MC-Sym wrapper version: `Jul 22 2016` `09:31:18`
 Marc Parisien and Francois Major
@ University of Montreal
Parisien M, Major F. Nature (2008) 452:51-55.


Taking a snapshot of MC-Sym's database...
A link to the snapshot will be created at the bottom of this page!

MCSYM-DB/
MCSYM-DB/0/
MCSYM-DB/0/AAACUAA/
MCSYM-DB/0/AAACUAA/0-AAACUAA.mcs
MCSYM-DB/0/AAACUAA/ss-0-AAACUAA_x.pdb.gz
MCSYM-DB/0/AAACUAAA/
MCSYM-DB/0/AAACUAAA/0-AAACUAAA.mcs
MCSYM-DB/0/AAACUAAA/ss-0-AAACUAAA_x.pdb.gz
MCSYM-DB/0/AAACUCA/
MCSYM-DB/0/AAACUCA/0-AAACUCA.mcs
MCSYM-DB/0/AAACUCA/ss-0-AAACUCA_x.pdb.gz
MCSYM-DB/0/AAAGAAAG/
MCSYM-DB/0/AAAGAAAG/0-AAAGAAAG.mcs
MCSYM-DB/0/AAAGAAAG/ss-0-AAAGAAAG_x.pdb.gz
MCSYM-DB/0/AAAUCAAA/
MCSYM-DB/0/AAAUCAAA/0-AAAUCAAA.mcs
MCSYM-DB/0/AAAUCAAA/ss-0-AAAUCAAA_x.pdb.gz
MCSYM-DB/0/AAAUCCAU/
MCSYM-DB/0/AAAUCCAU/0-AAAUCCAU.mcs
MCSYM-DB/0/AAAUCCAU/ss-0-AAAUCCAU_x.pdb.gz
MCSYM-DB/0/AAAUGAA/
MCSYM-DB/0/AAAUGAA/0-AAAUGAA.mcs
MCSYM-DB/0/AAAUGAA/ss-0-AAAUGAA_x.pdb.gz
MCSYM-DB/0/AAAUGAAA/
MCSYM-DB/0/AAAUGAAA/0-AAAUGAAA.mcs
MCSYM-DB/0/AAAUGAAA/ss-0-AAAUGAAA_x.pdb.gz
MCSYM-DB/0/AAAUGCA/
MCSYM-DB/0/AAAUGCA/0-AAAUGCA.mcs
MCSYM-DB/0/AAAUGCA/ss-0-AAAUGCA_x.pdb.gz
MCSYM-DB/0/AACACAU/
MCSYM-DB/0/AACACAU/0-AACACAU.mcs
MCSYM-DB/0/AACACAU/ss-0-AACACAU_x.pdb.gz
MCSYM-DB/0/AACAGAA/
MCSYM-DB/0/AACAGAA/0-AACAGAA.mcs
MCSYM-DB/0/AACAGAA/ss-0-AACAGAA_x.pdb.gz
MCSYM-DB/0/AACAUUCU/
MCSYM-DB/0/AACAUUCU/0-AACAUUCU.mcs
MCSYM-DB/0/AACAUUCU/ss-0-AACAUUCU_x.pdb.gz
MCSYM-DB/0/AACCCCA/
MCSYM-DB/0/AACCCCA/0-AACCCCA.mcs
MCSYM-DB/0/AACUGCA/
MCSYM-DB/0/AACUGCA/0-AACUGCA.mcs
MCSYM-DB/0/AACUGCA/ss-0-AACUGCA_x.pdb.gz
MCSYM-DB/0/AAGAGAA/
MCSYM-DB/0/AAGAGAA/0-AAGAGAA.mcs
MCSYM-DB/0/AAGAGAA/ss-0-AAGAGAA_x.pdb.gz
MCSYM-DB/0/AAGGCAU/
MCSYM-DB/0/AAGGCAU/0-AAGGCAU.mcs
MCSYM-DB/0/AAGGCAU/ss-0-AAGGCAU_x.pdb.gz
MCSYM-DB/0/AAUGCCA/
MCSYM-DB/0/AAUGCCA/0-AAUGCCA.mcs
MCSYM-DB/0/AAUGCCA/ss-0-AAUGCCA_x.pdb.gz
MCSYM-DB/0/AAUGGUCA/
MCSYM-DB/0/AAUGGUCA/0-AAUGGUCA.mcs
MCSYM-DB/0/ACACACU/
MCSYM-DB/0/ACACACU/0-ACACACU.mcs
MCSYM-DB/0/ACACACU/ss-0-ACACACU_x.pdb.gz
MCSYM-DB/0/ACACUAC/
MCSYM-DB/0/ACACUAC/0-ACACUAC.mcs
MCSYM-DB/0/ACACUAC/ss-0-ACACUAC_x.pdb.gz
MCSYM-DB/0/ACACUCA/
MCSYM-DB/0/ACACUCA/0-ACACUCA.mcs
MCSYM-DB/0/ACACUCA/ss-0-ACACUCA_x.pdb.gz
MCSYM-DB/0/ACAGUCA/
MCSYM-DB/0/ACAGUCA/0-ACAGUCA.mcs
MCSYM-DB/0/ACAGUCA/ss-0-ACAGUCA_x.pdb.gz
MCSYM-DB/0/ACAUUAU/
MCSYM-DB/0/ACAUUAU/0-ACAUUAU.mcs
MCSYM-DB/0/ACAUUAU/ss-0-ACAUUAU_x.pdb.gz
MCSYM-DB/0/ACCGUUU/
MCSYM-DB/0/ACCGUUU/0-ACCGUUU.mcs
MCSYM-DB/0/ACCGUUU/ss-0-ACCGUUU_x.pdb.gz
MCSYM-DB/0/ACCUCCA/
MCSYM-DB/0/ACCUCCA/0-ACCUCCA.mcs
MCSYM-DB/0/ACCUCCA/ss-0-ACCUCCA_x.pdb.gz
MCSYM-DB/0/ACCUUUU/
MCSYM-DB/0/ACCUUUU/0-ACCUUUU.mcs
MCSYM-DB/0/ACCUUUU/0-ACCUUUU.pdb.gz
MCSYM-DB/0/ACUAUUA/
MCSYM-DB/0/ACUAUUA/0-ACUAUUA.mcs
MCSYM-DB/0/ACUAUUA/ss-0-ACUAUUA_x.pdb.gz
MCSYM-DB/0/ACUCGUU/
MCSYM-DB/0/ACUCGUU/0-ACUCGUU.mcs
MCSYM-DB/0/ACUCGUU/ss-0-ACUCGUU_x.pdb.gz
MCSYM-DB/0/AGAAAAA/
MCSYM-DB/0/AGAAAAA/0-AGAAAAA.mcs
MCSYM-DB/0/AGAAAAA/ss-0-AGAAAAA_x.pdb.gz
MCSYM-DB/0/AGACUAAA/
MCSYM-DB/0/AGACUAAA/0-AGACUAAA.mcs
MCSYM-DB/0/AGACUAAA/ss-0-AGACUAAA_x.pdb.gz
MCSYM-DB/0/AGAUUGU/
MCSYM-DB/0/AGAUUGU/0-AGAUUGU.mcs
MCSYM-DB/0/AGAUUGU/ss-0-AGAUUGU_x.pdb.gz
MCSYM-DB/0/AGGGUGA/
MCSYM-DB/0/AGGGUGA/0-AGGGUGA.mcs
MCSYM-DB/0/AGGGUGA/ss-0-AGGGUGA_x.pdb.gz
MCSYM-DB/0/AGGUUGU/
MCSYM-DB/0/AGGUUGU/0-AGGUUGU.mcs
MCSYM-DB/0/AGGUUGU/ss-0-AGGUUGU_x.pdb.gz
MCSYM-DB/0/AGUUGGG/
MCSYM-DB/0/AGUUGGG/0-AGUUGGG.mcs
MCSYM-DB/0/AGUUGGG/ss-0-AGUUGGG_x.pdb.gz
MCSYM-DB/0/AUAUGUG/
MCSYM-DB/0/AUAUGUG/0-AUAUGUG.mcs
MCSYM-DB/0/AUGGUUA/
MCSYM-DB/0/AUGGUUA/0-AUGGUUA.mcs
MCSYM-DB/0/AUGGUUA/ss-0-AUGGUUA_x.pdb.gz
MCSYM-DB/0/CAAAGCG/
MCSYM-DB/0/CAAAGCG/0-CAAAGCG.mcs
MCSYM-DB/0/CAAAGCG/ss-0-CAAAGCG_x.pdb.gz
MCSYM-DB/0/CAAUCAA/
MCSYM-DB/0/CAAUCAA/0-CAAUCAA.mcs
MCSYM-DB/0/CAAUCAA/ss-0-CAAUCAA_x.pdb.gz
MCSYM-DB/0/CACACCA/
MCSYM-DB/0/CACACCA/0-CACACCA.mcs
MCSYM-DB/0/CACACCA/ss-0-CACACCA_x.pdb.gz
MCSYM-DB/0/CACUCAG/
MCSYM-DB/0/CACUCAG/0-CACUCAG.mcs
MCSYM-DB/0/CACUCAG/ss-0-CACUCAG_x.pdb.gz
MCSYM-DB/0/CAGUUGGG/
MCSYM-DB/0/CAGUUGGG/0-CAGUUGGG.mcs
MCSYM-DB/0/CAGUUGGG/ss-0-CAGUUGGG_x.pdb.gz
MCSYM-DB/0/CAUGCCG/
MCSYM-DB/0/CAUGCCG/0-CAUGCCG.mcs
MCSYM-DB/0/CAUGCCG/1MJI_model_1.pdb.gz
MCSYM-DB/0/CAUGUAG/
MCSYM-DB/0/CAUGUAG/0-CAUGUAG.mcs
MCSYM-DB/0/CAUGUAG/ss-0-CAUGUAG_x.pdb.gz
MCSYM-DB/0/CCAUCAC/
MCSYM-DB/0/CCAUCAC/0-CCAUCAC.mcs
MCSYM-DB/0/CCAUCAC/ss-0-CCAUCAC_x.pdb.gz
MCSYM-DB/0/CCAUUCC/
MCSYM-DB/0/CCAUUCC/0-CCAUUCC.mcs
MCSYM-DB/0/CCAUUCC/ss-0-CCAUUCC_x.pdb.gz
MCSYM-DB/0/CCUGGGAG/
MCSYM-DB/0/CCUGGGAG/0-CCUGGGAG.mcs
MCSYM-DB/0/CCUGGGAG/1KIS_model_1.pdb.gz
MCSYM-DB/0/CCUGGGAG/1LVJ_model_1.pdb.gz
MCSYM-DB/0/CCUGGGAG/1QD3_model_1.pdb.gz
MCSYM-DB/0/CCUGGGAG/1UUD_model_1.pdb.gz
MCSYM-DB/0/CGAGAAG/
MCSYM-DB/0/CGAGAAG/0-CGAGAAG.mcs
MCSYM-DB/0/CGAGAAG/0-CGAGAAG_x.pdb.gz
MCSYM-DB/0/CGAGAAG/1NEM_model_1.pdb.gz
MCSYM-DB/0/CGAUAGAG/
MCSYM-DB/0/CGAUAGAG/0-CGAUAGAG.mcs
MCSYM-DB/0/CGAUAGAG/ss-0-CGAUAGAG_x.pdb.gz
MCSYM-DB/0/CGGAGGG/
MCSYM-DB/0/CGGAGGG/0-CGGAGGG.mcs
MCSYM-DB/0/CGGAGGG/ss-0-CGGAGGG_x.pdb.gz
MCSYM-DB/0/CGGCGGG/
MCSYM-DB/0/CGGCGGG/0-CGGCGGG.mcs
MCSYM-DB/0/CGGCGGG/ss-0-CGGCGGG_x.pdb.gz
MCSYM-DB/0/CGUUUGG/
MCSYM-DB/0/CGUUUGG/0-CGUUUGG.mcs
MCSYM-DB/0/CGUUUGG/ss-0-CGUUUGG_x.pdb.gz
MCSYM-DB/0/CUAGUCAC/
MCSYM-DB/0/CUAGUCAC/0-CUAGUCAC.mcs
MCSYM-DB/0/CUGCUUC/
MCSYM-DB/0/CUGCUUC/0-CUGCUUC.mcs
MCSYM-DB/0/CUGCUUC/ss-0-CUGCUUC_x.pdb.gz
MCSYM-DB/0/CUGUAGC/
MCSYM-DB/0/CUGUAGC/0-CUGUAGC.mcs
MCSYM-DB/0/CUGUAGC/ss-0-CUGUAGC_x.pdb.gz
MCSYM-DB/0/GAACUAA/
MCSYM-DB/0/GAACUAA/0-GAACUAA.mcs
MCSYM-DB/0/GAACUAA/ss-0-GAACUAA_x.pdb.gz
MCSYM-DB/0/GAACUAAA/
MCSYM-DB/0/GAACUAAA/0-GAACUAAA.mcs
MCSYM-DB/0/GAACUAAA/ss-0-GAACUAAA_x.pdb.gz
MCSYM-DB/0/GAAGUAC/
MCSYM-DB/0/GAAGUAC/0-GAAGUAC.mcs
MCSYM-DB/0/GAAGUAC/ss-0-GAAGUAC_x.pdb.gz
MCSYM-DB/0/GAAUAGAG/
MCSYM-DB/0/GAAUAGAG/0-GAAUAGAG.mcs
MCSYM-DB/0/GAAUAGAG/ss-0-GAAUAGAG_x.pdb.gz
MCSYM-DB/0/GAAUCCAC/
MCSYM-DB/0/GAAUCCAC/0-GAAUCCAC.mcs
MCSYM-DB/0/GAAUCCAC/ss-0-GAAUCCAC_x.pdb.gz
MCSYM-DB/0/GAGCUAC/
MCSYM-DB/0/GAGCUAC/0-GAGCUAC.mcs
MCSYM-DB/0/GAGCUAC/ss-0-GAGCUAC_x.pdb.gz
MCSYM-DB/0/GAGGGCU/
MCSYM-DB/0/GAGGGCU/0-GAGGGCU.mcs
MCSYM-DB/0/GAGGGCU/ss-0-GAGGGCU_x.pdb.gz
MCSYM-DB/0/GCACAUU/
MCSYM-DB/0/GCACAUU/0-GCACAUU.mcs
MCSYM-DB/0/GCACAUU/ss-0-GCACAUU_x.pdb.gz
MCSYM-DB/0/GCAGCUC/
MCSYM-DB/0/GCAGCUC/0-GCAGCUC.mcs
MCSYM-DB/0/GCAGCUC/ss-0-GCAGCUC_x.pdb.gz
MCSYM-DB/0/GCGCCGAC/
MCSYM-DB/0/GCGCCGAC/0-GCGCCGAC.mcs
MCSYM-DB/0/GCGCCGAC/ss-0-GCGCCGAC_x.pdb.gz
MCSYM-DB/0/GGAACGC/
MCSYM-DB/0/GGAACGC/0-GGAACGC.mcs
MCSYM-DB/0/GGAACGC/ss-0-GGAACGC_x.pdb.gz
MCSYM-DB/0/GGUUGGG/
MCSYM-DB/0/GGUUGGG/0-GGUUGGG.mcs
MCSYM-DB/0/GGUUGGG/ss-0-GGUUGGG_x.pdb.gz
MCSYM-DB/0/GUACUAG/
MCSYM-DB/0/GUACUAG/0-GUACUAG.mcs
MCSYM-DB/0/GUACUAG/ss-0-GUACUAG_x.pdb.gz
MCSYM-DB/0/GUUUAGUU/
MCSYM-DB/0/GUUUAGUU/0-GUUUAGUU.mcs
MCSYM-DB/0/UAACUCA/
MCSYM-DB/0/UAACUCA/0-UAACUCA.mcs
MCSYM-DB/0/UAACUCA/ss-0-UAACUCA_x.pdb.gz
MCSYM-DB/0/UAAGAAG/
MCSYM-DB/0/UAAGAAG/0-UAAGAAG.mcs
MCSYM-DB/0/UAAGAAG/ss-0-UAAGAAG_x.pdb.gz
MCSYM-DB/0/UAAUUAA/
MCSYM-DB/0/UAAUUAA/0-UAAUUAA.mcs
MCSYM-DB/0/UAAUUAA/ss-0-UAAUUAA_x.pdb.gz
MCSYM-DB/0/UACAGCA/
MCSYM-DB/0/UACAGCA/0-UACAGCA.mcs
MCSYM-DB/0/UACAGCA/ss-0-UACAGCA_x.pdb.gz
MCSYM-DB/0/UACGGCG/
MCSYM-DB/0/UACGGCG/0-UACGGCG.mcs
MCSYM-DB/0/UACGGCG/ss-0-UACGGCG_x.pdb.gz
MCSYM-DB/0/UACUCAU/
MCSYM-DB/0/UACUCAU/0-UACUCAU.mcs
MCSYM-DB/0/UACUCAU/ss-0-UACUCAU_x.pdb.gz
MCSYM-DB/0/UACUGCU/
MCSYM-DB/0/UACUGCU/0-UACUGCU.mcs
MCSYM-DB/0/UACUGCU/ss-0-UACUGCU_x.pdb.gz
MCSYM-DB/0/UCACUUA/
MCSYM-DB/0/UCACUUA/0-UCACUUA.mcs
MCSYM-DB/0/UCACUUA/ss-0-UCACUUA_x.pdb.gz
MCSYM-DB/0/UCAGAUA/
MCSYM-DB/0/UCAGAUA/0-UCAGAUA.mcs
MCSYM-DB/0/UCAGAUA/ss-0-UCAGAUA_x.pdb.gz
MCSYM-DB/0/UCAUCAA/
MCSYM-DB/0/UCAUCAA/0-UCAUCAA.mcs
MCSYM-DB/0/UCAUCAA/ss-0-UCAUCAA_x.pdb.gz
MCSYM-DB/0/UCAUCUA/
MCSYM-DB/0/UCAUCUA/0-UCAUCUA.mcs
MCSYM-DB/0/UCAUCUA/ss-0-UCAUCUA_x.pdb.gz
MCSYM-DB/0/UCAUUUU/
MCSYM-DB/0/UCAUUUU/0-UCAUUUU.mcs
MCSYM-DB/0/UCAUUUU/ss-0-UCAUUUU_x.pdb.gz
MCSYM-DB/0/UCCAUAA/
MCSYM-DB/0/UCCAUAA/0-UCCAUAA.mcs
MCSYM-DB/0/UCCAUAA/ss-0-UCCAUAA_x.pdb.gz
MCSYM-DB/0/UCCCUAU/
MCSYM-DB/0/UCCCUAU/0-UCCCUAU.mcs
MCSYM-DB/0/UCCCUAU/ss-0-UCCCUAU_x.pdb.gz
MCSYM-DB/0/UCCGUAUG/
MCSYM-DB/0/UCCGUAUG/0-UCCGUAUG.mcs
MCSYM-DB/0/UCCGUAUG/ss-0-UCCGUAUG_x.pdb.gz
MCSYM-DB/0/UCCUUUG/
MCSYM-DB/0/UCCUUUG/0-UCCUUUG.mcs
MCSYM-DB/0/UCCUUUG/ss-0-UCCUUUG_x.pdb.gz
MCSYM-DB/0/UCGUUAG/
MCSYM-DB/0/UCGUUAG/0-UCGUUAG.mcs
MCSYM-DB/0/UCGUUAG/ss-0-UCGUUAG_x.pdb.gz
MCSYM-DB/0/UGUCUGA/
MCSYM-DB/0/UGUCUGA/0-UGUCUGA.mcs
MCSYM-DB/0/UGUCUGA/ss-0-UGUCUGA_x.pdb.gz
MCSYM-DB/0/UGUCUGAA/
MCSYM-DB/0/UGUCUGAA/0-UGUCUGAA.mcs
MCSYM-DB/0/UGUCUGAA/ss-0-UGUCUGAA_x.pdb.gz
MCSYM-DB/0/UUACCUU/
MCSYM-DB/0/UUACCUU/0-UUACCUU.mcs
MCSYM-DB/0/UUACCUU/ss-0-UUACCUU_x.pdb.gz
MCSYM-DB/0/UUCUGUCU/
MCSYM-DB/0/UUCUGUCU/0-UUCUGUCU.mcs
MCSYM-DB/0/UUCUGUCU/ss-0-UUCUGUCU_x.pdb.gz
MCSYM-DB/0/UUUAGCUA/
MCSYM-DB/0/UUUAGCUA/0-UUUAGCUA.mcs
MCSYM-DB/0/UUUAGCUA/1TOB_model_1.pdb.gz
MCSYM-DB/1_1/
MCSYM-DB/1_1/CAAA/
MCSYM-DB/1_1/CCGG/
MCSYM-DB/1_4_1/
MCSYM-DB/1_4_1/CAUCGG/
MCSYM-DB/2/
MCSYM-DB/2/CA/
MCSYM-DB/2/GG/
MCSYM-DB/2/GG/2-GG.mcs
MCSYM-DB/2/GG/ss-2-GG_x.pdb.gz
MCSYM-DB/2/GU/
MCSYM-DB/2/GU/2-GU.mcs
MCSYM-DB/2/GU/ss-2-GU_x.pdb.gz
MCSYM-DB/20/
MCSYM-DB/20/GCUUUGCCCAUCGGGGCCGC/
MCSYM-DB/2K4C.pdb/
MCSYM-DB/2_2/
MCSYM-DB/2_2/AA/
MCSYM-DB/2_2/AAAA/
MCSYM-DB/2_2/AAAA/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/283D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAA/2_2-AAAA.mcs
MCSYM-DB/2_2/AAAA/ds-2_2-AAAA_x.pdb.gz
MCSYM-DB/2_2/AAAC/
MCSYM-DB/2_2/AAAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAC/2_2-AAAC.mcs
MCSYM-DB/2_2/AAAC/ds-2_2-AAAC_x.pdb.gz
MCSYM-DB/2_2/AAAG/
MCSYM-DB/2_2/AAAG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAG/2_2-AAAG.mcs
MCSYM-DB/2_2/AAAG/ds-2_2-AAAG_x.pdb.gz
MCSYM-DB/2_2/AAAU/
MCSYM-DB/2_2/AAAU/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAAU/2_2-AAAU.mcs
MCSYM-DB/2_2/AAAU/ds-2_2-AAAU_x.pdb.gz
MCSYM-DB/2_2/AACA/
MCSYM-DB/2_2/AACA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACA/2_2-AACA.mcs
MCSYM-DB/2_2/AACA/ds-2_2-AACA_x.pdb.gz
MCSYM-DB/2_2/AACC/
MCSYM-DB/2_2/AACC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACC/2_2-AACC.mcs
MCSYM-DB/2_2/AACC/ds-2_2-AACC_x.pdb.gz
MCSYM-DB/2_2/AACG/
MCSYM-DB/2_2/AACG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/AACG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/AACG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AACG/2_2-AACG.mcs
MCSYM-DB/2_2/AACG/ds-2_2-AACG_x.pdb.gz
MCSYM-DB/2_2/AACGU/
MCSYM-DB/2_2/AACU/
MCSYM-DB/2_2/AACU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACU/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACU/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACU/2_2-AACU.mcs
MCSYM-DB/2_2/AACU/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AACU/ds-2_2-AACU_x.pdb.gz
MCSYM-DB/2_2/AAGA/
MCSYM-DB/2_2/AAGA/1F84_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/283D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGA/2_2-AAGA.mcs
MCSYM-DB/2_2/AAGA/ds-2_2-AAGA_x.pdb.gz
MCSYM-DB/2_2/AAGC/
MCSYM-DB/2_2/AAGC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/AAGC/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGC/2_2-AAGC.mcs
MCSYM-DB/2_2/AAGC/ds-2_2-AAGC_x.pdb.gz
MCSYM-DB/2_2/AAGG/
MCSYM-DB/2_2/AAGG/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/AAGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AAGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGG/2_2-AAGG.mcs
MCSYM-DB/2_2/AAGG/ds-2_2-AAGG_x.pdb.gz
MCSYM-DB/2_2/AAGU/
MCSYM-DB/2_2/AAGU/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/28SP_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/2_2-AAGU.mcs
MCSYM-DB/2_2/AAGU/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAGU/ds-2_2-AAGU_x.pdb.gz
MCSYM-DB/2_2/AAUA/
MCSYM-DB/2_2/AAUA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUA/2_2-AAUA.mcs
MCSYM-DB/2_2/AAUA/ds-2_2-AAUA_x.pdb
MCSYM-DB/2_2/AAUA/ds-2_2-AAUA_x.pdb.gz
MCSYM-DB/2_2/AAUC/
MCSYM-DB/2_2/AAUC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUC/2_2-AAUC.mcs
MCSYM-DB/2_2/AAUC/ds-2_2-AAUC_x.pdb
MCSYM-DB/2_2/AAUC/ds-2_2-AAUC_x.pdb.gz
MCSYM-DB/2_2/AAUG/
MCSYM-DB/2_2/AAUG/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/AAUG/2_2-AAUG.mcs
MCSYM-DB/2_2/AAUG/ds-2_2-AAUG_x.pdb
MCSYM-DB/2_2/AAUG/ds-2_2-AAUG_x.pdb.gz
MCSYM-DB/2_2/AAUU/
MCSYM-DB/2_2/AAUU/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1-2_2-AAUU_t.pdb.gz
MCSYM-DB/2_2/AAUU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1A34_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1A60_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2D17_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1YYW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/ds-2_2-AAUU_x.pdb
MCSYM-DB/2_2/AAUU/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/ds-2_2-AAUU_x.pdb.gz
MCSYM-DB/2_2/AAUU/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1M82_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2_2-AAUU.mcs
MCSYM-DB/2_2/AAUU/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/2G92_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AAUU/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AC/
MCSYM-DB/2_2/ACAA/
MCSYM-DB/2_2/ACAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAA/2_2-ACAA.mcs
MCSYM-DB/2_2/ACAA/ds-2_2-ACAA_x.pdb.gz
MCSYM-DB/2_2/ACAC/
MCSYM-DB/2_2/ACAC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAC/2_2-ACAC.mcs
MCSYM-DB/2_2/ACAC/ds-2_2-ACAC_x.pdb.gz
MCSYM-DB/2_2/ACAG/
MCSYM-DB/2_2/ACAG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAG/2_2-ACAG.mcs
MCSYM-DB/2_2/ACAG/ds-2_2-ACAG_x.pdb.gz
MCSYM-DB/2_2/ACAU/
MCSYM-DB/2_2/ACAU/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/2_2-ACAU.mcs
MCSYM-DB/2_2/ACAU/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACAU/ds-2_2-ACAU_x.pdb.gz
MCSYM-DB/2_2/ACCA/
MCSYM-DB/2_2/ACCA/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCA/2_2-ACCA.mcs
MCSYM-DB/2_2/ACCA/ds-2_2-ACCA_x.pdb.gz
MCSYM-DB/2_2/ACCC/
MCSYM-DB/2_2/ACCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCC/2_2-ACCC.mcs
MCSYM-DB/2_2/ACCC/ds-2_2-ACCC_x.pdb.gz
MCSYM-DB/2_2/ACCG/
MCSYM-DB/2_2/ACCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCG/2_2-ACCG.mcs
MCSYM-DB/2_2/ACCG/ds-2_2-ACCG_x.pdb.gz
MCSYM-DB/2_2/ACCU/
MCSYM-DB/2_2/ACCU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCU/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/ACCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCU/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACCU/2_2-ACCU.mcs
MCSYM-DB/2_2/ACCU/ds-2_2-ACCU_x.pdb.gz
MCSYM-DB/2_2/ACGA/
MCSYM-DB/2_2/ACGA/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/2D18_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/ACGA/2_2-ACGA.mcs
MCSYM-DB/2_2/ACGA/ds-2_2-ACGA_x.pdb.gz
MCSYM-DB/2_2/ACGAU/
MCSYM-DB/2_2/ACGC/
MCSYM-DB/2_2/ACGC/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/2_2-ACGC.mcs
MCSYM-DB/2_2/ACGC/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGC/ds-2_2-ACGC_x.pdb.gz
MCSYM-DB/2_2/ACGG/
MCSYM-DB/2_2/ACGG/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/5MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/ACGG.txt
MCSYM-DB/2_2/ACGG/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/ds-2_2-ACGG_x.pdb.gz
MCSYM-DB/2_2/ACGG/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1MIS_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/2_2-ACGG.mcs
MCSYM-DB/2_2/ACGG/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/ACGG/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/
MCSYM-DB/2_2/ACGU/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1-2_2-ACGU_t.pdb.gz
MCSYM-DB/2_2/ACGU/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1B36_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1N66_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1I9X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2_2-ACGU.mcs
MCSYM-DB/2_2/ACGU/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KOD_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1JZV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ROQ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1G70_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1I46_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1IK1_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1T28_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1RPU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1UUU_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YTU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1YVP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BGG_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BS0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BS1_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2BS1_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2D17_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2D18_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2ESI_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2F88_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/377D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/377D_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/422D_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/429D_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/433D_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/484D_model_1.pdb.gz
MCSYM-DB/2_2/ACGU/ds-2_2-ACGU_x.pdb
MCSYM-DB/2_2/ACGU/ds-2_2-ACGU_x.pdb.gz
MCSYM-DB/2_2/ACUA/
MCSYM-DB/2_2/ACUA/1B36_model_1.pdb.gz
