m2sh version 0.2
Source code found in matureRNAi2shRNA_v2.cc
Compiled on Oct  6 2010
m2sh short help.

Generate shRNA hairpin given the mature RNAi. see Nature Methods vol.1 No.2 pp163-167 2004.

(For additional information type m2sh usage)
m2sh help.

Provide one mature RNAi string either as a parameter or via stdin.
It is especially usefull to use stdin if you have a series of mature sequences.
Uncertainties should respect IUPAC and unknows should be represented using underscore and not gap and will be treated as N.

this -- becomes --> that
A --         -- T
C --         -- G
G --         -- C
T --         -- A
U --         -- A
N -- A C G T -- N
Y -- C T     -- R
R -- A G     -- Y
W -- A T     -- W
S -- C G     -- S
M -- A C     -- K
K -- G T     -- M
B -- C G T   -- V
D -- A G T   -- H
H -- A C T   -- D
V -- A C G   -- B

The user specifies either the first or second position for the microRNA (parameter position).
By default the second position is used (3' arm).
And a mutation is introduced that disrupts the base pair which is farthest from the loop in order 
to destabilise that end. 
This mutation will never lead to a GU.
This mutation intruduction may be overriden (see parameters).
By default the sequences in the article are used.
To specify new sequences use the parameters head, loop and tail.


For more information on the parameters accepted type: m2sh help_parameters,


(For information on parameters, type m2sh help_parameters.)
Parameters accepted by m2sh
(a * indicates that the parameter is mandatory)

 PCR3Enzyme         user specified 5' end of 3' primer for PCR. Default is CTAAAGTAGCCCCTTGAAT (ECOR1)
 PCR5Enzyme         user specified 5' end of 5' primer for PCR. Default is CAGAAGGCTCGAGAAGGTATAT (XHO1)
 break_pair_one     Should drosha site be turned to a missmatch? (yes,no)[yes]
 debug_parameters   print actual parameters used for invoquing the program and exit
 file               a single file name to search for additionnal parameters.
 file_search_list   print list of files searched for defaults and exit.
 head               user specified 5' end of hairpin.
 help               print a short description of programs' behaviour and exit.
 help_parameters    print parameters accepted by this program and exit.
 loop               user specified loop region of hairpin.
 mat                mature sequence of RNAi.
 output             output format (html,text) [text].
 pcr                specify to generate new pcr primers.
 position           Given sequence is first or second (1, 2)[2].
 source             Provide path to source code main's.
 stdin              Just say yes to allow waiting on input.
 tail               user specified 3' end of hairpin.
 usage              print long description of programs' behaviour and exit
 version            report program name, version number and exit.