WHAT IS MC-FOLD | MC-SYM ?

The MC-Fold | MC-Sym pipeline is a web-hosted service for RNA secondary and tertiary structure prediction. The pipeline means that the input sequence to MC-Fold outputs secondary structures that are direct input to MC-Sym, which outputs tertiary structures.

The vertical bar '|' is the symbol indicating pipeline processing in Unix, which was invented by Malcolm D. McIlroy.

Reference:

  1. Parisien M, Major F. Nature. (2008) 452:51-55. (pubmed) (Nature) (user's guide)



WHAT IS MC-FOLD ?

MC-Fold logo MC-Fold predicts secondary structures from sequence (black arrow). Compared to classical secondary structures that include the AU, CG, and Wobble GU base pairs that form the stems of the structure, MC-Fold's secondary structures include the other base pairing patterns as well. These are often called non-canonical base pairs.

⊕ MC-Fold's database folder
⊕ MC-Fold's user's guide

Reference:

  1. Parisien and Major. Nature (Supplementary Information)

MC-Fold :: sequence -> [secondary-structure]
Link to MC-Fold


♦ MC-Fold is available online via command line using the cURL program:

curl -Y 0 -y 300 -F "pass=lucy" -F "sequence=CCAGAUCUGAGCCUGGGAGCUCUCUGG" https://www.major.iric.ca/cgi-bin/MC-Fold/mcfold.static.cgi


♦ Compare the results of different secondary structure prediction programs using the following sequences:

♦ Alternative secondary structure prediction programs:


WHAT IS MC-SYM ?

MC-Sym logo MC-Sym builds tertiary structures from MC-Fold's secondary structures, which are provided as ASCII input scripts. No interactive computer graphics is needed. MC-Sym explores exhaustively or probabilistically the conformational search space of an RNA and produces structures that satisfies all input constraints.

⊕ MC-Sym's FAQ
⊕ MC-Sym's user's guide
⊕ MC-Sym's database folder
⊕ MC-Sym's database snapshot

References:

  1. Major et al. Science 1991.
  2. Major. Comp Sci Eng 2003.
MC-Sym :: secondary-structure -> [tertiary-structure]
Link to MC-Sym


♦ Here is a list of MC-Sym input scripts and PDB references:

PDB ID    MC-Sym    Reference    Type    Description
430D 430D.mcc 430D01.pdb Hairpin Rat 28S Loop E
1NBR 1NBR.mcc 1NBR01.pdb Hairpin Iron Responsive Element V-form
2HUA 2HUA.mcc 2HUA01.pdb Hairpin SCFV IRES Domain III
2GIO 2GIO.mcc 2GIO01.pdb Hairpin RNA Thermometer
2FDT 2FDT.mcc 2FDT01.pdb Hairpin UnaL2 Interspersed Element
2FEY 2FEY.mcc 2FEY01.pdb Hairpin Telomerase RNA Domain IV
2CD1 2CD1.mcc 2CD101.pdb Hairpin RNase P RNA P4
2EVY 2EVY.mcc 2EVY01.pdb Hairpin GNYA Tetraloop
2O33 2O33.mcc 2O3301.pdb Hairpin U2 snRNA
2AHT 2AHT.mcc 2AHT01.pdb Hairpin Group II Intron Branchsite
1NYI 1NYI.mcc 1NYI01.pdb Y-Shape Hammerhead Ribozyme
2HGH 2HGH.mcc 2HGH01.pdb Y-Shape 5S rRNA
2AP5 2AP5.mcc 2AP501.pdb Pseudoknot Yellow Leaf Virus
                 
2P89 [P1] [P1S] [P2] [P2S] 2P8901.pdb Complex H/ACA Box
[Whole]




WHAT IS MC-CONS ?

MC-Cons logo MC-Cons assigns a secondary structure for each sequence among the sequence's set of sub-optimal secondary structures, such that the set of assigned secondary structures maximizes the sum of pairwise structural similarity; the consensus assignment. MC-Cons can be seen as a filter between multiple-sequences and tertiary structure.

⊕ MC-Cons's user's guide

Reference:

  1. Parisien and Major. Nature (Supplementary Information)

MC-Cons :: [(sequence, [secondary-structure])] -> [(sequence, secondary-structure)]
Link to MC-Cons


♦ Alternative consensus structure and assignment programs:



DOT-BRACKET RENDERING

A tool for rendering dot-bracket structures is plot_rna of the CONTRAfold package (Do et al. Bioinformatics 2006).

Type or paste in your dot-bracket structures:


Index of the first nucleotide:


Here is an input example:

>ce TrxR
GACCUUUGGCUAAACUCCAUCGUGAGCGCCUCUGGUC
((((((((((..((((((...))))))))))))))))   -32.465
((((((((((...(((((...).))))))))))))))   -32.570

♦ Alternative rendering programs with pseudoknot capability:



MC-SYM SCRIPT GENERATOR

This program will generate an MC-Sym script that will build an RNA of the specified sequence and secondary structure. Please consider these points:

Type or paste in your sequence followed by your dot-bracket structure:



Clicking Submit will queue this job on the MC-Sym web server.
Clicking Advanced will bring a web page of options.
Please use with parsimony and good judgment!

Here is an input example:

>ce TrxR
GACCUUUGGCUAAACUCCAUCGUGAGCGCCUCUGGUC
((((((((((..((((((...))))))))))))))))

Here is another input example, with a pseudoknot:

>2TPK
UGACCAGCUAUGAGGUCAUACAUCGUCAUAGC
(((((.[[[[[[[))))).......]]]]]]]




RNA DOUBLE-HELIX GENERATOR

This program will generate an MC-Sym script that will build an RNA double-helix.

 1. Sequence 

  • An empty 3'-strand field indicates A=U/C=G double helix
  • The 3'-strand sequence must be entered 3' to 5'

  strand 5'- 
  strand 3'- 

♦ Alternative double-helix generators:





RNA INTERACTION NETWORK FIDELITY

This program will calculate the interaction network fidelity (INF) between two RNA 3-D structures based on their annotations.

 1. Structures 

  • Locate your reference and your model files
  • Files should be in the PDB format
  • Files cannot be compressed
  • Structures should have the same chain IDs and numberings

  Reference: 
  Model: 
  Method: MC-Annotate [1,2,3,4,5]
    RNAview [1,6]
    Consider stacking too! [3,4,5]
       
    [1] Leontis & Westhof. RNA. 2001
    [2] Lemieux & Major. Nucleic Acids Res. 2002
    [3] Gabb et al. J Mol Graph. 1996
    [4] Major & Thibault. in Bioinformatics: From Genomes to Therapies. 2007
    [5] Gendron et al. J Mol Biol. 2001
    [6] Yang et al. Nucleic Acids Res. 2003





RNA SEQUENCE MUTATION

This program will mutate the nucleobase identity to the specified sequence into the furnished 3D structure. This is useful to perform point mutations in a structure, or to replace non-canonical nucleobases by standard one.

 1. Sequence and Structure 

  • Locate your structure, specified in the PDB file format.
  • The structure should be stripped of all ions and water molecules.
  • The sequence progresses from the 5'-end to the 3'-end.

  Structure: 
  Sequence:  

Here is an input example:

Structure: PDB file 1EVV (without ions and water molecules).
Sequence:  GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA




CONTACT

RNA dance Many thanks to Patrick Gendron for managing Condor at the IRIC bioinformatics plateform and for helping us out with the distributed computation issues!

created: October 16, 2007
updated: August 05, 2009