MCSYM-DB/2_2/ACUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/ACUA/2_2-ACUA.mcs
MCSYM-DB/2_2/ACUA/ds-2_2-ACUA_x.pdb.gz
MCSYM-DB/2_2/ACUC/
MCSYM-DB/2_2/ACUC/2_2-ACUC.mcs
MCSYM-DB/2_2/ACUC/ds-2_2-ACUC_x.pdb.gz
MCSYM-DB/2_2/ACUG/
MCSYM-DB/2_2/ACUG/2_2-ACUG.mcs
MCSYM-DB/2_2/ACUG/ds-2_2-ACUG_x.pdb.gz
MCSYM-DB/2_2/ACUU/
MCSYM-DB/2_2/ACUU/2_2-ACUU.mcs
MCSYM-DB/2_2/ACUU/ds-2_2-ACUU_x.pdb.gz
MCSYM-DB/2_2/AGAA/
MCSYM-DB/2_2/AGAA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAA/2_2-AGAA.mcs
MCSYM-DB/2_2/AGAA/ds-2_2-AGAA_x.pdb.gz
MCSYM-DB/2_2/AGAC/
MCSYM-DB/2_2/AGAC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAC/2_2-AGAC.mcs
MCSYM-DB/2_2/AGAC/ds-2_2-AGAC_x.pdb.gz
MCSYM-DB/2_2/AGAG/
MCSYM-DB/2_2/AGAG/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/AGAG/2_2-AGAG.mcs
MCSYM-DB/2_2/AGAG/ds-2_2-AGAG_x.pdb.gz
MCSYM-DB/2_2/AGAU/
MCSYM-DB/2_2/AGAU/1A60_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1O15_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/2_2-AGAU.mcs
MCSYM-DB/2_2/AGAU/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/484D_model_1.pdb.gz
MCSYM-DB/2_2/AGAU/ds-2_2-AGAU_x.pdb.gz
MCSYM-DB/2_2/AGCA/
MCSYM-DB/2_2/AGCA/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/AGCA/2_2-AGCA.mcs
MCSYM-DB/2_2/AGCA/ds-2_2-AGCA_x.pdb.gz
MCSYM-DB/2_2/AGCC/
MCSYM-DB/2_2/AGCC/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/2_2-AGCC.mcs
MCSYM-DB/2_2/AGCC/402D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCC/ds-2_2-AGCC_x.pdb.gz
MCSYM-DB/2_2/AGCG/
MCSYM-DB/2_2/AGCG/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1E7K_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1F84_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/ds-2_2-AGCG_x.pdb.gz
MCSYM-DB/2_2/AGCG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1N66_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1RLG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1SA9_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1SAQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/28SP_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCG/2_2-AGCG.mcs
MCSYM-DB/2_2/AGCU/
MCSYM-DB/2_2/AGCU/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1-2_2-AGCU_t.pdb.gz
MCSYM-DB/2_2/AGCU/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1A60_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1N53_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1N66_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I9X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1E95_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1G70_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1HJI_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JU7_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/ds-2_2-AGCU_x.pdb
MCSYM-DB/2_2/AGCU/2_2-AGCU.mcs
MCSYM-DB/2_2/AGCU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2D17_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/435D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/6MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGCU/ds-2_2-AGCU_x.pdb.gz
MCSYM-DB/2_2/AGGA/
MCSYM-DB/2_2/AGGA/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGA/2_2-AGGA.mcs
MCSYM-DB/2_2/AGGA/ds-2_2-AGGA_x.pdb.gz
MCSYM-DB/2_2/AGGC/
MCSYM-DB/2_2/AGGC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGC/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGC/2_2-AGGC.mcs
MCSYM-DB/2_2/AGGC/ds-2_2-AGGC_x.pdb.gz
MCSYM-DB/2_2/AGGG/
MCSYM-DB/2_2/AGGG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/AGGG/2_2-AGGG.mcs
MCSYM-DB/2_2/AGGG/ds-2_2-AGGG_x.old.gz
MCSYM-DB/2_2/AGGG/ds-2_2-AGGG_x.pdb.gz
MCSYM-DB/2_2/AGGG/ncm_1.mcs
MCSYM-DB/2_2/AGGU/
MCSYM-DB/2_2/AGGU/1A51_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1AM0_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/2_2-AGGU.mcs
MCSYM-DB/2_2/AGGU/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGGU/ds-2_2-AGGU_x.pdb.gz
MCSYM-DB/2_2/AGUA/
MCSYM-DB/2_2/AGUA/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUA/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/AGUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUA/2_2-AGUA.mcs
MCSYM-DB/2_2/AGUA/ds-2_2-AGUA_x.pdb.gz
MCSYM-DB/2_2/AGUC/
MCSYM-DB/2_2/AGUC/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/AGUC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUC/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUC/2_2-AGUC.mcs
MCSYM-DB/2_2/AGUC/ds-2_2-AGUC_x.pdb.gz
MCSYM-DB/2_2/AGUG/
MCSYM-DB/2_2/AGUG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1F85_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/2_2-AGUG.mcs
MCSYM-DB/2_2/AGUG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUG/ds-2_2-AGUG_x.pdb.gz
MCSYM-DB/2_2/AGUU/
MCSYM-DB/2_2/AGUU/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1M82_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1QES_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/2F88_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/2_2-AGUU.mcs
MCSYM-DB/2_2/AGUU/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AGUU/ds-2_2-AGUU_x.pdb.gz
MCSYM-DB/2_2/ATAT/
MCSYM-DB/2_2/ATAT/2_2-ATAT.mcs
MCSYM-DB/2_2/AUAA/
MCSYM-DB/2_2/AUAA/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAA/2_2-AUAA.mcs
MCSYM-DB/2_2/AUAA/ds-2_2-AUAA_x.pdb.gz
MCSYM-DB/2_2/AUAC/
MCSYM-DB/2_2/AUAC/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/2_2-AUAC.mcs
MCSYM-DB/2_2/AUAC/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAC/ds-2_2-AUAC_x.pdb.gz
MCSYM-DB/2_2/AUAG/
MCSYM-DB/2_2/AUAG/1A60_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/2_2-AUAG.mcs
MCSYM-DB/2_2/AUAG/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/484D_model_1.pdb.gz
MCSYM-DB/2_2/AUAG/ds-2_2-AUAG_x.pdb
MCSYM-DB/2_2/AUAG/ds-2_2-AUAG_x.pdb.gz
MCSYM-DB/2_2/AUAU/
MCSYM-DB/2_2/AUAU/1-2_2-AUAU_t.pdb.gz
MCSYM-DB/2_2/AUAU/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/246D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/419D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1J4Y_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2C4Y_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2C4Z_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1RNA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2G92_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/2_2-AUAU.mcs
MCSYM-DB/2_2/AUAU/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1YYW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/485D_R10_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUAU/ds-2_2-AUAU_x.pdb
MCSYM-DB/2_2/AUAU/ds-2_2-AUAU_x.pdb.gz
MCSYM-DB/2_2/AUCA/
MCSYM-DB/2_2/AUCA/2_2-AUCA.mcs
MCSYM-DB/2_2/AUCA/ds-2_2-AUCA_x.pdb.gz
MCSYM-DB/2_2/AUCC/
MCSYM-DB/2_2/AUCC/2_2-AUCC.mcs
MCSYM-DB/2_2/AUCC/ds-2_2-AUCC_x.pdb.gz
MCSYM-DB/2_2/AUCG/
MCSYM-DB/2_2/AUCG/2_2-AUCG.mcs
MCSYM-DB/2_2/AUCG/ds-2_2-AUCG_x.pdb.gz
MCSYM-DB/2_2/AUCU/
MCSYM-DB/2_2/AUCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUCU/2_2-AUCU.mcs
MCSYM-DB/2_2/AUCU/ds-2_2-AUCU_x.pdb.gz
MCSYM-DB/2_2/AUG/
MCSYM-DB/2_2/AUGA/
MCSYM-DB/2_2/AUGA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGA/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/AUGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGA/2_2-AUGA.mcs
MCSYM-DB/2_2/AUGA/ds-2_2-AUGA_x.pdb.gz
MCSYM-DB/2_2/AUGC/
MCSYM-DB/2_2/AUGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGC/2_2-AUGC.mcs
MCSYM-DB/2_2/AUGC/ds-2_2-AUGC_x.pdb.gz
MCSYM-DB/2_2/AUGG/
MCSYM-DB/2_2/AUGG/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/AUGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGG/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/AUGG/2_2-AUGG.mcs
MCSYM-DB/2_2/AUGG/ds-2_2-AUGG_x.pdb.gz
MCSYM-DB/2_2/AUGU/
MCSYM-DB/2_2/AUGU/17RA_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1A51_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/ds-2_2-AUGU_x.pdb.gz
MCSYM-DB/2_2/AUGU/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1FUF_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1IK5_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1QET_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1ROQ_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1T28_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2F88_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/2_2-AUGU.mcs
MCSYM-DB/2_2/AUGU/315D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUGU/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUA/
MCSYM-DB/2_2/AUUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUA/2_2-AUUA.mcs
MCSYM-DB/2_2/AUUA/ds-2_2-AUUA_x.pdb.gz
MCSYM-DB/2_2/AUUC/
MCSYM-DB/2_2/AUUC/2_2-AUUC.mcs
MCSYM-DB/2_2/AUUC/ds-2_2-AUUC_x.pdb.gz
MCSYM-DB/2_2/AUUG/
MCSYM-DB/2_2/AUUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUG/2_2-AUUG.mcs
MCSYM-DB/2_2/AUUG/ds-2_2-AUUG_x.pdb.gz
MCSYM-DB/2_2/AUUU/
MCSYM-DB/2_2/AUUU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUU/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/AUUU/2_2-AUUU.mcs
MCSYM-DB/2_2/AUUU/ds-2_2-AUUU_x.pdb
MCSYM-DB/2_2/AUUU/ds-2_2-AUUU_x.pdb.gz
MCSYM-DB/2_2/C-UA/
MCSYM-DB/2_2/C-UA/2_2-C-UA.mcs
MCSYM-DB/2_2/CA/
MCSYM-DB/2_2/CAAA/
MCSYM-DB/2_2/CAAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAA/2_2-CAAA.mcs
MCSYM-DB/2_2/CAAA/ds-2_2-CAAA_x.pdb.gz
MCSYM-DB/2_2/CAAC/
MCSYM-DB/2_2/CAAC/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAC/2_2-CAAC.mcs
MCSYM-DB/2_2/CAAC/ds-2_2-CAAC_x.pdb.gz
MCSYM-DB/2_2/CAAG/
MCSYM-DB/2_2/CAAG/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CAAG/2_2-CAAG.mcs
MCSYM-DB/2_2/CAAG/ds-2_2-CAAG_x.pdb.gz
MCSYM-DB/2_2/CAAU/
MCSYM-DB/2_2/CAAU/2_2-CAAU.mcs
MCSYM-DB/2_2/CAAU/ds-2_2-CAAU_x.pdb.gz
MCSYM-DB/2_2/CACA/
MCSYM-DB/2_2/CACA/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACA/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACA/2_2-CACA.mcs
MCSYM-DB/2_2/CACA/402D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACA/ds-2_2-CACA_x.pdb.gz
MCSYM-DB/2_2/CACC/
MCSYM-DB/2_2/CACC/2_2-CACC.mcs
MCSYM-DB/2_2/CACC/ds-2_2-CACC_x.pdb.gz
MCSYM-DB/2_2/CACG/
MCSYM-DB/2_2/CACG/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/CACG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CACG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACG/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CACG/2_2-CACG.mcs
MCSYM-DB/2_2/CACG/ds-2_2-CACG_x.pdb.gz
MCSYM-DB/2_2/CACU/
MCSYM-DB/2_2/CACU/2_2-CACU.mcs
MCSYM-DB/2_2/CACU/ds-2_2-CACU_x.pdb.gz
MCSYM-DB/2_2/CAGA/
MCSYM-DB/2_2/CAGA/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/CAGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGA/2_2-CAGA.mcs
MCSYM-DB/2_2/CAGA/ds-2_2-CAGA_x.pdb.gz
MCSYM-DB/2_2/CAGC/
MCSYM-DB/2_2/CAGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGC/2_2-CAGC.mcs
MCSYM-DB/2_2/CAGC/ds-2_2-CAGC_x.pdb.gz
MCSYM-DB/2_2/CAGG/
MCSYM-DB/2_2/CAGG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAGG/2_2-CAGG.mcs
MCSYM-DB/2_2/CAGG/ds-2_2-CAGG_x.pdb
MCSYM-DB/2_2/CAGG/ds-2_2-CAGG_x.pdb.gz
MCSYM-DB/2_2/CAGU/
MCSYM-DB/2_2/CAGU/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CAGU/2_2-CAGU.mcs
MCSYM-DB/2_2/CAGU/ds-2_2-CAGU_x.pdb.gz
MCSYM-DB/2_2/CAUA/
MCSYM-DB/2_2/CAUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUA/2_2-CAUA.mcs
MCSYM-DB/2_2/CAUA/ds-2_2-CAUA_x.pdb.gz
MCSYM-DB/2_2/CAUAG/
MCSYM-DB/2_2/CAUC/
MCSYM-DB/2_2/CAUC/2_2-CAUC.mcs
MCSYM-DB/2_2/CAUC/ds-2_2-CAUC_x.pdb.gz
MCSYM-DB/2_2/CAUG/
MCSYM-DB/2_2/CAUG/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1-2_2-CAUG_t.pdb.gz
MCSYM-DB/2_2/CAUG/1LUU_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1LUX_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1M82_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BYX_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I46_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1E95_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/484D_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2_2-CAUG.mcs
MCSYM-DB/2_2/CAUG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2BNY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2C4Y_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2C4Z_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2C50_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2C51_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2D18_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2F88_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/6MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/398D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/ds-2_2-CAUG_x.pdb
MCSYM-DB/2_2/CAUG/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/ds-2_2-CAUG_x.pdb.gz
MCSYM-DB/2_2/CAUG/418D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUG/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CAUU/
MCSYM-DB/2_2/CAUU/2_2-CAUU.mcs
MCSYM-DB/2_2/CAUU/ds-2_2-CAUU_x.pdb.gz
MCSYM-DB/2_2/CCAA/
MCSYM-DB/2_2/CCAA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAA/2_2-CCAA.mcs
MCSYM-DB/2_2/CCAA/ds-2_2-CCAA_x.pdb.gz
MCSYM-DB/2_2/CCAC/
MCSYM-DB/2_2/CCAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAC/2_2-CCAC.mcs
MCSYM-DB/2_2/CCAC/ds-2_2-CCAC_x.pdb.gz
MCSYM-DB/2_2/CCAG/
MCSYM-DB/2_2/CCAG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/2_2-CCAG.mcs
MCSYM-DB/2_2/CCAG/402D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCAG/ds-2_2-CCAG_x.pdb.gz
MCSYM-DB/2_2/CCAU/
MCSYM-DB/2_2/CCAU/2_2-CCAU.mcs
MCSYM-DB/2_2/CCAU/ds-2_2-CCAU_x.pdb.gz
MCSYM-DB/2_2/CCCA/
MCSYM-DB/2_2/CCCA/2_2-CCCA.mcs
MCSYM-DB/2_2/CCCA/ds-2_2-CCCA_x.pdb.gz
MCSYM-DB/2_2/CCCC/
MCSYM-DB/2_2/CCCC/2_2-CCCC.mcs
MCSYM-DB/2_2/CCCC/ds-2_2-CCCC_x.pdb.gz
MCSYM-DB/2_2/CCCG/
MCSYM-DB/2_2/CCCG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCCG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCCG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCCG/2_2-CCCG.mcs
MCSYM-DB/2_2/CCCG/ds-2_2-CCCG_x.pdb
MCSYM-DB/2_2/CCCG/ds-2_2-CCCG_x.pdb.gz
MCSYM-DB/2_2/CCCU/
MCSYM-DB/2_2/CCCU/2_2-CCCU.mcs
MCSYM-DB/2_2/CCCU/ds-2_2-CCCU_x.pdb.gz
MCSYM-DB/2_2/CCGA/
MCSYM-DB/2_2/CCGA/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/CCGA/2_2-CCGA.mcs
MCSYM-DB/2_2/CCGA/ds-2_2-CCGA_x.pdb.gz
MCSYM-DB/2_2/CCGC/
MCSYM-DB/2_2/CCGC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CCGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGC/2_2-CCGC.mcs
MCSYM-DB/2_2/CCGC/ds-2_2-CCGC_x.pdb.gz
MCSYM-DB/2_2/CCGG/
MCSYM-DB/2_2/CCGG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1-2_2-CCGG_t.pdb.gz
MCSYM-DB/2_2/CCGG/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/17RA_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1HJI_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1A60_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I46_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1IDV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1IK1_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1BYX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1C0O_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1J4Y_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F84_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F85_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JU7_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1E7K_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1E95_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2_2-CCGG.mcs
MCSYM-DB/2_2/CCGG/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KAJ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KUO_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1L2X_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LUU_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LUX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1M82_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MV1_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MV6_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1N35_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1N53_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1N66_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QES_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QET_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1R4H_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1RLG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1T28_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1WNE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZIF_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/259D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/28SP_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2A0P_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2A43_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2AZ0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2BNY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2C4Y_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2C4Z_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2C50_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2C51_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2F88_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2G1W_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/361D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/398D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/409D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/435D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/484D_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/5MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/7MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGG/ds-2_2-CCGG_x.pdb
MCSYM-DB/2_2/CCGG/ds-2_2-CCGG_x.pdb.gz
MCSYM-DB/2_2/CCGU/
MCSYM-DB/2_2/CCGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCGU/2_2-CCGU.mcs
MCSYM-DB/2_2/CCGU/ds-2_2-CCGU_x.pdb.gz
MCSYM-DB/2_2/CCUA/
MCSYM-DB/2_2/CCUA/2_2-CCUA.mcs
MCSYM-DB/2_2/CCUA/ds-2_2-CCUA_x.pdb.gz
MCSYM-DB/2_2/CCUC/
MCSYM-DB/2_2/CCUC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUC/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUC/2_2-CCUC.mcs
MCSYM-DB/2_2/CCUC/ds-2_2-CCUC_x.pdb.gz
MCSYM-DB/2_2/CCUG/
MCSYM-DB/2_2/CCUG/1N66_model_1.pdb.gz
MCSYM-DB/2_2/CCUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CCUG/2_2-CCUG.mcs
MCSYM-DB/2_2/CCUG/ds-2_2-CCUG_x.pdb.gz
MCSYM-DB/2_2/CCUU/
MCSYM-DB/2_2/CCUU/2_2-CCUU.mcs
MCSYM-DB/2_2/CCUU/ds-2_2-CCUU_x.pdb.gz
MCSYM-DB/2_2/CG/
MCSYM-DB/2_2/CGAA/
MCSYM-DB/2_2/CGAA/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/CGAA/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/CGAA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CGAA/2_2-CGAA.mcs
MCSYM-DB/2_2/CGAA/ds-2_2-CGAA_x.pdb.gz
MCSYM-DB/2_2/CGAC/
MCSYM-DB/2_2/CGAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAC/2_2-CGAC.mcs
MCSYM-DB/2_2/CGAC/ds-2_2-CGAC_x.pdb.gz
MCSYM-DB/2_2/CGAG/
MCSYM-DB/2_2/CGAG/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1E7K_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1F84_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/ds-2_2-CGAG_x.pdb.gz
MCSYM-DB/2_2/CGAG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1N66_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1RLG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1SA9_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1SAQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/28SP_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGAG/2_2-CGAG.mcs
MCSYM-DB/2_2/CGAU/
MCSYM-DB/2_2/CGAU/2_2-CGAU.mcs
MCSYM-DB/2_2/CGAU/ds-2_2-CGAU_x.pdb.gz
MCSYM-DB/2_2/CGCA/
MCSYM-DB/2_2/CGCA/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCA/2_2-CGCA.mcs
MCSYM-DB/2_2/CGCA/ds-2_2-CGCA_x.pdb.gz
MCSYM-DB/2_2/CGCC/
MCSYM-DB/2_2/CGCC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCC/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCC/2_2-CGCC.mcs
MCSYM-DB/2_2/CGCC/ds-2_2-CGCC_x.pdb.gz
MCSYM-DB/2_2/CGCG/
MCSYM-DB/2_2/CGCG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1-2_2-CGCG_t.pdb.gz
MCSYM-DB/2_2/CGCG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1A60_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1MIS_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1HS3_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2_2-CGCG.mcs
MCSYM-DB/2_2/CGCG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1HS4_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/aligned.pdb
MCSYM-DB/2_2/CGCG/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I2X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1HS8_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I2Y_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1E95_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I9X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1JZV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1HS2_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1T28_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1FUF_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1G3A_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1KAJ_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1GKW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1HS1_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1L2X_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1J9H_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1T4X_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/28SP_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2A0P_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2A43_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1RC7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1RPU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2AO5_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2AZ0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2BGG_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1UUU_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/361D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/438D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/5MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/7MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2F88_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/ds-2_2-CGCG_x.pdb
MCSYM-DB/2_2/CGCG/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/ds-2_2-CGCG_x.pdb.gz
MCSYM-DB/2_2/CGCG/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/259D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/
MCSYM-DB/2_2/CGCU/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/2_2-CGCU.mcs
MCSYM-DB/2_2/CGCU/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGCU/ds-2_2-CGCU_x.pdb.gz
MCSYM-DB/2_2/CGGA/
MCSYM-DB/2_2/CGGA/2_2-CGGA.mcs
MCSYM-DB/2_2/CGGA/ds-2_2-CGGA_x.pdb.gz
MCSYM-DB/2_2/CGGC/
MCSYM-DB/2_2/CGGC/2_2-CGGC.mcs
MCSYM-DB/2_2/CGGC/ds-2_2-CGGC_x.pdb.gz
MCSYM-DB/2_2/CGGG/
MCSYM-DB/2_2/CGGG/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/CGGG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGGG/2_2-CGGG.mcs
MCSYM-DB/2_2/CGGG/ds-2_2-CGGG_x.pdb.gz
MCSYM-DB/2_2/CGGU/
MCSYM-DB/2_2/CGGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGGU/2_2-CGGU.mcs
MCSYM-DB/2_2/CGGU/ds-2_2-CGGU_x.pdb.gz
MCSYM-DB/2_2/CGUA/
MCSYM-DB/2_2/CGUA/2_2-CGUA.mcs
MCSYM-DB/2_2/CGUA/ds-2_2-CGUA_x.pdb.gz
MCSYM-DB/2_2/CGUC/
MCSYM-DB/2_2/CGUC/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/CGUC/2_2-CGUC.mcs
MCSYM-DB/2_2/CGUC/ds-2_2-CGUC_x.pdb.gz
MCSYM-DB/2_2/CGUG/
MCSYM-DB/2_2/CGUG/17RA_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1F84_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1IK5_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1KOD_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2D18_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/2_2-CGUG.mcs
MCSYM-DB/2_2/CGUG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/485D_R10_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUG/ds-2_2-CGUG_x.pdb.gz
MCSYM-DB/2_2/CGUU/
MCSYM-DB/2_2/CGUU/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUU/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUU/2_2-CGUU.mcs
MCSYM-DB/2_2/CGUU/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CGUU/ds-2_2-CGUU_x.pdb.gz
MCSYM-DB/2_2/CUAA/
MCSYM-DB/2_2/CUAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAA/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAA/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAA/2_2-CUAA.mcs
MCSYM-DB/2_2/CUAA/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAA/ds-2_2-CUAA_x.pdb.gz
MCSYM-DB/2_2/CUAC/
MCSYM-DB/2_2/CUAC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CUAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAC/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAC/2_2-CUAC.mcs
MCSYM-DB/2_2/CUAC/ds-2_2-CUAC_x.pdb.gz
MCSYM-DB/2_2/CUAG/
MCSYM-DB/2_2/CUAG/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1-2_2-CUAG_t.pdb.gz
MCSYM-DB/2_2/CUAG/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1A60_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1N53_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1N66_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I9X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1E95_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1HJI_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JU7_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/ds-2_2-CUAG_x.pdb
MCSYM-DB/2_2/CUAG/2_2-CUAG.mcs
MCSYM-DB/2_2/CUAG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/435D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/6MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAG/ds-2_2-CUAG_x.pdb.gz
MCSYM-DB/2_2/CUAU/
MCSYM-DB/2_2/CUAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUAU/2_2-CUAU.mcs
MCSYM-DB/2_2/CUAU/ds-2_2-CUAU_x.pdb.gz
MCSYM-DB/2_2/CUCA/
MCSYM-DB/2_2/CUCA/2_2-CUCA.mcs
MCSYM-DB/2_2/CUCA/ds-2_2-CUCA_x.pdb.gz
MCSYM-DB/2_2/CUCC/
MCSYM-DB/2_2/CUCC/2_2-CUCC.mcs
MCSYM-DB/2_2/CUCC/ds-2_2-CUCC_x.pdb.gz
MCSYM-DB/2_2/CUCG/
MCSYM-DB/2_2/CUCG/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/2_2-CUCG.mcs
MCSYM-DB/2_2/CUCG/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUCG/ds-2_2-CUCG_x.pdb.gz
MCSYM-DB/2_2/CUCU/
MCSYM-DB/2_2/CUCU/2_2-CUCU.mcs
MCSYM-DB/2_2/CUCU/ds-2_2-CUCU_x.pdb.gz
MCSYM-DB/2_2/CUGA/
MCSYM-DB/2_2/CUGA/2_2-CUGA.mcs
MCSYM-DB/2_2/CUGA/ds-2_2-CUGA_x.pdb.gz
MCSYM-DB/2_2/CUGC/
MCSYM-DB/2_2/CUGC/2_2-CUGC.mcs
MCSYM-DB/2_2/CUGC/ds-2_2-CUGC_x.pdb.gz
MCSYM-DB/2_2/CUGG/
MCSYM-DB/2_2/CUGG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2D18_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1B36_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2_2-CUGG.mcs
MCSYM-DB/2_2/CUGG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/ds-2_2-CUGG_x.pdb.gz
MCSYM-DB/2_2/CUGG/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/484D_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1F85_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ZIF_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1M82_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/438D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGG/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUGU/
MCSYM-DB/2_2/CUGU/2_2-CUGU.mcs
MCSYM-DB/2_2/CUGU/ds-2_2-CUGU_x.pdb.gz
MCSYM-DB/2_2/CUUA/
MCSYM-DB/2_2/CUUA/2_2-CUUA.mcs
MCSYM-DB/2_2/CUUA/ds-2_2-CUUA_x.pdb.gz
MCSYM-DB/2_2/CUUAUG/
MCSYM-DB/2_2/CUUC/
MCSYM-DB/2_2/CUUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUC/2_2-CUUC.mcs
MCSYM-DB/2_2/CUUC/ds-2_2-CUUC_x.pdb.gz
MCSYM-DB/2_2/CUUG/
MCSYM-DB/2_2/CUUG/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/1ZEV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/CUUG/2_2-CUUG.mcs
MCSYM-DB/2_2/CUUG/ds-2_2-CUUG_x.pdb.gz
MCSYM-DB/2_2/CUUU/
MCSYM-DB/2_2/CUUU/1N66_model_1.pdb.gz
MCSYM-DB/2_2/CUUU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/CUUU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/CUUU/2_2-CUUU.mcs
MCSYM-DB/2_2/CUUU/ds-2_2-CUUU_e.bak.gz
MCSYM-DB/2_2/CUUU/ds-2_2-CUUU_x.bak.gz
MCSYM-DB/2_2/CUUU/ds-2_2-CUUU_x.pdb.gz
MCSYM-DB/2_2/GAAA/
MCSYM-DB/2_2/GAAA/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/283D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAA/2_2-GAAA.mcs
MCSYM-DB/2_2/GAAA/ds-2_2-GAAA_x.pdb.gz
MCSYM-DB/2_2/GAAC/
MCSYM-DB/2_2/GAAC/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/2D18_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GAAC/2_2-GAAC.mcs
MCSYM-DB/2_2/GAAC/ds-2_2-GAAC_x.pdb
MCSYM-DB/2_2/GAAC/ds-2_2-GAAC_x.pdb.gz
MCSYM-DB/2_2/GAAG/
MCSYM-DB/2_2/GAAG/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAG/2_2-GAAG.mcs
MCSYM-DB/2_2/GAAG/ds-2_2-GAAG_x.pdb.gz
MCSYM-DB/2_2/GAAU/
MCSYM-DB/2_2/GAAU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAU/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GAAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAAU/2_2-GAAU.mcs
MCSYM-DB/2_2/GAAU/ds-2_2-GAAU_x.pdb.gz
MCSYM-DB/2_2/GACA/
MCSYM-DB/2_2/GACA/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GACA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACA/2_2-GACA.mcs
MCSYM-DB/2_2/GACA/ds-2_2-GACA_x.pdb.gz
MCSYM-DB/2_2/GACC/
MCSYM-DB/2_2/GACC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GACC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GACC/2_2-GACC.mcs
MCSYM-DB/2_2/GACC/ds-2_2-GACC_x.pdb
MCSYM-DB/2_2/GACC/ds-2_2-GACC_x.pdb.gz
MCSYM-DB/2_2/GACG/
MCSYM-DB/2_2/GACG/2_2-GACG.mcs
MCSYM-DB/2_2/GACG/ds-2_2-GACG_x.pdb.gz
MCSYM-DB/2_2/GACU/
MCSYM-DB/2_2/GACU/2_2-GACU.mcs
MCSYM-DB/2_2/GACU/ds-2_2-GACU_x.pdb.gz
MCSYM-DB/2_2/GAGA/
MCSYM-DB/2_2/GAGA/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1E7K_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1MIS_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1RLG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1SA9_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1SAQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/GAGA/2_2-GAGA.mcs
MCSYM-DB/2_2/GAGA/GAGA.txt
MCSYM-DB/2_2/GAGA/ds-2_2-GAGA_x.pdb.gz
MCSYM-DB/2_2/GAGC/
MCSYM-DB/2_2/GAGC/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GAGC/2_2-GAGC.mcs
MCSYM-DB/2_2/GAGC/ds-2_2-GAGC_x.pdb.gz
MCSYM-DB/2_2/GAGG/
MCSYM-DB/2_2/GAGG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GAGG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGG/2_2-GAGG.mcs
MCSYM-DB/2_2/GAGG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGG/ds-2_2-GAGG_x.pdb.gz
MCSYM-DB/2_2/GAGU/
MCSYM-DB/2_2/GAGU/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGU/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAGU/2_2-GAGU.mcs
MCSYM-DB/2_2/GAGU/ds-2_2-GAGU_x.pdb.gz
MCSYM-DB/2_2/GAUA/
MCSYM-DB/2_2/GAUA/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/2_2-GAUA.mcs
MCSYM-DB/2_2/GAUA/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUA/ds-2_2-GAUA_x.pdb.gz
MCSYM-DB/2_2/GAUC/
MCSYM-DB/2_2/GAUC/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1-2_2-GAUC_t.pdb.gz
MCSYM-DB/2_2/GAUC/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1A60_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1N66_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1N53_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2_2-GAUC.mcs
MCSYM-DB/2_2/GAUC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1E95_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1GKW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1J4Y_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QES_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QET_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2BS1_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/484D_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/ds-2_2-GAUC_x.pdb
MCSYM-DB/2_2/GAUC/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/ds-2_2-GAUC_x.pdb.gz
MCSYM-DB/2_2/GAUC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YTU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2BGG_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YVP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2BS0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUC/485D_R10_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/
MCSYM-DB/2_2/GAUG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUG/2_2-GAUG.mcs
MCSYM-DB/2_2/GAUG/ds-2_2-GAUG_x.pdb.gz
MCSYM-DB/2_2/GAUU/
MCSYM-DB/2_2/GAUU/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/GAUU/2_2-GAUU.mcs
MCSYM-DB/2_2/GAUU/ds-2_2-GAUU_x.pdb.gz
MCSYM-DB/2_2/GC/
MCSYM-DB/2_2/GCAA/
MCSYM-DB/2_2/GCAA/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GCAA/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAA/2_2-GCAA.mcs
MCSYM-DB/2_2/GCAA/ds-2_2-GCAA_x.pdb.gz
MCSYM-DB/2_2/GCAC/
MCSYM-DB/2_2/GCAC/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/2_2-GCAC.mcs
MCSYM-DB/2_2/GCAC/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAC/ds-2_2-GCAC_x.pdb
MCSYM-DB/2_2/GCAC/ds-2_2-GCAC_x.pdb.gz
MCSYM-DB/2_2/GCAG/
MCSYM-DB/2_2/GCAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAG/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAG/2_2-GCAG.mcs
MCSYM-DB/2_2/GCAG/ds-2_2-GCAG_x.old.gz
MCSYM-DB/2_2/GCAG/ds-2_2-GCAG_x.pdb.gz
MCSYM-DB/2_2/GCAG/ncm_1.mcs
MCSYM-DB/2_2/GCAU/
MCSYM-DB/2_2/GCAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCAU/2_2-GCAU.mcs
MCSYM-DB/2_2/GCAU/ds-2_2-GCAU_x.pdb.gz
MCSYM-DB/2_2/GCCA/
MCSYM-DB/2_2/GCCA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCCA/2_2-GCCA.mcs
MCSYM-DB/2_2/GCCA/ds-2_2-GCCA_x.pdb.gz
MCSYM-DB/2_2/GCCC/
MCSYM-DB/2_2/GCCC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCCC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GCCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCCC/2_2-GCCC.mcs
MCSYM-DB/2_2/GCCC/ds-2_2-GCCC_x.pdb.gz
MCSYM-DB/2_2/GCCG/
MCSYM-DB/2_2/GCCG/2_2-GCCG.mcs
MCSYM-DB/2_2/GCCG/ds-2_2-GCCG_x.pdb.gz
MCSYM-DB/2_2/GCCU/
MCSYM-DB/2_2/GCCU/2_2-GCCU.mcs
MCSYM-DB/2_2/GCCU/ds-2_2-GCCU_x.pdb.gz
MCSYM-DB/2_2/GCGA/
MCSYM-DB/2_2/GCGA/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GCGA/2_2-GCGA.mcs
MCSYM-DB/2_2/GCGA/ds-2_2-GCGA_x.pdb.gz
MCSYM-DB/2_2/GCGC/
MCSYM-DB/2_2/GCGC/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1-2_2-GCGC_t.pdb.gz
MCSYM-DB/2_2/GCGC/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/17RA_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HS2_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JU7_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KAJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HJI_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2_2-GCGC.mcs
MCSYM-DB/2_2/GCGC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I46_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1L2X_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1E95_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HS1_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MIS_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1IDV_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HS3_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HS4_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HS8_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MV1_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MV6_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1UUU_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1R4H_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2AZ0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RC7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1RPU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1SA9_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1T4X_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2D18_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZEV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2AO5_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2G1W_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2G92_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/361D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/402D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/418D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/435D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/438D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/7MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGC/ds-2_2-GCGC_x.pdb
MCSYM-DB/2_2/GCGC/ds-2_2-GCGC_x.pdb.gz
MCSYM-DB/2_2/GCGG/
MCSYM-DB/2_2/GCGG/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGG/2_2-GCGG.mcs
MCSYM-DB/2_2/GCGG/ds-2_2-GCGG_x.pdb.gz
MCSYM-DB/2_2/GCGU/
MCSYM-DB/2_2/GCGU/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2_2-GCGU.mcs
MCSYM-DB/2_2/GCGU/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/ds-2_2-GCGU_x.pdb.gz
MCSYM-DB/2_2/GCGU/1F85_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1YTY_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1N53_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCGU/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCNN/
MCSYM-DB/2_2/GCNN/2_2-GCNN.mcs
MCSYM-DB/2_2/GCUA/
MCSYM-DB/2_2/GCUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCUA/2_2-GCUA.mcs
MCSYM-DB/2_2/GCUA/ds-2_2-GCUA_x.pdb.gz
MCSYM-DB/2_2/GCUC/
MCSYM-DB/2_2/GCUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCUC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCUC/2_2-GCUC.mcs
MCSYM-DB/2_2/GCUC/ds-2_2-GCUC_x.pdb.gz
MCSYM-DB/2_2/GCUG/
MCSYM-DB/2_2/GCUG/2_2-GCUG.mcs
MCSYM-DB/2_2/GCUG/ds-2_2-GCUG_x.pdb.gz
MCSYM-DB/2_2/GCUU/
MCSYM-DB/2_2/GCUU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GCUU/2_2-GCUU.mcs
MCSYM-DB/2_2/GCUU/ds-2_2-GCUU_x.pdb.gz
MCSYM-DB/2_2/GGAA/
MCSYM-DB/2_2/GGAA/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GGAA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAA/2_2-GGAA.mcs
MCSYM-DB/2_2/GGAA/ds-2_2-GGAA_x.pdb.gz
MCSYM-DB/2_2/GGAC/
MCSYM-DB/2_2/GGAC/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/5MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/ds-2_2-GGAC_x.pdb.gz
MCSYM-DB/2_2/GGAC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1MIS_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/2_2-GGAC.mcs
MCSYM-DB/2_2/GGAC/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GGAC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/
MCSYM-DB/2_2/GGAG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GGAG/2_2-GGAG.mcs
MCSYM-DB/2_2/GGAG/ds-2_2-GGAG_x.pdb.gz
MCSYM-DB/2_2/GGAU/
MCSYM-DB/2_2/GGAU/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/GGAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGAU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/GGAU/2_2-GGAU.mcs
MCSYM-DB/2_2/GGAU/ds-2_2-GGAU_x.pdb.gz
MCSYM-DB/2_2/GGAU/ds-2_2-GGAU_x.pdb
MCSYM-DB/2_2/GGCA/
MCSYM-DB/2_2/GGCA/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCA/2_2-GGCA.mcs
MCSYM-DB/2_2/GGCA/ds-2_2-GGCA_x.pdb.gz
MCSYM-DB/2_2/GGCC/
MCSYM-DB/2_2/GGCC/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1-2_2-GGCC_t.pdb.gz
MCSYM-DB/2_2/GGCC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/17RA_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1HJI_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1A60_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I46_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1IDV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1IK1_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1BYX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1C0O_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1J4Y_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F85_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JU7_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1E7K_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1E95_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EC6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2_2-GGCC.mcs
MCSYM-DB/2_2/GGCC/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KAJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KH6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KKS_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KUO_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1L2X_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LUU_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LUX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MUV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MV1_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MV6_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MWG_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1N35_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1N53_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1N66_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QES_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QET_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1R4H_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1RLG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1T28_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1WNE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YFV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZIF_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/259D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2A0P_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2A43_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2AZ0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2BNY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2C4Y_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2C4Z_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2C50_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2C51_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2G1W_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/361D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/398D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/409D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/435D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/484D_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/5MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/7MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCC/ds-2_2-GGCC_x.pdb
MCSYM-DB/2_2/GGCC/ds-2_2-GGCC_x.pdb.gz
MCSYM-DB/2_2/GGCG/
MCSYM-DB/2_2/GGCG/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/GGCG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCG/2_2-GGCG.mcs
MCSYM-DB/2_2/GGCG/ds-2_2-GGCG_x.pdb.gz
MCSYM-DB/2_2/GGCU/
MCSYM-DB/2_2/GGCU/2D18_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2_2-GGCU.mcs
MCSYM-DB/2_2/GGCU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/ds-2_2-GGCU_x.pdb.gz
MCSYM-DB/2_2/GGCU/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/484D_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1F85_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1ZIF_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/438D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGCU/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/
MCSYM-DB/2_2/GGGA/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/2_2-GGGA.mcs
MCSYM-DB/2_2/GGGA/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGA/ds-2_2-GGGA_x.pdb.gz
MCSYM-DB/2_2/GGGC/
MCSYM-DB/2_2/GGGC/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGGC/2_2-GGGC.mcs
MCSYM-DB/2_2/GGGC/ds-2_2-GGGC_x.pdb.gz
MCSYM-DB/2_2/GGGG/
MCSYM-DB/2_2/GGGG/2_2-GGGG.mcs
MCSYM-DB/2_2/GGGG/ds-2_2-GGGG_x.pdb.gz
MCSYM-DB/2_2/GGGU/
MCSYM-DB/2_2/GGGU/2_2-GGGU.mcs
MCSYM-DB/2_2/GGGU/ds-2_2-GGGU_x.pdb.gz
MCSYM-DB/2_2/GGUA/
MCSYM-DB/2_2/GGUA/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GGUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUA/2_2-GGUA.mcs
MCSYM-DB/2_2/GGUA/ds-2_2-GGUA_x.pdb.gz
MCSYM-DB/2_2/GGUC/
MCSYM-DB/2_2/GGUC/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1C0O_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/2_2-GGUC.mcs
MCSYM-DB/2_2/GGUC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1T28_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUC/ds-2_2-GGUC_x.pdb.gz
MCSYM-DB/2_2/GGUG/
MCSYM-DB/2_2/GGUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GGUG/2_2-GGUG.mcs
MCSYM-DB/2_2/GGUG/ds-2_2-GGUG_x.pdb.gz
MCSYM-DB/2_2/GGUU/
MCSYM-DB/2_2/GGUU/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/2_2-GGUU.mcs
MCSYM-DB/2_2/GGUU/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGUU/ds-2_2-GGUU_x.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2D18_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2_2-GGCU.mcs
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/ds-2_2-GGCU_x.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/484D_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1F85_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ZIG_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ZIH_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1JID_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1ZIF_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/438D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 1)/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GGcu (Case Conflict 2)/
MCSYM-DB/2_2/GGcu (Case Conflict 2)/2_2-GGCU.mcs
MCSYM-DB/2_2/GGcu (Case Conflict 2)/ds-2_2-GGCU_x.pdb.gz
MCSYM-DB/2_2/GGcu/
MCSYM-DB/2_2/GGcu/2_2-GGcu.mcs
MCSYM-DB/2_2/GU/
MCSYM-DB/2_2/GUAA/
MCSYM-DB/2_2/GUAA/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/2_2-GUAA.mcs
MCSYM-DB/2_2/GUAA/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAA/ds-2_2-GUAA_x.pdb.gz
MCSYM-DB/2_2/GUAC/
MCSYM-DB/2_2/GUAC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1-2_2-GUAC_t.pdb.gz
MCSYM-DB/2_2/GUAC/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1N66_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1I9X_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2_2-GUAC.mcs
MCSYM-DB/2_2/GUAC/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KOD_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1DDY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1DQF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ET4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1JZV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1F6U_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ROQ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1I46_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1IK1_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1T28_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1RPU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1UUU_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YTU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1YVP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2BGG_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2BS0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2BS1_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2D17_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2D18_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/377D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/484D_model_1.pdb.gz
MCSYM-DB/2_2/GUAC/ds-2_2-GUAC_x.pdb
MCSYM-DB/2_2/GUAC/ds-2_2-GUAC_x.pdb.gz
MCSYM-DB/2_2/GUAG/
MCSYM-DB/2_2/GUAG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1AM0_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/2_2-GUAG.mcs
MCSYM-DB/2_2/GUAG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAG/ds-2_2-GUAG_x.pdb.gz
MCSYM-DB/2_2/GUAU/
MCSYM-DB/2_2/GUAU/17RA_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/ds-2_2-GUAU_x.pdb.gz
MCSYM-DB/2_2/GUAU/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1FUF_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1IK5_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1QET_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1ROQ_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1T28_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/2_2-GUAU.mcs
MCSYM-DB/2_2/GUAU/315D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUAU/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUCA/
MCSYM-DB/2_2/GUCA/1B36_model_1.pdb.gz
MCSYM-DB/2_2/GUCA/2_2-GUCA.mcs
MCSYM-DB/2_2/GUCA/ds-2_2-GUCA_x.pdb
MCSYM-DB/2_2/GUCA/ds-2_2-GUCA_x.pdb.gz
MCSYM-DB/2_2/GUCC/
MCSYM-DB/2_2/GUCC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUCC/2_2-GUCC.mcs
MCSYM-DB/2_2/GUCC/ds-2_2-GUCC_x.pdb
MCSYM-DB/2_2/GUCC/ds-2_2-GUCC_x.pdb.gz
MCSYM-DB/2_2/GUCG/
MCSYM-DB/2_2/GUCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUCG/2_2-GUCG.mcs
MCSYM-DB/2_2/GUCG/ds-2_2-GUCG_x.pdb.gz
MCSYM-DB/2_2/GUCU/
MCSYM-DB/2_2/GUCU/2_2-GUCU.mcs
MCSYM-DB/2_2/GUCU/ds-2_2-GUCU_x.pdb.gz
MCSYM-DB/2_2/GUGA/
MCSYM-DB/2_2/GUGA/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGA/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGA/2_2-GUGA.mcs
MCSYM-DB/2_2/GUGA/ds-2_2-GUGA_x.pdb.gz
MCSYM-DB/2_2/GUGC/
MCSYM-DB/2_2/GUGC/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1A51_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/28SP_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2F88_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2_2-GUGC.mcs
MCSYM-DB/2_2/GUGC/1F84_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/ds-2_2-GUGC_x.pdb.gz
MCSYM-DB/2_2/GUGC/1F85_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1G70_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1YTY_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1M82_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1O15_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1N53_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGC/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGG/
MCSYM-DB/2_2/GUGG/2_2-GUGG.mcs
MCSYM-DB/2_2/GUGG/ds-2_2-GUGG_x.pdb
MCSYM-DB/2_2/GUGG/ds-2_2-GUGG_x.pdb.gz
MCSYM-DB/2_2/GUGU/
MCSYM-DB/2_2/GUGU/1C0O_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/1QES_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/2_2-GUGU.mcs
MCSYM-DB/2_2/GUGU/332D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUGU/ds-2_2-GUGU_x.pdb.gz
MCSYM-DB/2_2/GUUA/
MCSYM-DB/2_2/GUUA/2_2-GUUA.mcs
MCSYM-DB/2_2/GUUA/ds-2_2-GUUA_x.pdb.gz
MCSYM-DB/2_2/GUUC/
MCSYM-DB/2_2/GUUC/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1HS1_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1HS2_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1HS3_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1HS4_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1HS8_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1N66_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUC/2_2-GUUC.mcs
MCSYM-DB/2_2/GUUC/ds-2_2-GUUC_x.pdb.gz
MCSYM-DB/2_2/GUUG/
MCSYM-DB/2_2/GUUG/2_2-GUUG.mcs
MCSYM-DB/2_2/GUUG/ds-2_2-GUUG_x.pdb.gz
MCSYM-DB/2_2/GUUU/
MCSYM-DB/2_2/GUUU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/GUUU/2_2-GUUU.mcs
MCSYM-DB/2_2/GUUU/ds-2_2-GUUU_x.pdb.gz
MCSYM-DB/2_2/UAA/
MCSYM-DB/2_2/UAAA/
MCSYM-DB/2_2/UAAA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAA/2_2-UAAA.mcs
MCSYM-DB/2_2/UAAA/ds-2_2-UAAA_x.pdb.gz
MCSYM-DB/2_2/UAAC/
MCSYM-DB/2_2/UAAC/1B36_model_1.pdb.gz
MCSYM-DB/2_2/UAAC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAC/2_2-UAAC.mcs
MCSYM-DB/2_2/UAAC/ds-2_2-UAAC_x.pdb.gz
MCSYM-DB/2_2/UAAG/
MCSYM-DB/2_2/UAAG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAG/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/UAAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAG/2_2-UAAG.mcs
MCSYM-DB/2_2/UAAG/ds-2_2-UAAG_x.pdb.gz
MCSYM-DB/2_2/UAAU/
MCSYM-DB/2_2/UAAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAAU/2_2-UAAU.mcs
MCSYM-DB/2_2/UAAU/ds-2_2-UAAU_x.pdb.gz
MCSYM-DB/2_2/UACA/
MCSYM-DB/2_2/UACA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UACA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UACA/2_2-UACA.mcs
MCSYM-DB/2_2/UACA/ds-2_2-UACA_x.pdb.gz
MCSYM-DB/2_2/UACC/
MCSYM-DB/2_2/UACC/2_2-UACC.mcs
MCSYM-DB/2_2/UACC/ds-2_2-UACC_x.pdb.gz
MCSYM-DB/2_2/UACG/
MCSYM-DB/2_2/UACG/2_2-UACG.mcs
MCSYM-DB/2_2/UACG/ds-2_2-UACG_x.pdb
MCSYM-DB/2_2/UACG/ds-2_2-UACG_x.pdb.gz
MCSYM-DB/2_2/UACU/
MCSYM-DB/2_2/UACU/2_2-UACU.mcs
MCSYM-DB/2_2/UACU/ds-2_2-UACU_x.pdb.gz
MCSYM-DB/2_2/UAGA/
MCSYM-DB/2_2/UAGA/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1A51_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1F84_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1IE1_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/2_2-UAGA.mcs
MCSYM-DB/2_2/UAGA/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGA/ds-2_2-UAGA_x.pdb.gz
MCSYM-DB/2_2/UAGC/
MCSYM-DB/2_2/UAGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGC/2_2-UAGC.mcs
MCSYM-DB/2_2/UAGC/ds-2_2-UAGC_x.pdb.gz
MCSYM-DB/2_2/UAGG/
MCSYM-DB/2_2/UAGG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UAGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAGG/2_2-UAGG.mcs
MCSYM-DB/2_2/UAGG/ds-2_2-UAGG_x.pdb
MCSYM-DB/2_2/UAGG/ds-2_2-UAGG_x.pdb.gz
MCSYM-DB/2_2/UAGU/
MCSYM-DB/2_2/UAGU/2_2-UAGU.mcs
MCSYM-DB/2_2/UAGU/ds-2_2-UAGU_x.pdb.gz
MCSYM-DB/2_2/UAUA/
MCSYM-DB/2_2/UAUA/1-2_2-UAUA_t.pdb.gz
MCSYM-DB/2_2/UAUA/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1EXY_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/2_2-UAUA.mcs
MCSYM-DB/2_2/UAUA/1FUF_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1IK1_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1IK5_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1RNA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1ROQ_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/ds-2_2-UAUA_x.pdb.gz
MCSYM-DB/2_2/UAUA/1RPU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1UUU_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1YYW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/246D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/419D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/315D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/377D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUA/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUC/
MCSYM-DB/2_2/UAUC/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUC/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUC/2_2-UAUC.mcs
MCSYM-DB/2_2/UAUC/ds-2_2-UAUC_x.pdb.gz
MCSYM-DB/2_2/UAUG/
MCSYM-DB/2_2/UAUG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/2_2-UAUG.mcs
MCSYM-DB/2_2/UAUG/332D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UAUG/ds-2_2-UAUG_x.pdb.gz
MCSYM-DB/2_2/UAUU/
MCSYM-DB/2_2/UAUU/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/UAUU/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/UAUU/2_2-UAUU.mcs
MCSYM-DB/2_2/UAUU/ds-2_2-UAUU_x.pdb.gz
MCSYM-DB/2_2/UCAA/
MCSYM-DB/2_2/UCAA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCAA/2_2-UCAA.mcs
MCSYM-DB/2_2/UCAA/ds-2_2-UCAA_x.pdb.gz
MCSYM-DB/2_2/UCAC/
MCSYM-DB/2_2/UCAC/2_2-UCAC.mcs
MCSYM-DB/2_2/UCAC/ds-2_2-UCAC_x.pdb.gz
MCSYM-DB/2_2/UCAG/
MCSYM-DB/2_2/UCAG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/UCAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCAG/1KD3_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCAG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCAG/2_2-UCAG.mcs
MCSYM-DB/2_2/UCAG/ds-2_2-UCAG_x.pdb.gz
MCSYM-DB/2_2/UCAU/
MCSYM-DB/2_2/UCAU/2_2-UCAU.mcs
MCSYM-DB/2_2/UCAU/ds-2_2-UCAU_x.pdb.gz
MCSYM-DB/2_2/UCCA/
MCSYM-DB/2_2/UCCA/2_2-UCCA.mcs
MCSYM-DB/2_2/UCCA/ds-2_2-UCCA_x.pdb.gz
MCSYM-DB/2_2/UCCC/
MCSYM-DB/2_2/UCCC/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCCC/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCCC/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCCC/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCCC/2_2-UCCC.mcs
MCSYM-DB/2_2/UCCC/ds-2_2-UCCC_x.pdb.gz
MCSYM-DB/2_2/UCCG/
MCSYM-DB/2_2/UCCG/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/UCCG/2_2-UCCG.mcs
MCSYM-DB/2_2/UCCG/ds-2_2-UCCG_x.pdb.gz
MCSYM-DB/2_2/UCCU/
MCSYM-DB/2_2/UCCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCCU/2_2-UCCU.mcs
MCSYM-DB/2_2/UCCU/ds-2_2-UCCU_x.pdb.gz
MCSYM-DB/2_2/UCGA (Case Conflict 1)/
MCSYM-DB/2_2/UCGA (Case Conflict 1)/2_2-UCga.mcs
MCSYM-DB/2_2/UCGA (Case Conflict 1)/ds-2_2-UCga_x.pdb.gz
MCSYM-DB/2_2/UCGA/
MCSYM-DB/2_2/UCGA/1IVS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1-2_2-UCGA_t.pdb.gz
MCSYM-DB/2_2/UCGA/1IVS_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1A60_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1J1U_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1J4Y_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1AJT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1JBR_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ATV_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1JBT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ATW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1JBT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1B23_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BGZ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BN0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2_2-UCGA.mcs
MCSYM-DB/2_2/UCGA/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1C0A_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KOC_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1GKW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KP7_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1CK5_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KPY_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1CX0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1KXK_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MSY_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1DUL_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1LNT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1DZ5_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1M5K_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1E95_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1GKW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EFW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1M82_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EHZ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ME1_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EUY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EUY_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EXD_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MJI_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1EXD_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F7U_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F27_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1N53_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F27_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MSY_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MZP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1FG0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1H4S_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1N66_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1I6U_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1N77_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1I6U_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1I9V_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1IL2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1JBR_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1LNT_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TFW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NBK_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U8D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NTA_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TFW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NUJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1OQ0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1WTS_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1OSW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1OW9_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XJR_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q29_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q75_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XOK_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q9A_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Q9A_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XWP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QES_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Y26_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QET_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U0B_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Y27_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QF6_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QU2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YN1_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1R3E_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YTU_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YVP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YYK_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YZ9_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1S03_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SDR_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z31_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SER_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TTT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SJ3_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z43_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z7F_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1T0E_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ZJW_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YTU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YVP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/205D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/28SP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2A9X_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2B3J_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/405D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BGG_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BGG_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BH2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BH2_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/420D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BS0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BS0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/ds-2_2-UCGA_x.pdb
MCSYM-DB/2_2/UCGA/2BS1_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BS1_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/ds-2_2-UCGA_x.pdb.gz
MCSYM-DB/2_2/UCGA/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2BTE_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2CSX_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2CSX_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2D17_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2EZ6_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2F88_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/429D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2F8K_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FK6_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FMT_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/484D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FQN_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/2TRA_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/485D_R10_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/353D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/397D_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/UCGA/485D_model_1.pdb.gz
MCSYM-DB/2_2/UCGC/
MCSYM-DB/2_2/UCGC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGC/2_2-UCGC.mcs
MCSYM-DB/2_2/UCGC/ds-2_2-UCGC_x.pdb.gz
MCSYM-DB/2_2/UCGG/
MCSYM-DB/2_2/UCGG/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1C0O_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1D0T_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1D0U_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/2_2-UCGG.mcs
MCSYM-DB/2_2/UCGG/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/2FMT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1G70_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1GUC_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1IKD_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1JOX_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1O15_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1RNG_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1T28_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/464D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/466D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGG/ds-2_2-UCGG_x.pdb.gz
MCSYM-DB/2_2/UCGU/
MCSYM-DB/2_2/UCGU/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1HS1_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1HS2_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1HS3_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1HS4_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1HS8_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1N66_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/2FQN_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCGU/2_2-UCGU.mcs
MCSYM-DB/2_2/UCGU/ds-2_2-UCGU_x.pdb.gz
MCSYM-DB/2_2/UCUA/
MCSYM-DB/2_2/UCUA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUA/2_2-UCUA.mcs
MCSYM-DB/2_2/UCUA/ds-2_2-UCUA_x.pdb.gz
MCSYM-DB/2_2/UCUC/
MCSYM-DB/2_2/UCUC/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUC/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUC/2_2-UCUC.mcs
MCSYM-DB/2_2/UCUC/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUC/ds-2_2-UCUC_x.pdb.gz
MCSYM-DB/2_2/UCUG/
MCSYM-DB/2_2/UCUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UCUG/2_2-UCUG.mcs
MCSYM-DB/2_2/UCUG/ds-2_2-UCUG_x.pdb.gz
MCSYM-DB/2_2/UCUU/
MCSYM-DB/2_2/UCUU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UCUU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UCUU/2_2-UCUU.mcs
MCSYM-DB/2_2/UCUU/ds-2_2-UCUU_x.pdb.gz
MCSYM-DB/2_2/UG/
MCSYM-DB/2_2/UGAA/
MCSYM-DB/2_2/UGAA/1A4T_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1BVJ_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1HMH_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/UGAA/2_2-UGAA.mcs
MCSYM-DB/2_2/UGAA/ds-2_2-UGAA_x.pdb.gz
MCSYM-DB/2_2/UGAC/
MCSYM-DB/2_2/UGAC/2_2-UGAC.mcs
MCSYM-DB/2_2/UGAC/ds-2_2-UGAC_x.pdb.gz
MCSYM-DB/2_2/UGAG/
MCSYM-DB/2_2/UGAG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1F85_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1F9L_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1TJZ_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/1XV0_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/2_2-UGAG.mcs
MCSYM-DB/2_2/UGAG/354D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAG/ds-2_2-UGAG_x.pdb.gz
MCSYM-DB/2_2/UGAU/
MCSYM-DB/2_2/UGAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGAU/2_2-UGAU.mcs
MCSYM-DB/2_2/UGAU/ds-2_2-UGAU_x.pdb.gz
MCSYM-DB/2_2/UGCA/
MCSYM-DB/2_2/UGCA/1LMV_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1-2_2-UGCA_t.pdb.gz
MCSYM-DB/2_2/UGCA/1LPW_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1A51_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1H4S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1A9N_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1LUU_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1AFX_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1LUX_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1LVJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1M82_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ATO_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MFJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1AUD_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1JZC_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1B23_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MFK_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1B36_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BYJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BYX_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BZ2_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1NTA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1BZT_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1HC8_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1C4L_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I3X_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1CSL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I3Y_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1CX0_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I46_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1D4R_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I9F_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I4B_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1DUQ_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1E95_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1P5M_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1EBR_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1K2G_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1L1W_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1EKZ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1P5O_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Q29_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ESH_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Q8N_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1F5G_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QC8_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1F5U_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1F7U_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QD3_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FEQ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1JUR_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1L8V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QF6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FL8_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QWB_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FMN_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1R7W_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1FYO_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1R7Z_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1G70_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1K6G_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1K8S_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1RKJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1KIS_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1RNK_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1KOS_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1KUQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1S03_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/484D_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2_2-UGCA.mcs
MCSYM-DB/2_2/UGCA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1MJI_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1N77_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1NUJ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Q93_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Q96_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1R3E_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1SJ3_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1SZY_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1T0D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1T0E_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U0B_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U2A_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U3K_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U8D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ULL_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1UUD_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1VFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XOK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Y27_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Y3O_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YFG_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YG3_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YNC_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YNE_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZCI_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZDK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZE2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZFV_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZX7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/1ZZ5_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2AB4_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2BE0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2BNY_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2BTE_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2C4Y_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2C4Z_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2C50_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2C51_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2D17_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2D18_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2ESI_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2F88_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2FRL_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/2TPK_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/397D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/398D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/6MSF_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/ds-2_2-UGCA_x.pdb
MCSYM-DB/2_2/UGCA/418D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/ds-2_2-UGCA_x.pdb.gz
MCSYM-DB/2_2/UGCA/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/429D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCA/430D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/
MCSYM-DB/2_2/UGCC/1N66_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_2/UGCC/2_2-UGCC.mcs
MCSYM-DB/2_2/UGCC/ds-2_2-UGCC_x.pdb
MCSYM-DB/2_2/UGCC/ds-2_2-UGCC_x.pdb.gz
MCSYM-DB/2_2/UGCG/
MCSYM-DB/2_2/UGCG/17RA_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1CK5_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1E4P_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1EKD_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1ELH_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1F84_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1FHK_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1FQZ_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1HWQ_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1IK5_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1JTW_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1K5I_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1KOD_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1U9S_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1VOP_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2D17_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2D18_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/2_2-UGCG.mcs
MCSYM-DB/2_2/UGCG/364D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/485D_R10_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCG/ds-2_2-UGCG_x.pdb.gz
MCSYM-DB/2_2/UGCU/
MCSYM-DB/2_2/UGCU/1MMS_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1OLN_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1Y39_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1Z43_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/1ZEV_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGCU/2_2-UGCU.mcs
MCSYM-DB/2_2/UGCU/ds-2_2-UGCU_x.pdb.gz
MCSYM-DB/2_2/UGGA/
MCSYM-DB/2_2/UGGA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGA/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGA/1SER_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGA/2_2-UGGA.mcs
MCSYM-DB/2_2/UGGA/ds-2_2-UGGA_x.pdb.gz
MCSYM-DB/2_2/UGGC/
MCSYM-DB/2_2/UGGC/2_2-UGGC.mcs
MCSYM-DB/2_2/UGGC/ds-2_2-UGGC_x.pdb.gz
MCSYM-DB/2_2/UGGG/
MCSYM-DB/2_2/UGGG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGGG/2AU4_model_1.pdb.gz
MCSYM-DB/2_2/UGGG/2_2-UGGG.mcs
MCSYM-DB/2_2/UGGG/ds-2_2-UGGG_x.pdb.gz
MCSYM-DB/2_2/UGGU/
MCSYM-DB/2_2/UGGU/2_2-UGGU.mcs
MCSYM-DB/2_2/UGGU/ds-2_2-UGGU_x.pdb.gz
MCSYM-DB/2_2/UGR20*.pdb.gz/
MCSYM-DB/2_2/UGUA/
MCSYM-DB/2_2/UGUA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1MNX_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/2_2-UGUA.mcs
MCSYM-DB/2_2/UGUA/332D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUA/ds-2_2-UGUA_x.pdb.gz
MCSYM-DB/2_2/UGUC/
MCSYM-DB/2_2/UGUC/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUC/2_2-UGUC.mcs
MCSYM-DB/2_2/UGUC/ds-2_2-UGUC_x.pdb.gz
MCSYM-DB/2_2/UGUG/
MCSYM-DB/2_2/UGUG/1A51_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1D6K_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1DFU_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1EKA_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1FEU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1MHK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1QET_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/2_2-UGUG.mcs
MCSYM-DB/2_2/UGUG/315D_R15_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/353D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/439D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUG/ds-2_2-UGUG_x.pdb.gz
MCSYM-DB/2_2/UGUU/
MCSYM-DB/2_2/UGUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUU/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UGUU/2_2-UGUU.mcs
MCSYM-DB/2_2/UGUU/ds-2_2-UGUU_x.pdb.gz
MCSYM-DB/2_2/UUAA/
MCSYM-DB/2_2/UUAA/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1-2_2-UUAA_t.pdb.gz
MCSYM-DB/2_2/UUAA/1OOA_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/157D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/157D_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1OOA_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2_2-UUAA.mcs
MCSYM-DB/2_2/UUAA/1A34_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XJR_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1A34_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1A60_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1AL5_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XP7_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1BAU_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XPE_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1BJ2_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1PJY_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XPF_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1C0A_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1SDR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XSG_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1EFW_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1QC0_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XSH_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1EHZ_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XWU_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1F6X_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Y26_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1F6Z_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1SDR_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YMO_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1FG0_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YSV_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1HLX_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YYK_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1I9V_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1IL2_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YYW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1IL2_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1QC0_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1J1U_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YYW_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1J1U_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YZ9_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Z2J_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1JTJ_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Z30_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1K4A_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Z7F_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1K4B_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1K6H_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1ZL3_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1L1C_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1ZL3_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1WKS_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1L9A_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1L9A_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2B3J_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1M5K_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2D17_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1M5L_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2D1A_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1M82_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2EUY_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1MFY_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2EZ6_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1MT4_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2F4X_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1N8X_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2F8K_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2FK6_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1NC0_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2FK6_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1NZ1_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1RAW_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1SLP_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2G92_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1SYZ_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2GBH_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1T4L_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1WSU_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2GM0_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1TTT_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2TRA_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1U6P_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1WSU_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XP7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XPE_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1XPF_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YYK_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1YZ9_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/1Z7F_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2B3J_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2F8K_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2G92_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/2TRA_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/3PHP_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/405D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/405D_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/420D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/420D_model_1.pdb.gz
MCSYM-DB/2_2/UUAA/ds-2_2-UUAA_x.pdb
MCSYM-DB/2_2/UUAA/ds-2_2-UUAA_x.pdb.gz
MCSYM-DB/2_2/UUAC/
MCSYM-DB/2_2/UUAC/2_2-UUAC.mcs
MCSYM-DB/2_2/UUAC/ds-2_2-UUAC_x.pdb.gz
MCSYM-DB/2_2/UUAG/
MCSYM-DB/2_2/UUAG/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1C0A_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1EFW_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1G1X_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1KXK_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1LDZ_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1M82_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1NYB_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1P5N_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1QES_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1QU2_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1R2P_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1XHP_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1XJR_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/2EZ6_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/2F88_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/2_2-UUAG.mcs
MCSYM-DB/2_2/UUAG/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAG/ds-2_2-UUAG_x.pdb.gz
MCSYM-DB/2_2/UUAU/
MCSYM-DB/2_2/UUAU/1MZP_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAU/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAU/1Y26_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAU/1ZJW_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUAU/2_2-UUAU.mcs
MCSYM-DB/2_2/UUAU/ds-2_2-UUAU_x.pdb.gz
MCSYM-DB/2_2/UUCA/
MCSYM-DB/2_2/UUCA/2_2-UUCA.mcs
MCSYM-DB/2_2/UUCA/ds-2_2-UUCA_x.pdb.gz
MCSYM-DB/2_2/UUCC/
MCSYM-DB/2_2/UUCC/2_2-UUCC.mcs
MCSYM-DB/2_2/UUCC/ds-2_2-UUCC_x.pdb
MCSYM-DB/2_2/UUCC/ds-2_2-UUCC_x.pdb.gz
MCSYM-DB/2_2/UUCG/
MCSYM-DB/2_2/UUCG/1ICG_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUCG/1QBP_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUCG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUCG/2_2-UUCG.mcs
MCSYM-DB/2_2/UUCG/422D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUCG/ds-2_2-UUCG_x.pdb.gz
MCSYM-DB/2_2/UUCU/
MCSYM-DB/2_2/UUCU/1N66_model_1.pdb.gz
MCSYM-DB/2_2/UUCU/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UUCU/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UUCU/2_2-UUCU.mcs
MCSYM-DB/2_2/UUCU/ds-2_2-UUCU_x.pdb.gz
MCSYM-DB/2_2/UUGA/
MCSYM-DB/2_2/UUGA/1EHZ_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1H3E_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1I9V_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1JO7_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1NBR_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1S2F_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1TLR_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1TTT_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/1ZC5_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/2B6G_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/2ES5_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/UUGA/2_2-UUGA.mcs
MCSYM-DB/2_2/UUGA/ds-2_2-UUGA_x.pdb.gz
MCSYM-DB/2_2/UUGC/
MCSYM-DB/2_2/UUGC/1XMQ_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGC/2_2-UUGC.mcs
MCSYM-DB/2_2/UUGC/ds-2_2-UUGC_x.pdb.gz
MCSYM-DB/2_2/UUGG/
MCSYM-DB/2_2/UUGG/1AJF_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1CQ5_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1DUL_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1L8V_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1M5K_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1NEM_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1TUT_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/2ADT_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/2_2-UUGG.mcs
MCSYM-DB/2_2/UUGG/433D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/472D_R20_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGG/ds-2_2-UUGG_x.pdb.gz
MCSYM-DB/2_2/UUGU/
MCSYM-DB/2_2/UUGU/1FG0_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUGU/2_2-UUGU.mcs
MCSYM-DB/2_2/UUGU/ds-2_2-UUGU_x.pdb.gz
MCSYM-DB/2_2/UUUA/
MCSYM-DB/2_2/UUUA/1TOB_model_1.pdb.gz
MCSYM-DB/2_2/UUUA/2TOB_model_1.pdb.gz
MCSYM-DB/2_2/UUUA/2_2-UUUA.mcs
MCSYM-DB/2_2/UUUA/ds-2_2-UUUA_x.pdb.gz
MCSYM-DB/2_2/UUUC/
MCSYM-DB/2_2/UUUC/1RFR_model_1.pdb.gz
MCSYM-DB/2_2/UUUC/1TXS_model_1.pdb.gz
MCSYM-DB/2_2/UUUC/2_2-UUUC.mcs
MCSYM-DB/2_2/UUUC/ds-2_2-UUUC_x.pdb.gz
MCSYM-DB/2_2/UUUG/
MCSYM-DB/2_2/UUUG/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUUG/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUUG/2_2-UUUG.mcs
MCSYM-DB/2_2/UUUG/ds-2_2-UUUG_x.pdb.gz
MCSYM-DB/2_2/UUUU/
MCSYM-DB/2_2/UUUU/1NA2_model_1.pdb.gz
MCSYM-DB/2_2/UUUU/1VQ7_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUUU/205D_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUUU/280D_R25_R30_R35_model_1.pdb.gz
MCSYM-DB/2_2/UUUU/2_2-UUUU.mcs
MCSYM-DB/2_2/UUUU/ds-2_2-UUUU_x.pdb.gz
MCSYM-DB/2_2/theo/
MCSYM-DB/2_2/theo/2_2-theo_x.pdb
MCSYM-DB/2_2/theo/ds-2_2-theo_x.pdb.gz
MCSYM-DB/2_2/theo/maketheo.bat
MCSYM-DB/2_2/2_2.stats
MCSYM-DB/2_2/instances.txt
MCSYM-DB/2_2/make_2_2.bat
MCSYM-DB/2_2/make_2_2.mut.bat
MCSYM-DB/2_2/out.pdb
MCSYM-DB/2_2/setXray.C
MCSYM-DB/2_2/setXray.exe
MCSYM-DB/2_2/xray.txt
MCSYM-DB/2_22/
MCSYM-DB/2_22/GCGG/
MCSYM-DB/2_3/
MCSYM-DB/2_3/AAAAA/
MCSYM-DB/2_3/AAAAA/2AU4_model_1.pdb.gz
MCSYM-DB/2_3/AAAAA/2_3-AAAAA.mcs
MCSYM-DB/2_3/AAAAA/ds-2_3-AAAAA_x.pdb.gz
MCSYM-DB/2_3/AAAAC/
MCSYM-DB/2_3/AAAAC/2_3-AAAAC.mcs
MCSYM-DB/2_3/AAAAC/ds-2_3-AAAAC_x.pdb.gz
MCSYM-DB/2_3/AAAAG/
MCSYM-DB/2_3/AAAAG/2_3-AAAAG.mcs
MCSYM-DB/2_3/AAAAG/ds-2_3-AAAAG_x.pdb.gz
MCSYM-DB/2_3/AAAAU/
MCSYM-DB/2_3/AAAAU/1IE1_model_1.pdb.gz
MCSYM-DB/2_3/AAAAU/2_3-AAAAU.mcs
MCSYM-DB/2_3/AAAAU/ds-2_3-AAAAU_x.pdb.gz
MCSYM-DB/2_3/AAACA/
MCSYM-DB/2_3/AAACA/2_3-AAACA.mcs
MCSYM-DB/2_3/AAACA/ds-2_3-AAACA_x.pdb.gz
MCSYM-DB/2_3/AAACC/
MCSYM-DB/2_3/AAACC/2_3-AAACC.mcs
MCSYM-DB/2_3/AAACC/ds-2_3-AAACC_x.pdb.gz
MCSYM-DB/2_3/AAACG/
MCSYM-DB/2_3/AAACG/2_3-AAACG.mcs
MCSYM-DB/2_3/AAACG/ds-2_3-AAACG_x.pdb.gz
MCSYM-DB/2_3/AAACU/
MCSYM-DB/2_3/AAACU/2_3-AAACU.mcs
MCSYM-DB/2_3/AAACU/ds-2_3-AAACU_x.pdb.gz
MCSYM-DB/2_3/AAAGA/
MCSYM-DB/2_3/AAAGA/2_3-AAAGA.mcs
MCSYM-DB/2_3/AAAGA/ds-2_3-AAAGA_x.pdb.gz
MCSYM-DB/2_3/AAAGC/
MCSYM-DB/2_3/AAAGC/2_3-AAAGC.mcs
MCSYM-DB/2_3/AAAGC/ds-2_3-AAAGC_x.pdb.gz
MCSYM-DB/2_3/AAAGG/
MCSYM-DB/2_3/AAAGG/2_3-AAAGG.mcs
MCSYM-DB/2_3/AAAGG/ds-2_3-AAAGG_x.pdb.gz
MCSYM-DB/2_3/AAAGU/
MCSYM-DB/2_3/AAAGU/1F84_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1FQZ_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1IE1_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1JBR_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1JBT_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1P5N_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1P5O_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1Q93_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1Q96_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1QWB_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/AAAGU/2_3-AAAGU.mcs
MCSYM-DB/2_3/AAAGU/ds-2_3-AAAGU_x.pdb.gz
MCSYM-DB/2_3/AAAUA/
MCSYM-DB/2_3/AAAUA/2_3-AAAUA.mcs
MCSYM-DB/2_3/AAAUA/ds-2_3-AAAUA_x.pdb.gz
MCSYM-DB/2_3/AAAUC/
MCSYM-DB/2_3/AAAUC/2_3-AAAUC.mcs
MCSYM-DB/2_3/AAAUC/ds-2_3-AAAUC_x.pdb.gz
MCSYM-DB/2_3/AAAUG/
MCSYM-DB/2_3/AAAUG/2_3-AAAUG.mcs
MCSYM-DB/2_3/AAAUG/ds-2_3-AAAUG_x.pdb.gz
MCSYM-DB/2_3/AAAUU/
MCSYM-DB/2_3/AAAUU/2_3-AAAUU.mcs
MCSYM-DB/2_3/AAAUU/ds-2_3-AAAUU_x.pdb.gz
MCSYM-DB/2_3/AACAA/
MCSYM-DB/2_3/AACAA/2_3-AACAA.mcs
MCSYM-DB/2_3/AACAA/ds-2_3-AACAA_x.pdb.gz
MCSYM-DB/2_3/AACAC/
MCSYM-DB/2_3/AACAC/2_3-AACAC.mcs
MCSYM-DB/2_3/AACAC/ds-2_3-AACAC_x.pdb.gz
MCSYM-DB/2_3/AACAG/
MCSYM-DB/2_3/AACAG/2_3-AACAG.mcs
MCSYM-DB/2_3/AACAG/ds-2_3-AACAG_x.pdb.gz
MCSYM-DB/2_3/AACAU/
MCSYM-DB/2_3/AACAU/2_3-AACAU.mcs
MCSYM-DB/2_3/AACAU/ds-2_3-AACAU_x.pdb.gz
MCSYM-DB/2_3/AACCA/
MCSYM-DB/2_3/AACCA/2_3-AACCA.mcs
MCSYM-DB/2_3/AACCA/ds-2_3-AACCA_x.pdb.gz
MCSYM-DB/2_3/AACCC/
MCSYM-DB/2_3/AACCC/2_3-AACCC.mcs
MCSYM-DB/2_3/AACCC/ds-2_3-AACCC_x.pdb.gz
MCSYM-DB/2_3/AACCG/
MCSYM-DB/2_3/AACCG/2_3-AACCG.mcs
MCSYM-DB/2_3/AACCG/ds-2_3-AACCG_x.pdb.gz
MCSYM-DB/2_3/AACCU/
MCSYM-DB/2_3/AACCU/2_3-AACCU.mcs
MCSYM-DB/2_3/AACCU/ds-2_3-AACCU_x.pdb.gz
MCSYM-DB/2_3/AACGA/
MCSYM-DB/2_3/AACGA/2_3-AACGA.mcs
MCSYM-DB/2_3/AACGA/ds-2_3-AACGA_x.pdb.gz
MCSYM-DB/2_3/AACGC/
MCSYM-DB/2_3/AACGC/2_3-AACGC.mcs
MCSYM-DB/2_3/AACGC/ds-2_3-AACGC_x.pdb.gz
MCSYM-DB/2_3/AACGG/
MCSYM-DB/2_3/AACGG/2_3-AACGG.mcs
MCSYM-DB/2_3/AACGG/ds-2_3-AACGG_x.pdb.gz
MCSYM-DB/2_3/AACGU/
MCSYM-DB/2_3/AACGU/2_3-AACGU.mcs
MCSYM-DB/2_3/AACGU/ds-2_3-AACGU_x.pdb.gz
MCSYM-DB/2_3/AACUA/
MCSYM-DB/2_3/AACUA/2_3-AACUA.mcs
MCSYM-DB/2_3/AACUA/ds-2_3-AACUA_x.pdb.gz
MCSYM-DB/2_3/AACUC/
MCSYM-DB/2_3/AACUC/2_3-AACUC.mcs
MCSYM-DB/2_3/AACUC/ds-2_3-AACUC_x.pdb.gz
MCSYM-DB/2_3/AACUG/
MCSYM-DB/2_3/AACUG/2_3-AACUG.mcs
MCSYM-DB/2_3/AACUG/ds-2_3-AACUG_x.pdb.gz
MCSYM-DB/2_3/AACUU/
MCSYM-DB/2_3/AACUU/2_3-AACUU.mcs
MCSYM-DB/2_3/AACUU/ds-2_3-AACUU_x.pdb.gz
MCSYM-DB/2_3/AAGAA/
MCSYM-DB/2_3/AAGAA/2_3-AAGAA.mcs
MCSYM-DB/2_3/AAGAA/ds-2_3-AAGAA_x.pdb.gz
MCSYM-DB/2_3/AAGAC/
MCSYM-DB/2_3/AAGAC/2_3-AAGAC.mcs
MCSYM-DB/2_3/AAGAC/ds-2_3-AAGAC_x.pdb.gz
MCSYM-DB/2_3/AAGAG/
MCSYM-DB/2_3/AAGAG/2_3-AAGAG.mcs
MCSYM-DB/2_3/AAGAG/ds-2_3-AAGAG_x.pdb.gz
MCSYM-DB/2_3/AAGAU/
MCSYM-DB/2_3/AAGAU/2_3-AAGAU.mcs
MCSYM-DB/2_3/AAGAU/ds-2_3-AAGAU_x.pdb.gz
MCSYM-DB/2_3/AAGCA/
MCSYM-DB/2_3/AAGCA/2_3-AAGCA.mcs
MCSYM-DB/2_3/AAGCA/ds-2_3-AAGCA_x.pdb.gz
MCSYM-DB/2_3/AAGCC/
MCSYM-DB/2_3/AAGCC/2_3-AAGCC.mcs
MCSYM-DB/2_3/AAGCC/ds-2_3-AAGCC_x.pdb.gz
MCSYM-DB/2_3/AAGCG/
MCSYM-DB/2_3/AAGCG/2_3-AAGCG.mcs
MCSYM-DB/2_3/AAGCG/ds-2_3-AAGCG_x.pdb.gz
MCSYM-DB/2_3/AAGCU/
MCSYM-DB/2_3/AAGCU/2_3-AAGCU.mcs
MCSYM-DB/2_3/AAGCU/ds-2_3-AAGCU_x.pdb.gz
MCSYM-DB/2_3/AAGGA/
MCSYM-DB/2_3/AAGGA/2_3-AAGGA.mcs
MCSYM-DB/2_3/AAGGA/ds-2_3-AAGGA_x.pdb.gz
MCSYM-DB/2_3/AAGGC/
MCSYM-DB/2_3/AAGGC/2_3-AAGGC.mcs
MCSYM-DB/2_3/AAGGC/ds-2_3-AAGGC_x.pdb.gz
MCSYM-DB/2_3/AAGGG/
MCSYM-DB/2_3/AAGGG/2_3-AAGGG.mcs
MCSYM-DB/2_3/AAGGG/ds-2_3-AAGGG_x.pdb.gz
MCSYM-DB/2_3/AAGGU/
MCSYM-DB/2_3/AAGGU/2_3-AAGGU.mcs
MCSYM-DB/2_3/AAGGU/ds-2_3-AAGGU_x.pdb.gz
MCSYM-DB/2_3/AAGUA/
MCSYM-DB/2_3/AAGUA/ds-2_3-AAGUA_x.pdb.gz
MCSYM-DB/2_3/AAGUC/
MCSYM-DB/2_3/AAGUC/2_3-AAGUC.mcs
MCSYM-DB/2_3/AAGUC/ds-2_3-AAGUC_x.pdb.gz
MCSYM-DB/2_3/AAGUG/
MCSYM-DB/2_3/AAGUG/2_3-AAGUG.mcs
MCSYM-DB/2_3/AAGUG/ds-2_3-AAGUG_x.pdb.gz
MCSYM-DB/2_3/AAGUU/
MCSYM-DB/2_3/AAGUU/2_3-AAGUU.mcs
MCSYM-DB/2_3/AAGUU/ds-2_3-AAGUU_x.pdb.gz
MCSYM-DB/2_3/AAUAA/
MCSYM-DB/2_3/AAUAA/2_3-AAUAA.mcs
MCSYM-DB/2_3/AAUAA/ds-2_3-AAUAA_x.pdb.gz
MCSYM-DB/2_3/AAUAC/
MCSYM-DB/2_3/AAUAC/2_3-AAUAC.mcs
MCSYM-DB/2_3/AAUAC/ds-2_3-AAUAC_x.pdb.gz
MCSYM-DB/2_3/AAUAG/
MCSYM-DB/2_3/AAUAG/2_3-AAUAG.mcs
MCSYM-DB/2_3/AAUAG/ds-2_3-AAUAG_x.pdb.gz
MCSYM-DB/2_3/AAUAU/
MCSYM-DB/2_3/AAUAU/2_3-AAUAU.mcs
MCSYM-DB/2_3/AAUAU/ds-2_3-AAUAU_x.pdb.gz
MCSYM-DB/2_3/AAUCA/
MCSYM-DB/2_3/AAUCA/2_3-AAUCA.mcs
MCSYM-DB/2_3/AAUCA/ds-2_3-AAUCA_x.pdb.gz
MCSYM-DB/2_3/AAUCC/
MCSYM-DB/2_3/AAUCC/2_3-AAUCC.mcs
MCSYM-DB/2_3/AAUCC/ds-2_3-AAUCC_x.pdb.gz
MCSYM-DB/2_3/AAUCG/
MCSYM-DB/2_3/AAUCG/2_3-AAUCG.mcs
MCSYM-DB/2_3/AAUCG/ds-2_3-AAUCG_x.pdb.gz
MCSYM-DB/2_3/AAUCU/
MCSYM-DB/2_3/AAUCU/2_3-AAUCU.mcs
MCSYM-DB/2_3/AAUCU/ds-2_3-AAUCU_x.pdb.gz
MCSYM-DB/2_3/AAUGA/
MCSYM-DB/2_3/AAUGA/2_3-AAUGA.mcs
MCSYM-DB/2_3/AAUGA/ds-2_3-AAUGA_x.pdb.gz
MCSYM-DB/2_3/AAUGC/
MCSYM-DB/2_3/AAUGC/2_3-AAUGC.mcs
MCSYM-DB/2_3/AAUGC/ds-2_3-AAUGC_x.pdb.gz
MCSYM-DB/2_3/AAUGG/
MCSYM-DB/2_3/AAUGG/2_3-AAUGG.mcs
MCSYM-DB/2_3/AAUGG/ds-2_3-AAUGG_x.pdb.gz
MCSYM-DB/2_3/AAUGU/
MCSYM-DB/2_3/AAUGU/2_3-AAUGU.mcs
MCSYM-DB/2_3/AAUGU/ds-2_3-AAUGU_x.pdb.gz
MCSYM-DB/2_3/AAUUA/
MCSYM-DB/2_3/AAUUA/2_3-AAUUA.mcs
MCSYM-DB/2_3/AAUUA/ds-2_3-AAUUA_x.pdb.gz
MCSYM-DB/2_3/AAUUC/
MCSYM-DB/2_3/AAUUC/2_3-AAUUC.mcs
MCSYM-DB/2_3/AAUUC/ds-2_3-AAUUC_x.pdb.gz
MCSYM-DB/2_3/AAUUG/
MCSYM-DB/2_3/AAUUG/2_3-AAUUG.mcs
MCSYM-DB/2_3/AAUUG/ds-2_3-AAUUG_x.pdb.gz
MCSYM-DB/2_3/AAUUU/
MCSYM-DB/2_3/AAUUU/2_3-AAUUU.mcs
MCSYM-DB/2_3/AAUUU/ds-2_3-AAUUU_x.pdb.gz
MCSYM-DB/2_3/ACAAA/
MCSYM-DB/2_3/ACAAA/2_3-ACAAA.mcs
MCSYM-DB/2_3/ACAAA/ds-2_3-ACAAA_x.pdb.gz
MCSYM-DB/2_3/ACAAC/
MCSYM-DB/2_3/ACAAC/2_3-ACAAC.mcs
MCSYM-DB/2_3/ACAAC/ds-2_3-ACAAC_x.pdb.gz
MCSYM-DB/2_3/ACAAG/
MCSYM-DB/2_3/ACAAG/2_3-ACAAG.mcs
MCSYM-DB/2_3/ACAAG/ds-2_3-ACAAG_x.pdb.gz
MCSYM-DB/2_3/ACAAU/
MCSYM-DB/2_3/ACAAU/2_3-ACAAU.mcs
MCSYM-DB/2_3/ACAAU/ds-2_3-ACAAU_x.pdb.gz
MCSYM-DB/2_3/ACAC/
MCSYM-DB/2_3/ACACA/
MCSYM-DB/2_3/ACACA/2_3-ACACA.mcs
MCSYM-DB/2_3/ACACA/ds-2_3-ACACA.pdb.gz
MCSYM-DB/2_3/ACACA/ds-2_3-ACACA_x.pdb.gz
MCSYM-DB/2_3/ACACC/
MCSYM-DB/2_3/ACACC/2_3-ACACC.mcs
MCSYM-DB/2_3/ACACC/ds-2_3-ACACC_x.pdb.gz
MCSYM-DB/2_3/ACACG/
MCSYM-DB/2_3/ACACG/ds-2_3-ACACG_x.pdb.gz
MCSYM-DB/2_3/ACACU/
MCSYM-DB/2_3/ACACU/2_3-ACACU.mcs
MCSYM-DB/2_3/ACACU/ds-2_3-ACACU_x.pdb.gz
MCSYM-DB/2_3/ACAGA/
MCSYM-DB/2_3/ACAGA/2_3-ACAGA.mcs
MCSYM-DB/2_3/ACAGA/ds-2_3-ACAGA_x.pdb.gz
MCSYM-DB/2_3/ACAGC/
MCSYM-DB/2_3/ACAGC/2_3-ACAGC.mcs
MCSYM-DB/2_3/ACAGC/ds-2_3-ACAGC_x.pdb.gz
MCSYM-DB/2_3/ACAGG/
MCSYM-DB/2_3/ACAGG/2_3-ACAGG.mcs
MCSYM-DB/2_3/ACAGG/ds-2_3-ACAGG_x.pdb.gz
MCSYM-DB/2_3/ACAGU/
MCSYM-DB/2_3/ACAGU/2_3-ACAGU.mcs
MCSYM-DB/2_3/ACAGU/ds-2_3-ACAGU_x.pdb.gz
MCSYM-DB/2_3/ACAUA/
MCSYM-DB/2_3/ACAUA/2_3-ACAUA.mcs
MCSYM-DB/2_3/ACAUA/ds-2_3-ACAUA_x.pdb.gz
MCSYM-DB/2_3/ACAUC/
MCSYM-DB/2_3/ACAUC/2_3-ACAUC.mcs
MCSYM-DB/2_3/ACAUC/ds-2_3-ACAUC_x.pdb.gz
MCSYM-DB/2_3/ACAUG/
MCSYM-DB/2_3/ACAUG/2_3-ACAUG.mcs
MCSYM-DB/2_3/ACAUG/ds-2_3-ACAUG_x.pdb.gz
MCSYM-DB/2_3/ACAUU/
MCSYM-DB/2_3/ACAUU/2_3-ACAUU.mcs
MCSYM-DB/2_3/ACAUU/ds-2_3-ACAUU_x.pdb.gz
MCSYM-DB/2_3/ACCAA/
MCSYM-DB/2_3/ACCAA/2_3-ACCAA.mcs
MCSYM-DB/2_3/ACCAA/ds-2_3-ACCAA_x.pdb.gz
MCSYM-DB/2_3/ACCAC/
MCSYM-DB/2_3/ACCAC/2_3-ACCAC.mcs
MCSYM-DB/2_3/ACCAC/ds-2_3-ACCAC_x.pdb.gz
MCSYM-DB/2_3/ACCAG/
MCSYM-DB/2_3/ACCAG/2_3-ACCAG.mcs
MCSYM-DB/2_3/ACCAG/ds-2_3-ACCAG_x.pdb.gz
MCSYM-DB/2_3/ACCAU/
MCSYM-DB/2_3/ACCAU/2_3-ACCAU.mcs
MCSYM-DB/2_3/ACCAU/ds-2_3-ACCAU_x.pdb.gz
MCSYM-DB/2_3/ACCCA/
MCSYM-DB/2_3/ACCCA/2_3-ACCCA.mcs
MCSYM-DB/2_3/ACCCA/ds-2_3-ACCCA_x.pdb.gz
MCSYM-DB/2_3/ACCCC/
MCSYM-DB/2_3/ACCCC/ds-2_3-ACCCC_x.pdb.gz
MCSYM-DB/2_3/ACCCG/
MCSYM-DB/2_3/ACCCG/2_3-ACCCG.mcs
MCSYM-DB/2_3/ACCCG/ds-2_3-ACCCG_x.pdb.gz
MCSYM-DB/2_3/ACCCU/
MCSYM-DB/2_3/ACCCU/2_3-ACCCU.mcs
MCSYM-DB/2_3/ACCCU/ds-2_3-ACCCU_x.pdb.gz
MCSYM-DB/2_3/ACCGA/
MCSYM-DB/2_3/ACCGA/ds-2_3-ACCGA_x.pdb.gz
MCSYM-DB/2_3/ACCGC/
MCSYM-DB/2_3/ACCGC/2_3-ACCGC.mcs
MCSYM-DB/2_3/ACCGC/ds-2_3-ACCGC_x.pdb.gz
MCSYM-DB/2_3/ACCGG/
MCSYM-DB/2_3/ACCGG/ds-2_3-ACCGG_x.pdb.gz
MCSYM-DB/2_3/ACCGU/
MCSYM-DB/2_3/ACCGU/2_3-ACCGU.mcs
MCSYM-DB/2_3/ACCGU/ds-2_3-ACCGU_x.pdb.gz
MCSYM-DB/2_3/ACCUA/
MCSYM-DB/2_3/ACCUA/ds-2_3-ACCUA_x.pdb.gz
MCSYM-DB/2_3/ACCUC/
MCSYM-DB/2_3/ACCUC/ds-2_3-ACCUC_x.pdb.gz
MCSYM-DB/2_3/ACCUG/
MCSYM-DB/2_3/ACCUG/2_3-ACCUG.mcs
MCSYM-DB/2_3/ACCUG/ds-2_3-ACCUG_x.pdb.gz
MCSYM-DB/2_3/ACCUU/
MCSYM-DB/2_3/ACCUU/2_3-ACCUU.mcs
MCSYM-DB/2_3/ACCUU/ds-2_3-ACCUU_x.pdb.gz
MCSYM-DB/2_3/ACGAA/
MCSYM-DB/2_3/ACGAA/2GM0_model_1.pdb.gz
MCSYM-DB/2_3/ACGAA/2_3-ACGAA.mcs
MCSYM-DB/2_3/ACGAA/ds-2_3-ACGAA_x.pdb.gz
MCSYM-DB/2_3/ACGAC/
MCSYM-DB/2_3/ACGAC/2_3-ACGAC.mcs
MCSYM-DB/2_3/ACGAC/ds-2_3-ACGAC_x.pdb.gz
MCSYM-DB/2_3/ACGAG/
MCSYM-DB/2_3/ACGAG/2_3-ACGAG.mcs
MCSYM-DB/2_3/ACGAG/ds-2_3-ACGAG_x.pdb.gz
MCSYM-DB/2_3/ACGAU/
MCSYM-DB/2_3/ACGAU/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/ACGAU/2_3-ACGAU.mcs
MCSYM-DB/2_3/ACGAU/ds-2_3-ACGAU_x.pdb.gz
MCSYM-DB/2_3/ACGCA/
MCSYM-DB/2_3/ACGCA/2_3-ACGCA.mcs
MCSYM-DB/2_3/ACGCA/ds-2_3-ACGCA_x.pdb.gz
MCSYM-DB/2_3/ACGCC/
MCSYM-DB/2_3/ACGCC/2_3-ACGCC.mcs
MCSYM-DB/2_3/ACGCC/ds-2_3-ACGCC_x.pdb.gz
MCSYM-DB/2_3/ACGCG/
MCSYM-DB/2_3/ACGCG/2_3-ACGCG.mcs
MCSYM-DB/2_3/ACGCG/ds-2_3-ACGCG_x.pdb.gz
MCSYM-DB/2_3/ACGCU/
MCSYM-DB/2_3/ACGCU/1NBR_model_1.pdb.gz
MCSYM-DB/2_3/ACGCU/2_3-ACGCU.mcs
MCSYM-DB/2_3/ACGCU/ds-2_3-ACGCU.pdb.gz
MCSYM-DB/2_3/ACGCU/ds-2_3-ACGCU_x.pdb.gz
MCSYM-DB/2_3/ACGGA/
MCSYM-DB/2_3/ACGGA/2_3-ACGGA.mcs
MCSYM-DB/2_3/ACGGA/ds-2_3-ACGGA_x.pdb.gz
MCSYM-DB/2_3/ACGGC/
MCSYM-DB/2_3/ACGGC/2_3-ACGGC.mcs
MCSYM-DB/2_3/ACGGC/ds-2_3-ACGGC_x.pdb.gz
MCSYM-DB/2_3/ACGGG/
MCSYM-DB/2_3/ACGGG/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/ACGGG/2_3-ACGGG.mcs
MCSYM-DB/2_3/ACGGG/ds-2_3-ACGGG_x.pdb.gz
MCSYM-DB/2_3/ACGGU/
MCSYM-DB/2_3/ACGGU/2_3-ACGGU.mcs
MCSYM-DB/2_3/ACGGU/ds-2_3-ACGGU_x.pdb.gz
MCSYM-DB/2_3/ACGUA/
MCSYM-DB/2_3/ACGUA/2_3-ACGUA.mcs
MCSYM-DB/2_3/ACGUA/ds-2_3-ACGUA_x.pdb.gz
MCSYM-DB/2_3/ACGUC/
MCSYM-DB/2_3/ACGUC/2_3-ACGUC.mcs
MCSYM-DB/2_3/ACGUC/ds-2_3-ACGUC_x.pdb.gz
MCSYM-DB/2_3/ACGUG/
MCSYM-DB/2_3/ACGUG/2_3-ACGUG.mcs
MCSYM-DB/2_3/ACGUG/ds-2_3-ACGUG_x.pdb.gz
MCSYM-DB/2_3/ACGUU/
MCSYM-DB/2_3/ACGUU/1L8V_model_1.pdb.gz
MCSYM-DB/2_3/ACGUU/2_3-ACGUU.mcs
MCSYM-DB/2_3/ACGUU/ds-2_3-ACGUU.pdb.gz
MCSYM-DB/2_3/ACGUU/ds-2_3-ACGUU_x.pdb.gz
MCSYM-DB/2_3/ACUAA/
MCSYM-DB/2_3/ACUAA/ds-2_3-ACUAA_x.pdb.gz
MCSYM-DB/2_3/ACUAC/
MCSYM-DB/2_3/ACUAC/2_3-ACUAC.mcs
MCSYM-DB/2_3/ACUAC/ds-2_3-ACUAC_x.pdb.gz
MCSYM-DB/2_3/ACUAG/
MCSYM-DB/2_3/ACUAG/ds-2_3-ACUAG_x.pdb.gz
MCSYM-DB/2_3/ACUAU/
MCSYM-DB/2_3/ACUAU/2_3-ACUAU.mcs
MCSYM-DB/2_3/ACUAU/ds-2_3-ACUAU_x.pdb.gz
MCSYM-DB/2_3/ACUCA/
MCSYM-DB/2_3/ACUCA/2_3-ACUCA.mcs
MCSYM-DB/2_3/ACUCA/ds-2_3-ACUCA_x.pdb.gz
MCSYM-DB/2_3/ACUCC/
MCSYM-DB/2_3/ACUCC/2_3-ACUCC.mcs
MCSYM-DB/2_3/ACUCC/ds-2_3-ACUCC_x.pdb.gz
MCSYM-DB/2_3/ACUCG/
MCSYM-DB/2_3/ACUCG/ds-2_3-ACUCG_x.pdb.gz
MCSYM-DB/2_3/ACUCU/
MCSYM-DB/2_3/ACUCU/2_3-ACUCU.mcs
MCSYM-DB/2_3/ACUCU/ds-2_3-ACUCU_x.pdb.gz
MCSYM-DB/2_3/ACUGA/
MCSYM-DB/2_3/ACUGA/ds-2_3-ACUGA_x.pdb.gz
MCSYM-DB/2_3/ACUGC/
MCSYM-DB/2_3/ACUGC/ds-2_3-ACUGC_x.pdb.gz
MCSYM-DB/2_3/ACUGG/
MCSYM-DB/2_3/ACUGG/2_3-ACUGG.mcs
MCSYM-DB/2_3/ACUGG/ds-2_3-ACUGG_x.pdb.gz
MCSYM-DB/2_3/ACUGU/
MCSYM-DB/2_3/ACUGU/2_3-ACUGU.mcs
MCSYM-DB/2_3/ACUGU/ds-2_3-ACUGU_x.pdb.gz
MCSYM-DB/2_3/ACUUA/
MCSYM-DB/2_3/ACUUA/2_3-ACUUA.mcs
MCSYM-DB/2_3/ACUUA/ds-2_3-ACUUA_x.pdb.gz
MCSYM-DB/2_3/ACUUC/
MCSYM-DB/2_3/ACUUC/ds-2_3-ACUUC_x.pdb.gz
MCSYM-DB/2_3/ACUUG/
MCSYM-DB/2_3/ACUUG/2_3-ACUUG.mcs
MCSYM-DB/2_3/ACUUG/ds-2_3-ACUUG_x.pdb.gz
MCSYM-DB/2_3/ACUUU/
MCSYM-DB/2_3/ACUUU/2_3-ACUUU.mcs
MCSYM-DB/2_3/ACUUU/ds-2_3-ACUUU_x.pdb.gz
MCSYM-DB/2_3/AGAAA/
MCSYM-DB/2_3/AGAAA/2_3-AGAAA.mcs
MCSYM-DB/2_3/AGAAA/ds-2_3-AGAAA_x.pdb.gz
MCSYM-DB/2_3/AGAAC/
MCSYM-DB/2_3/AGAAC/2_3-AGAAC.mcs
MCSYM-DB/2_3/AGAAC/ds-2_3-AGAAC_x.pdb.gz
MCSYM-DB/2_3/AGAAG/
MCSYM-DB/2_3/AGAAG/2_3-AGAAG.mcs
MCSYM-DB/2_3/AGAAG/ds-2_3-AGAAG_x.pdb.gz
MCSYM-DB/2_3/AGAAU/
MCSYM-DB/2_3/AGAAU/1U8D_model_1.pdb.gz
MCSYM-DB/2_3/AGAAU/1Y26_model_1.pdb.gz
MCSYM-DB/2_3/AGAAU/1Y27_model_1.pdb.gz
MCSYM-DB/2_3/AGAAU/2_3-AGAAU.mcs
MCSYM-DB/2_3/AGAAU/ds-2_3-AGAAU_x.pdb.gz
MCSYM-DB/2_3/AGACA/
MCSYM-DB/2_3/AGACA/2_3-AGACA.mcs
MCSYM-DB/2_3/AGACA/ds-2_3-AGACA_x.pdb.gz
MCSYM-DB/2_3/AGACC/
MCSYM-DB/2_3/AGACC/2_3-AGACC.mcs
MCSYM-DB/2_3/AGACC/ds-2_3-AGACC_x.pdb.gz
MCSYM-DB/2_3/AGACG/
MCSYM-DB/2_3/AGACG/2_3-AGACG.mcs
MCSYM-DB/2_3/AGACG/ds-2_3-AGACG_x.pdb.gz
MCSYM-DB/2_3/AGACU/
MCSYM-DB/2_3/AGACU/2_3-AGACU.mcs
MCSYM-DB/2_3/AGACU/ds-2_3-AGACU_x.pdb.gz
MCSYM-DB/2_3/AGAGA/
MCSYM-DB/2_3/AGAGA/2_3-AGAGA.mcs
MCSYM-DB/2_3/AGAGA/ds-2_3-AGAGA_x.pdb.gz
MCSYM-DB/2_3/AGAGC/
MCSYM-DB/2_3/AGAGC/2_3-AGAGC.mcs
MCSYM-DB/2_3/AGAGC/ds-2_3-AGAGC_x.pdb.gz
MCSYM-DB/2_3/AGAGG/
MCSYM-DB/2_3/AGAGG/2_3-AGAGG.mcs
MCSYM-DB/2_3/AGAGG/ds-2_3-AGAGG_x.pdb.gz
MCSYM-DB/2_3/AGAGU/
MCSYM-DB/2_3/AGAGU/2_3-AGAGU.mcs
MCSYM-DB/2_3/AGAGU/ds-2_3-AGAGU_x.pdb.gz
MCSYM-DB/2_3/AGAUA/
MCSYM-DB/2_3/AGAUA/2_3-AGAUA.mcs
MCSYM-DB/2_3/AGAUA/ds-2_3-AGAUA_x.pdb.gz
MCSYM-DB/2_3/AGAUC/
MCSYM-DB/2_3/AGAUC/2_3-AGAUC.mcs
MCSYM-DB/2_3/AGAUC/ds-2_3-AGAUC_x.pdb.gz
MCSYM-DB/2_3/AGAUG/
MCSYM-DB/2_3/AGAUG/2_3-AGAUG.mcs
MCSYM-DB/2_3/AGAUG/ds-2_3-AGAUG_x.pdb.gz
MCSYM-DB/2_3/AGAUU/
MCSYM-DB/2_3/AGAUU/2_3-AGAUU.mcs
MCSYM-DB/2_3/AGAUU/ds-2_3-AGAUU_x.pdb.gz
MCSYM-DB/2_3/AGCAA/
MCSYM-DB/2_3/AGCAA/1H3E_model_1.pdb.gz
MCSYM-DB/2_3/AGCAA/2_3-AGCAA.mcs
MCSYM-DB/2_3/AGCAA/ds-2_3-AGCAA_x.pdb.gz
MCSYM-DB/2_3/AGCAC/
MCSYM-DB/2_3/AGCAC/2_3-AGCAC.mcs
MCSYM-DB/2_3/AGCAC/ds-2_3-AGCAC_x.pdb.gz
MCSYM-DB/2_3/AGCAG/
MCSYM-DB/2_3/AGCAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/AGCAG/2_3-AGCAG.mcs
MCSYM-DB/2_3/AGCAG/ds-2_3-AGCAG_x.pdb.gz
MCSYM-DB/2_3/AGCAU/
MCSYM-DB/2_3/AGCAU/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/AGCAU/2_3-AGCAU.mcs
MCSYM-DB/2_3/AGCAU/ds-2_3-AGCAU_x.pdb.gz
MCSYM-DB/2_3/AGCCA/
MCSYM-DB/2_3/AGCCA/2_3-AGCCA.mcs
MCSYM-DB/2_3/AGCCA/ds-2_3-AGCCA_x.pdb.gz
MCSYM-DB/2_3/AGCCC/
MCSYM-DB/2_3/AGCCC/2_3-AGCCC.mcs
MCSYM-DB/2_3/AGCCC/ds-2_3-AGCCC_x.pdb.gz
MCSYM-DB/2_3/AGCCG/
MCSYM-DB/2_3/AGCCG/2_3-AGCCG.mcs
MCSYM-DB/2_3/AGCCG/ds-2_3-AGCCG_x.pdb.gz
MCSYM-DB/2_3/AGCCU/
MCSYM-DB/2_3/AGCCU/2_3-AGCCU.mcs
MCSYM-DB/2_3/AGCCU/ds-2_3-AGCCU_x.pdb.gz
MCSYM-DB/2_3/AGCGA/
MCSYM-DB/2_3/AGCGA/2_3-AGCGA.mcs
MCSYM-DB/2_3/AGCGA/ds-2_3-AGCGA_x.pdb.gz
MCSYM-DB/2_3/AGCGC/
MCSYM-DB/2_3/AGCGC/2_3-AGCGC.mcs
MCSYM-DB/2_3/AGCGC/ds-2_3-AGCGC_x.pdb.gz
MCSYM-DB/2_3/AGCGG/
MCSYM-DB/2_3/AGCGG/2_3-AGCGG.mcs
MCSYM-DB/2_3/AGCGG/ds-2_3-AGCGG_x.pdb.gz
MCSYM-DB/2_3/AGCGU/
MCSYM-DB/2_3/AGCGU/1F5U_model_1.pdb.gz
MCSYM-DB/2_3/AGCGU/2_3-AGCGU.mcs
MCSYM-DB/2_3/AGCGU/ds-2_3-AGCGU_x.pdb.gz
MCSYM-DB/2_3/AGCUA/
MCSYM-DB/2_3/AGCUA/2_3-AGCUA.mcs
MCSYM-DB/2_3/AGCUA/ds-2_3-AGCUA_x.pdb.gz
MCSYM-DB/2_3/AGCUC/
MCSYM-DB/2_3/AGCUC/2_3-AGCUC.mcs
MCSYM-DB/2_3/AGCUC/ds-2_3-AGCUC_x.pdb.gz
MCSYM-DB/2_3/AGCUG/
MCSYM-DB/2_3/AGCUG/2_3-AGCUG.mcs
MCSYM-DB/2_3/AGCUG/ds-2_3-AGCUG_x.pdb.gz
MCSYM-DB/2_3/AGCUU/
MCSYM-DB/2_3/AGCUU/1M82_model_1.pdb.gz
MCSYM-DB/2_3/AGCUU/2_3-AGCUU.mcs
MCSYM-DB/2_3/AGCUU/ds-2_3-AGCUU_x.pdb.gz
MCSYM-DB/2_3/AGGAA/
MCSYM-DB/2_3/AGGAA/2_3-AGGAA.mcs
MCSYM-DB/2_3/AGGAA/ds-2_3-AGGAA_x.pdb.gz
MCSYM-DB/2_3/AGGAC/
MCSYM-DB/2_3/AGGAC/ds-2_3-AGGAC_x.pdb.gz
MCSYM-DB/2_3/AGGAG/
MCSYM-DB/2_3/AGGAG/2_3-AGGAG.mcs
MCSYM-DB/2_3/AGGAG/ds-2_3-AGGAG_x.pdb.gz
MCSYM-DB/2_3/AGGAU/
MCSYM-DB/2_3/AGGAU/2_3-AGGAU.mcs
MCSYM-DB/2_3/AGGAU/ds-2_3-AGGAU_x.pdb.gz
MCSYM-DB/2_3/AGGCA/
MCSYM-DB/2_3/AGGCA/2_3-AGGCA.mcs
MCSYM-DB/2_3/AGGCA/ds-2_3-AGGCA_x.pdb.gz
MCSYM-DB/2_3/AGGCC/
MCSYM-DB/2_3/AGGCC/2_3-AGGCC.mcs
MCSYM-DB/2_3/AGGCC/ds-2_3-AGGCC_x.pdb.gz
MCSYM-DB/2_3/AGGCG/
MCSYM-DB/2_3/AGGCG/2_3-AGGCG.mcs
MCSYM-DB/2_3/AGGCG/ds-2_3-AGGCG_x.pdb.gz
MCSYM-DB/2_3/AGGCU/
MCSYM-DB/2_3/AGGCU/2_3-AGGCU.mcs
MCSYM-DB/2_3/AGGCU/ds-2_3-AGGCU_x.pdb.gz
MCSYM-DB/2_3/AGGGA/
MCSYM-DB/2_3/AGGGA/2_3-AGGGA.mcs
MCSYM-DB/2_3/AGGGA/ds-2_3-AGGGA_x.pdb.gz
MCSYM-DB/2_3/AGGGC/
MCSYM-DB/2_3/AGGGC/2_3-AGGGC.mcs
MCSYM-DB/2_3/AGGGC/ds-2_3-AGGGC_x.pdb.gz
MCSYM-DB/2_3/AGGGG/
MCSYM-DB/2_3/AGGGG/2_3-AGGGG.mcs
MCSYM-DB/2_3/AGGGG/ds-2_3-AGGGG_x.pdb.gz
MCSYM-DB/2_3/AGGGU/
MCSYM-DB/2_3/AGGGU/2_3-AGGGU.mcs
MCSYM-DB/2_3/AGGGU/ds-2_3-AGGGU_x.pdb.gz
MCSYM-DB/2_3/AGGUA/
MCSYM-DB/2_3/AGGUA/ds-2_3-AGGUA_x.pdb.gz
MCSYM-DB/2_3/AGGUC/
MCSYM-DB/2_3/AGGUC/ds-2_3-AGGUC_x.pdb.gz
MCSYM-DB/2_3/AGGUG/
MCSYM-DB/2_3/AGGUG/2_3-AGGUG.mcs
MCSYM-DB/2_3/AGGUG/ds-2_3-AGGUG_x.pdb.gz
MCSYM-DB/2_3/AGGUU/
MCSYM-DB/2_3/AGGUU/2_3-AGGUU.mcs
MCSYM-DB/2_3/AGGUU/ds-2_3-AGGUU_x.pdb.gz
MCSYM-DB/2_3/AGUAA/
MCSYM-DB/2_3/AGUAA/2_3-AGUAA.mcs
MCSYM-DB/2_3/AGUAA/ds-2_3-AGUAA_x.pdb.gz
MCSYM-DB/2_3/AGUAC/
MCSYM-DB/2_3/AGUAC/2_3-AGUAC.mcs
MCSYM-DB/2_3/AGUAC/ds-2_3-AGUAC_x.pdb.gz
MCSYM-DB/2_3/AGUAG/
MCSYM-DB/2_3/AGUAG/2_3-AGUAG.mcs
MCSYM-DB/2_3/AGUAG/ds-2_3-AGUAG_x.pdb.gz
MCSYM-DB/2_3/AGUAU/
MCSYM-DB/2_3/AGUAU/1L8V_model_1.pdb.gz
MCSYM-DB/2_3/AGUAU/2_3-AGUAU.mcs
MCSYM-DB/2_3/AGUAU/ds-2_3-AGUAU_x.pdb.gz
MCSYM-DB/2_3/AGUCA/
MCSYM-DB/2_3/AGUCA/2_3-AGUCA.mcs
MCSYM-DB/2_3/AGUCA/ds-2_3-AGUCA_x.pdb.gz
MCSYM-DB/2_3/AGUCC/
MCSYM-DB/2_3/AGUCC/2_3-AGUCC.mcs
MCSYM-DB/2_3/AGUCC/ds-2_3-AGUCC_x.pdb.gz
MCSYM-DB/2_3/AGUCG/
MCSYM-DB/2_3/AGUCG/2_3-AGUCG.mcs
MCSYM-DB/2_3/AGUCG/ds-2_3-AGUCG_x.pdb.gz
MCSYM-DB/2_3/AGUCU/
MCSYM-DB/2_3/AGUCU/2_3-AGUCU.mcs
MCSYM-DB/2_3/AGUCU/ds-2_3-AGUCU_x.pdb.gz
MCSYM-DB/2_3/AGUGA/
MCSYM-DB/2_3/AGUGA/2_3-AGUGA.mcs
MCSYM-DB/2_3/AGUGA/ds-2_3-AGUGA_x.pdb.gz
MCSYM-DB/2_3/AGUGC/
MCSYM-DB/2_3/AGUGC/2_3-AGUGC.mcs
MCSYM-DB/2_3/AGUGC/ds-2_3-AGUGC_x.pdb.gz
MCSYM-DB/2_3/AGUGG/
MCSYM-DB/2_3/AGUGG/2_3-AGUGG.mcs
MCSYM-DB/2_3/AGUGG/ds-2_3-AGUGG_x.pdb.gz
MCSYM-DB/2_3/AGUGU/
MCSYM-DB/2_3/AGUGU/2_3-AGUGU.mcs
MCSYM-DB/2_3/AGUGU/ds-2_3-AGUGU_x.pdb.gz
MCSYM-DB/2_3/AGUUA/
MCSYM-DB/2_3/AGUUA/2_3-AGUUA.mcs
MCSYM-DB/2_3/AGUUA/ds-2_3-AGUUA_x.pdb.gz
MCSYM-DB/2_3/AGUUC/
MCSYM-DB/2_3/AGUUC/2_3-AGUUC.mcs
MCSYM-DB/2_3/AGUUC/ds-2_3-AGUUC_x.pdb.gz
MCSYM-DB/2_3/AGUUG/
MCSYM-DB/2_3/AGUUG/2_3-AGUUG.mcs
MCSYM-DB/2_3/AGUUG/ds-2_3-AGUUG_x.pdb.gz
MCSYM-DB/2_3/AGUUU/
MCSYM-DB/2_3/AGUUU/2_3-AGUUU.mcs
MCSYM-DB/2_3/AGUUU/ds-2_3-AGUUU_x.pdb.gz
MCSYM-DB/2_3/AUAAA/
MCSYM-DB/2_3/AUAAA/1L1C_model_1.pdb.gz
MCSYM-DB/2_3/AUAAA/2_3-AUAAA.mcs
MCSYM-DB/2_3/AUAAA/ds-2_3-AUAAA_x.pdb.gz
MCSYM-DB/2_3/AUAAC/
MCSYM-DB/2_3/AUAAC/2_3-AUAAC.mcs
MCSYM-DB/2_3/AUAAC/ds-2_3-AUAAC_x.pdb.gz
MCSYM-DB/2_3/AUAAG/
MCSYM-DB/2_3/AUAAG/2_3-AUAAG.mcs
MCSYM-DB/2_3/AUAAG/ds-2_3-AUAAG_x.pdb.gz
MCSYM-DB/2_3/AUAAU/
MCSYM-DB/2_3/AUAAU/2_3-AUAAU.mcs
MCSYM-DB/2_3/AUAAU/ds-2_3-AUAAU_x.pdb.gz
MCSYM-DB/2_3/AUACA/
MCSYM-DB/2_3/AUACA/2_3-AUACA.mcs
MCSYM-DB/2_3/AUACA/ds-2_3-AUACA_x.pdb.gz
MCSYM-DB/2_3/AUACC/
MCSYM-DB/2_3/AUACC/2_3-AUACC.mcs
MCSYM-DB/2_3/AUACC/ds-2_3-AUACC_x.pdb.gz
MCSYM-DB/2_3/AUACG/
MCSYM-DB/2_3/AUACG/2_3-AUACG.mcs
MCSYM-DB/2_3/AUACG/ds-2_3-AUACG_x.pdb.gz
MCSYM-DB/2_3/AUACU/
MCSYM-DB/2_3/AUACU/2_3-AUACU.mcs
MCSYM-DB/2_3/AUACU/ds-2_3-AUACU_x.pdb.gz
MCSYM-DB/2_3/AUAGA/
MCSYM-DB/2_3/AUAGA/2_3-AUAGA.mcs
MCSYM-DB/2_3/AUAGA/ds-2_3-AUAGA_x.pdb.gz
MCSYM-DB/2_3/AUAGC/
MCSYM-DB/2_3/AUAGC/2_3-AUAGC.mcs
MCSYM-DB/2_3/AUAGC/ds-2_3-AUAGC_x.pdb.gz
MCSYM-DB/2_3/AUAGG/
MCSYM-DB/2_3/AUAGG/2_3-AUAGG.mcs
MCSYM-DB/2_3/AUAGG/ds-2_3-AUAGG_x.pdb.gz
MCSYM-DB/2_3/AUAGU/
MCSYM-DB/2_3/AUAGU/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/AUAGU/2_3-AUAGU.mcs
MCSYM-DB/2_3/AUAGU/ds-2_3-AUAGU_x.pdb.gz
MCSYM-DB/2_3/AUAUA/
MCSYM-DB/2_3/AUAUA/2_3-AUAUA.mcs
MCSYM-DB/2_3/AUAUA/ds-2_3-AUAUA_x.pdb.gz
MCSYM-DB/2_3/AUAUC/
MCSYM-DB/2_3/AUAUC/2_3-AUAUC.mcs
MCSYM-DB/2_3/AUAUC/ds-2_3-AUAUC_x.pdb.gz
MCSYM-DB/2_3/AUAUG/
MCSYM-DB/2_3/AUAUG/2_3-AUAUG.mcs
MCSYM-DB/2_3/AUAUG/ds-2_3-AUAUG_x.pdb.gz
MCSYM-DB/2_3/AUAUU/
MCSYM-DB/2_3/AUAUU/2_3-AUAUU.mcs
MCSYM-DB/2_3/AUAUU/ds-2_3-AUAUU_x.pdb.gz
MCSYM-DB/2_3/AUCAA/
MCSYM-DB/2_3/AUCAA/2_3-AUCAA.mcs
MCSYM-DB/2_3/AUCAA/ds-2_3-AUCAA_x.pdb.gz
MCSYM-DB/2_3/AUCAC/
MCSYM-DB/2_3/AUCAC/2_3-AUCAC.mcs
MCSYM-DB/2_3/AUCAC/ds-2_3-AUCAC_x.pdb.gz
MCSYM-DB/2_3/AUCAG/
MCSYM-DB/2_3/AUCAG/2_3-AUCAG.mcs
MCSYM-DB/2_3/AUCAG/ds-2_3-AUCAG_x.pdb.gz
MCSYM-DB/2_3/AUCAU/
MCSYM-DB/2_3/AUCAU/2_3-AUCAU.mcs
MCSYM-DB/2_3/AUCAU/ds-2_3-AUCAU_x.pdb.gz
MCSYM-DB/2_3/AUCCA/
MCSYM-DB/2_3/AUCCA/2_3-AUCCA.mcs
MCSYM-DB/2_3/AUCCA/ds-2_3-AUCCA_x.pdb.gz
MCSYM-DB/2_3/AUCCC/
MCSYM-DB/2_3/AUCCC/2_3-AUCCC.mcs
MCSYM-DB/2_3/AUCCC/ds-2_3-AUCCC_x.pdb.gz
MCSYM-DB/2_3/AUCCG/
MCSYM-DB/2_3/AUCCG/ds-2_3-AUCCG_x.pdb.gz
MCSYM-DB/2_3/AUCCU/
MCSYM-DB/2_3/AUCCU/2_3-AUCCU.mcs
MCSYM-DB/2_3/AUCCU/ds-2_3-AUCCU_x.pdb.gz
MCSYM-DB/2_3/AUCGA/
MCSYM-DB/2_3/AUCGA/2_3-AUCGA.mcs
MCSYM-DB/2_3/AUCGA/ds-2_3-AUCGA_x.pdb.gz
MCSYM-DB/2_3/AUCGC/
MCSYM-DB/2_3/AUCGC/ds-2_3-AUCGC_x.pdb.gz
MCSYM-DB/2_3/AUCGG/
MCSYM-DB/2_3/AUCGG/2_3-AUCGG.mcs
MCSYM-DB/2_3/AUCGG/ds-2_3-AUCGG_x.pdb.gz
MCSYM-DB/2_3/AUCGU/
MCSYM-DB/2_3/AUCGU/2_3-AUCGU.mcs
MCSYM-DB/2_3/AUCGU/ds-2_3-AUCGU_x.pdb.gz
MCSYM-DB/2_3/AUCUA/
MCSYM-DB/2_3/AUCUA/2_3-AUCUA.mcs
MCSYM-DB/2_3/AUCUA/ds-2_3-AUCUA_x.pdb.gz
MCSYM-DB/2_3/AUCUC/
MCSYM-DB/2_3/AUCUC/2_3-AUCUC.mcs
MCSYM-DB/2_3/AUCUC/ds-2_3-AUCUC_x.pdb.gz
MCSYM-DB/2_3/AUCUG/
MCSYM-DB/2_3/AUCUG/2_3-AUCUG.mcs
MCSYM-DB/2_3/AUCUG/ds-2_3-AUCUG_x.pdb.gz
MCSYM-DB/2_3/AUCUU/
MCSYM-DB/2_3/AUCUU/2_3-AUCUU.mcs
MCSYM-DB/2_3/AUCUU/ds-2_3-AUCUU_x.pdb.gz
MCSYM-DB/2_3/AUGAA/
MCSYM-DB/2_3/AUGAA/2_3-AUGAA.mcs
MCSYM-DB/2_3/AUGAA/ds-2_3-AUGAA_x.pdb.gz
MCSYM-DB/2_3/AUGAC/
MCSYM-DB/2_3/AUGAC/2_3-AUGAC.mcs
MCSYM-DB/2_3/AUGAC/ds-2_3-AUGAC_x.pdb.gz
MCSYM-DB/2_3/AUGAG/
MCSYM-DB/2_3/AUGAG/2_3-AUGAG.mcs
MCSYM-DB/2_3/AUGAG/ds-2_3-AUGAG_x.pdb.gz
MCSYM-DB/2_3/AUGAU/
MCSYM-DB/2_3/AUGAU/2_3-AUGAU.mcs
MCSYM-DB/2_3/AUGAU/ds-2_3-AUGAU_x.pdb.gz
MCSYM-DB/2_3/AUGCA/
MCSYM-DB/2_3/AUGCA/2_3-AUGCA.mcs
MCSYM-DB/2_3/AUGCA/ds-2_3-AUGCA_x.pdb.gz
MCSYM-DB/2_3/AUGCC/
MCSYM-DB/2_3/AUGCC/2_3-AUGCC.mcs
MCSYM-DB/2_3/AUGCC/ds-2_3-AUGCC_x.pdb.gz
MCSYM-DB/2_3/AUGCG/
MCSYM-DB/2_3/AUGCG/2_3-AUGCG.mcs
MCSYM-DB/2_3/AUGCG/ds-2_3-AUGCG_x.pdb.gz
MCSYM-DB/2_3/AUGCU/
MCSYM-DB/2_3/AUGCU/2_3-AUGCU.mcs
MCSYM-DB/2_3/AUGCU/ds-2_3-AUGCU_x.pdb.gz
MCSYM-DB/2_3/AUGGA/
MCSYM-DB/2_3/AUGGA/2_3-AUGGA.mcs
MCSYM-DB/2_3/AUGGA/ds-2_3-AUGGA_x.pdb.gz
MCSYM-DB/2_3/AUGGC/
MCSYM-DB/2_3/AUGGC/2_3-AUGGC.mcs
MCSYM-DB/2_3/AUGGC/ds-2_3-AUGGC_x.pdb.gz
MCSYM-DB/2_3/AUGGG/
MCSYM-DB/2_3/AUGGG/2_3-AUGGG.mcs
MCSYM-DB/2_3/AUGGG/ds-2_3-AUGGG_x.pdb.gz
MCSYM-DB/2_3/AUGGU/
MCSYM-DB/2_3/AUGGU/2_3-AUGGU.mcs
MCSYM-DB/2_3/AUGGU/ds-2_3-AUGGU_x.pdb.gz
MCSYM-DB/2_3/AUGUA/
MCSYM-DB/2_3/AUGUA/2_3-AUGUA.mcs
MCSYM-DB/2_3/AUGUA/ds-2_3-AUGUA_x.pdb.gz
MCSYM-DB/2_3/AUGUC/
MCSYM-DB/2_3/AUGUC/2_3-AUGUC.mcs
MCSYM-DB/2_3/AUGUC/ds-2_3-AUGUC_x.pdb.gz
MCSYM-DB/2_3/AUGUG/
MCSYM-DB/2_3/AUGUG/2_3-AUGUG.mcs
MCSYM-DB/2_3/AUGUG/ds-2_3-AUGUG_x.pdb.gz
MCSYM-DB/2_3/AUGUU/
MCSYM-DB/2_3/AUGUU/2_3-AUGUU.mcs
MCSYM-DB/2_3/AUGUU/ds-2_3-AUGUU_x.pdb.gz
MCSYM-DB/2_3/AUUAA/
MCSYM-DB/2_3/AUUAA/2_3-AUUAA.mcs
MCSYM-DB/2_3/AUUAA/ds-2_3-AUUAA_x.pdb.gz
MCSYM-DB/2_3/AUUAC/
MCSYM-DB/2_3/AUUAC/2_3-AUUAC.mcs
MCSYM-DB/2_3/AUUAC/ds-2_3-AUUAC_x.pdb.gz
MCSYM-DB/2_3/AUUAG/
MCSYM-DB/2_3/AUUAG/ds-2_3-AUUAG_x.pdb.gz
MCSYM-DB/2_3/AUUAU/
MCSYM-DB/2_3/AUUAU/2_3-AUUAU.mcs
MCSYM-DB/2_3/AUUAU/ds-2_3-AUUAU_x.pdb.gz
MCSYM-DB/2_3/AUUCA/
MCSYM-DB/2_3/AUUCA/2_3-AUUCA.mcs
MCSYM-DB/2_3/AUUCA/ds-2_3-AUUCA_x.pdb.gz
MCSYM-DB/2_3/AUUCC/
MCSYM-DB/2_3/AUUCC/ds-2_3-AUUCC_x.pdb.gz
MCSYM-DB/2_3/AUUCG/
MCSYM-DB/2_3/AUUCG/2_3-AUUCG.mcs
MCSYM-DB/2_3/AUUCG/ds-2_3-AUUCG_x.pdb.gz
MCSYM-DB/2_3/AUUCU/
MCSYM-DB/2_3/AUUCU/2_3-AUUCU.mcs
MCSYM-DB/2_3/AUUCU/ds-2_3-AUUCU_x.pdb.gz
MCSYM-DB/2_3/AUUGA/
MCSYM-DB/2_3/AUUGA/2_3-AUUGA.mcs
MCSYM-DB/2_3/AUUGA/ds-2_3-AUUGA_x.pdb.gz
MCSYM-DB/2_3/AUUGC/
MCSYM-DB/2_3/AUUGC/2_3-AUUGC.mcs
MCSYM-DB/2_3/AUUGC/ds-2_3-AUUGC_x.pdb.gz
MCSYM-DB/2_3/AUUGG/
MCSYM-DB/2_3/AUUGG/2_3-AUUGG.mcs
MCSYM-DB/2_3/AUUGG/ds-2_3-AUUGG_x.pdb.gz
MCSYM-DB/2_3/AUUGU/
MCSYM-DB/2_3/AUUGU/2_3-AUUGU.mcs
MCSYM-DB/2_3/AUUGU/ds-2_3-AUUGU_x.pdb.gz
MCSYM-DB/2_3/AUUUA/
MCSYM-DB/2_3/AUUUA/2_3-AUUUA.mcs
MCSYM-DB/2_3/AUUUA/ds-2_3-AUUUA_x.pdb.gz
MCSYM-DB/2_3/AUUUC/
MCSYM-DB/2_3/AUUUC/2_3-AUUUC.mcs
MCSYM-DB/2_3/AUUUC/ds-2_3-AUUUC_x.pdb.gz
MCSYM-DB/2_3/AUUUG/
MCSYM-DB/2_3/AUUUG/2_3-AUUUG.mcs
MCSYM-DB/2_3/AUUUG/ds-2_3-AUUUG_x.pdb.gz
MCSYM-DB/2_3/AUUUU/
MCSYM-DB/2_3/AUUUU/2_3-AUUUU.mcs
MCSYM-DB/2_3/AUUUU/ds-2_3-AUUUU_x.pdb.gz
MCSYM-DB/2_3/CAAAA/
MCSYM-DB/2_3/CAAAA/2_3-CAAAA.mcs
MCSYM-DB/2_3/CAAAA/ds-2_3-CAAAA_x.pdb.gz
MCSYM-DB/2_3/CAAAC/
MCSYM-DB/2_3/CAAAC/2_3-CAAAC.mcs
MCSYM-DB/2_3/CAAAC/ds-2_3-CAAAC_x.pdb.gz
MCSYM-DB/2_3/CAAAG/
MCSYM-DB/2_3/CAAAG/1M5K_model_1.pdb.gz
MCSYM-DB/2_3/CAAAG/1ZFV_model_1.pdb.gz
MCSYM-DB/2_3/CAAAG/2D18_model_1.pdb.gz
MCSYM-DB/2_3/CAAAG/2D1A_model_1.pdb.gz
MCSYM-DB/2_3/CAAAG/2_3-CAAAG.mcs
MCSYM-DB/2_3/CAAAG/ds-2_3-CAAAG_x.pdb.gz
MCSYM-DB/2_3/CAAAU/
MCSYM-DB/2_3/CAAAU/2_3-CAAAU.mcs
MCSYM-DB/2_3/CAAAU/ds-2_3-CAAAU_x.pdb.gz
MCSYM-DB/2_3/CAACA/
MCSYM-DB/2_3/CAACA/2_3-CAACA.mcs
MCSYM-DB/2_3/CAACA/ds-2_3-CAACA_x.pdb.gz
MCSYM-DB/2_3/CAACC/
MCSYM-DB/2_3/CAACC/2_3-CAACC.mcs
MCSYM-DB/2_3/CAACC/ds-2_3-CAACC_x.pdb.gz
MCSYM-DB/2_3/CAACG/
MCSYM-DB/2_3/CAACG/2_3-CAACG.mcs
MCSYM-DB/2_3/CAACG/ds-2_3-CAACG_x.pdb.gz
MCSYM-DB/2_3/CAACU/
MCSYM-DB/2_3/CAACU/2_3-CAACU.mcs
MCSYM-DB/2_3/CAACU/ds-2_3-CAACU_x.pdb.gz
MCSYM-DB/2_3/CAAGA/
MCSYM-DB/2_3/CAAGA/2_3-CAAGA.mcs
MCSYM-DB/2_3/CAAGA/ds-2_3-CAAGA_x.pdb.gz
MCSYM-DB/2_3/CAAGC/
MCSYM-DB/2_3/CAAGC/2_3-CAAGC.mcs
MCSYM-DB/2_3/CAAGC/ds-2_3-CAAGC_x.pdb.gz
MCSYM-DB/2_3/CAAGG/
MCSYM-DB/2_3/CAAGG/2_3-CAAGG.mcs
MCSYM-DB/2_3/CAAGG/ds-2_3-CAAGG_x.pdb.gz
MCSYM-DB/2_3/CAAGU/
MCSYM-DB/2_3/CAAGU/2_3-CAAGU.mcs
MCSYM-DB/2_3/CAAGU/ds-2_3-CAAGU_x.pdb.gz
MCSYM-DB/2_3/CAAUA/
MCSYM-DB/2_3/CAAUA/2_3-CAAUA.mcs
MCSYM-DB/2_3/CAAUA/ds-2_3-CAAUA_x.pdb.gz
MCSYM-DB/2_3/CAAUC/
MCSYM-DB/2_3/CAAUC/2_3-CAAUC.mcs
MCSYM-DB/2_3/CAAUC/ds-2_3-CAAUC_x.pdb.gz
MCSYM-DB/2_3/CAAUG/
MCSYM-DB/2_3/CAAUG/2_3-CAAUG.mcs
MCSYM-DB/2_3/CAAUG/ds-2_3-CAAUG_x.pdb.gz
MCSYM-DB/2_3/CAAUU/
MCSYM-DB/2_3/CAAUU/2_3-CAAUU.mcs
MCSYM-DB/2_3/CAAUU/ds-2_3-CAAUU_x.pdb.gz
MCSYM-DB/2_3/CACAA/
MCSYM-DB/2_3/CACAA/2_3-CACAA.mcs
MCSYM-DB/2_3/CACAA/ds-2_3-CACAA_x.pdb.gz
MCSYM-DB/2_3/CACAC/
MCSYM-DB/2_3/CACAC/2_3-CACAC.mcs
MCSYM-DB/2_3/CACAC/ds-2_3-CACAC_x.pdb.gz
MCSYM-DB/2_3/CACAG/
MCSYM-DB/2_3/CACAG/2_3-CACAG.mcs
MCSYM-DB/2_3/CACAG/ds-2_3-CACAG_x.pdb.gz
MCSYM-DB/2_3/CACAU/
MCSYM-DB/2_3/CACAU/2_3-CACAU.mcs
MCSYM-DB/2_3/CACAU/ds-2_3-CACAU_x.pdb.gz
MCSYM-DB/2_3/CACCA/
MCSYM-DB/2_3/CACCA/2_3-CACCA.mcs
MCSYM-DB/2_3/CACCA/ds-2_3-CACCA_x.pdb.gz
MCSYM-DB/2_3/CACCC/
MCSYM-DB/2_3/CACCC/2_3-CACCC.mcs
MCSYM-DB/2_3/CACCC/ds-2_3-CACCC_x.pdb.gz
MCSYM-DB/2_3/CACCG/
MCSYM-DB/2_3/CACCG/2_3-CACCG.mcs
MCSYM-DB/2_3/CACCG/ds-2_3-CACCG_x.pdb.gz
MCSYM-DB/2_3/CACCU/
MCSYM-DB/2_3/CACCU/2_3-CACCU.mcs
MCSYM-DB/2_3/CACCU/ds-2_3-CACCU_x.pdb.gz
MCSYM-DB/2_3/CACGA/
MCSYM-DB/2_3/CACGA/ds-2_3-CACGA_x.pdb.gz
MCSYM-DB/2_3/CACGC/
MCSYM-DB/2_3/CACGC/ds-2_3-CACGC_x.pdb.gz
MCSYM-DB/2_3/CACGG/
MCSYM-DB/2_3/CACGG/2_3-CACGG.mcs
MCSYM-DB/2_3/CACGG/ds-2_3-CACGG_x.pdb.gz
MCSYM-DB/2_3/CACGU/
MCSYM-DB/2_3/CACGU/2_3-CACGU.mcs
MCSYM-DB/2_3/CACGU/ds-2_3-CACGU_x.pdb.gz
MCSYM-DB/2_3/CACUA/
MCSYM-DB/2_3/CACUA/2_3-CACUA.mcs
MCSYM-DB/2_3/CACUA/ds-2_3-CACUA_x.pdb.gz
MCSYM-DB/2_3/CACUC/
MCSYM-DB/2_3/CACUC/2_3-CACUC.mcs
MCSYM-DB/2_3/CACUC/ds-2_3-CACUC_x.pdb.gz
MCSYM-DB/2_3/CACUG/
MCSYM-DB/2_3/CACUG/2_3-CACUG.mcs
MCSYM-DB/2_3/CACUG/ds-2_3-CACUG_x.pdb.gz
MCSYM-DB/2_3/CACUU/
MCSYM-DB/2_3/CACUU/2_3-CACUU.mcs
MCSYM-DB/2_3/CACUU/ds-2_3-CACUU_x.pdb.gz
MCSYM-DB/2_3/CAGAA/
MCSYM-DB/2_3/CAGAA/2_3-CAGAA.mcs
MCSYM-DB/2_3/CAGAA/ds-2_3-CAGAA_x.pdb.gz
MCSYM-DB/2_3/CAGAC/
MCSYM-DB/2_3/CAGAC/2_3-CAGAC.mcs
MCSYM-DB/2_3/CAGAC/ds-2_3-CAGAC_x.pdb.gz
MCSYM-DB/2_3/CAGAG/
MCSYM-DB/2_3/CAGAG/2_3-CAGAG.mcs
MCSYM-DB/2_3/CAGAG/5MSF_model_1.pdb.gz
MCSYM-DB/2_3/CAGAG/ds-2_3-CAGAG_x.pdb.gz
MCSYM-DB/2_3/CAGAU/
MCSYM-DB/2_3/CAGAU/2_3-CAGAU.mcs
MCSYM-DB/2_3/CAGAU/ds-2_3-CAGAU_x.pdb.gz
MCSYM-DB/2_3/CAGCA/
MCSYM-DB/2_3/CAGCA/2_3-CAGCA.mcs
MCSYM-DB/2_3/CAGCA/ds-2_3-CAGCA_x.pdb.gz
MCSYM-DB/2_3/CAGCC/
MCSYM-DB/2_3/CAGCC/2_3-CAGCC.mcs
MCSYM-DB/2_3/CAGCC/ds-2_3-CAGCC_x.pdb.gz
MCSYM-DB/2_3/CAGCG/
MCSYM-DB/2_3/CAGCG/2_3-CAGCG.mcs
MCSYM-DB/2_3/CAGCG/ds-2_3-CAGCG_x.pdb.gz
MCSYM-DB/2_3/CAGCU/
MCSYM-DB/2_3/CAGCU/2_3-CAGCU.mcs
MCSYM-DB/2_3/CAGCU/ds-2_3-CAGCU_x.pdb.gz
MCSYM-DB/2_3/CAGGA/
MCSYM-DB/2_3/CAGGA/ds-2_3-CAGGA_x.pdb.gz
MCSYM-DB/2_3/CAGGC/
MCSYM-DB/2_3/CAGGC/ds-2_3-CAGGC_x.pdb.gz
MCSYM-DB/2_3/CAGGG/
MCSYM-DB/2_3/CAGGG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/CAGGG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CAGGG/2_3-CAGGG.mcs
MCSYM-DB/2_3/CAGGG/ds-2_3-CAGGG_x.pdb.gz
MCSYM-DB/2_3/CAGGU/
MCSYM-DB/2_3/CAGGU/2_3-CAGGU.mcs
MCSYM-DB/2_3/CAGGU/ds-2_3-CAGGU_x.pdb.gz
MCSYM-DB/2_3/CAGUA/
MCSYM-DB/2_3/CAGUA/2_3-CAGUA.mcs
MCSYM-DB/2_3/CAGUA/ds-2_3-CAGUA_x.pdb.gz
MCSYM-DB/2_3/CAGUC/
MCSYM-DB/2_3/CAGUC/2_3-CAGUC.mcs
MCSYM-DB/2_3/CAGUC/ds-2_3-CAGUC_x.pdb.gz
MCSYM-DB/2_3/CAGUG/
MCSYM-DB/2_3/CAGUG/2_3-CAGUG.mcs
MCSYM-DB/2_3/CAGUG/ds-2_3-CAGUG_x.pdb.gz
MCSYM-DB/2_3/CAGUU/
MCSYM-DB/2_3/CAGUU/2_3-CAGUU.mcs
MCSYM-DB/2_3/CAGUU/ds-2_3-CAGUU_x.pdb.gz
MCSYM-DB/2_3/CAU/
MCSYM-DB/2_3/CAUAA/
MCSYM-DB/2_3/CAUAA/2_3-CAUAA.mcs
MCSYM-DB/2_3/CAUAA/ds-2_3-CAUAA_x.pdb.gz
MCSYM-DB/2_3/CAUAC/
MCSYM-DB/2_3/CAUAC/2_3-CAUAC.mcs
MCSYM-DB/2_3/CAUAC/ds-2_3-CAUAC_x.pdb.gz
MCSYM-DB/2_3/CAUAG/
MCSYM-DB/2_3/CAUAG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/CAUAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CAUAG/2_3-CAUAG.mcs
MCSYM-DB/2_3/CAUAG/ds-2_3-CAUAG_x.pdb.gz
MCSYM-DB/2_3/CAUAU/
MCSYM-DB/2_3/CAUAU/2_3-CAUAU.mcs
MCSYM-DB/2_3/CAUAU/ds-2_3-CAUAU_x.pdb.gz
MCSYM-DB/2_3/CAUCA/
MCSYM-DB/2_3/CAUCA/2_3-CAUCA.mcs
MCSYM-DB/2_3/CAUCA/ds-2_3-CAUCA_x.pdb.gz
MCSYM-DB/2_3/CAUCC/
MCSYM-DB/2_3/CAUCC/2_3-CAUCC.mcs
MCSYM-DB/2_3/CAUCC/ds-2_3-CAUCC_x.pdb.gz
MCSYM-DB/2_3/CAUCG/
MCSYM-DB/2_3/CAUCG/1DQF_model_1.pdb.gz
MCSYM-DB/2_3/CAUCG/1Z31_model_1.pdb.gz
MCSYM-DB/2_3/CAUCG/2_3-CAUCG.mcs
MCSYM-DB/2_3/CAUCG/ds-2_3-CAUCG_x.pdb.gz
MCSYM-DB/2_3/CAUCU/
MCSYM-DB/2_3/CAUCU/2_3-CAUCU.mcs
MCSYM-DB/2_3/CAUCU/ds-2_3-CAUCU_x.pdb.gz
MCSYM-DB/2_3/CAUGA/
MCSYM-DB/2_3/CAUGA/2_3-CAUGA.mcs
MCSYM-DB/2_3/CAUGA/ds-2_3-CAUGA_x.pdb.gz
MCSYM-DB/2_3/CAUGC/
MCSYM-DB/2_3/CAUGC/2_3-CAUGC.mcs
MCSYM-DB/2_3/CAUGC/ds-2_3-CAUGC_x.pdb.gz
MCSYM-DB/2_3/CAUGG/
MCSYM-DB/2_3/CAUGG/2_3-CAUGG.mcs
MCSYM-DB/2_3/CAUGG/ds-2_3-CAUGG_x.pdb.gz
MCSYM-DB/2_3/CAUGU/
MCSYM-DB/2_3/CAUGU/2_3-CAUGU.mcs
MCSYM-DB/2_3/CAUGU/ds-2_3-CAUGU_x.pdb.gz
MCSYM-DB/2_3/CAUUA/
MCSYM-DB/2_3/CAUUA/2_3-CAUUA.mcs
MCSYM-DB/2_3/CAUUA/ds-2_3-CAUUA_x.pdb.gz
MCSYM-DB/2_3/CAUUC/
MCSYM-DB/2_3/CAUUC/2_3-CAUUC.mcs
MCSYM-DB/2_3/CAUUC/ds-2_3-CAUUC_x.pdb.gz
MCSYM-DB/2_3/CAUUG/
MCSYM-DB/2_3/CAUUG/1MFK_model_1.pdb.gz
MCSYM-DB/2_3/CAUUG/2_3-CAUUG.mcs
MCSYM-DB/2_3/CAUUG/ds-2_3-CAUUG_x.pdb.gz
MCSYM-DB/2_3/CAUUU/
MCSYM-DB/2_3/CAUUU/2_3-CAUUU.mcs
MCSYM-DB/2_3/CAUUU/ds-2_3-CAUUU_x.pdb.gz
MCSYM-DB/2_3/CCAAA/
MCSYM-DB/2_3/CCAAA/2_3-CCAAA.mcs
MCSYM-DB/2_3/CCAAA/ds-2_3-CCAAA_x.pdb.gz
MCSYM-DB/2_3/CCAAC/
MCSYM-DB/2_3/CCAAC/2_3-CCAAC.mcs
MCSYM-DB/2_3/CCAAC/ds-2_3-CCAAC_x.pdb.gz
MCSYM-DB/2_3/CCAAG/
MCSYM-DB/2_3/CCAAG/2_3-CCAAG.mcs
MCSYM-DB/2_3/CCAAG/ds-2_3-CCAAG_x.pdb.gz
MCSYM-DB/2_3/CCAAU/
MCSYM-DB/2_3/CCAAU/2_3-CCAAU.mcs
MCSYM-DB/2_3/CCAAU/ds-2_3-CCAAU_x.pdb.gz
MCSYM-DB/2_3/CCACA/
MCSYM-DB/2_3/CCACA/2_3-CCACA.mcs
MCSYM-DB/2_3/CCACA/ds-2_3-CCACA_x.pdb.gz
MCSYM-DB/2_3/CCACC/
MCSYM-DB/2_3/CCACC/2_3-CCACC.mcs
MCSYM-DB/2_3/CCACC/ds-2_3-CCACC_x.pdb.gz
MCSYM-DB/2_3/CCACG/
MCSYM-DB/2_3/CCACG/2_3-CCACG.mcs
MCSYM-DB/2_3/CCACG/ds-2_3-CCACG_x.pdb.gz
MCSYM-DB/2_3/CCACU/
MCSYM-DB/2_3/CCACU/2_3-CCACU.mcs
MCSYM-DB/2_3/CCACU/ds-2_3-CCACU_x.pdb.gz
MCSYM-DB/2_3/CCAGA/
MCSYM-DB/2_3/CCAGA/2_3-CCAGA.mcs
MCSYM-DB/2_3/CCAGA/ds-2_3-CCAGA_x.pdb.gz
MCSYM-DB/2_3/CCAGC/
MCSYM-DB/2_3/CCAGC/2_3-CCAGC.mcs
MCSYM-DB/2_3/CCAGC/ds-2_3-CCAGC_x.pdb.gz
MCSYM-DB/2_3/CCAGG/
MCSYM-DB/2_3/CCAGG/2_3-CCAGG.mcs
MCSYM-DB/2_3/CCAGG/ds-2_3-CCAGG_x.pdb.gz
MCSYM-DB/2_3/CCAGU/
MCSYM-DB/2_3/CCAGU/2_3-CCAGU.mcs
MCSYM-DB/2_3/CCAGU/ds-2_3-CCAGU_x.pdb.gz
MCSYM-DB/2_3/CCAUA/
MCSYM-DB/2_3/CCAUA/2_3-CCAUA.mcs
MCSYM-DB/2_3/CCAUA/ds-2_3-CCAUA_x.pdb.gz
MCSYM-DB/2_3/CCAUC/
MCSYM-DB/2_3/CCAUC/2_3-CCAUC.mcs
MCSYM-DB/2_3/CCAUC/ds-2_3-CCAUC_x.pdb.gz
MCSYM-DB/2_3/CCAUG/
MCSYM-DB/2_3/CCAUG/2_3-CCAUG.mcs
MCSYM-DB/2_3/CCAUG/ds-2_3-CCAUG_x.pdb.gz
MCSYM-DB/2_3/CCAUU/
MCSYM-DB/2_3/CCAUU/2_3-CCAUU.mcs
MCSYM-DB/2_3/CCAUU/ds-2_3-CCAUU_x.pdb.gz
MCSYM-DB/2_3/CCCAA/
MCSYM-DB/2_3/CCCAA/2_3-CCCAA.mcs
MCSYM-DB/2_3/CCCAA/ds-2_3-CCCAA_x.pdb.gz
MCSYM-DB/2_3/CCCAC/
MCSYM-DB/2_3/CCCAC/2_3-CCCAC.mcs
MCSYM-DB/2_3/CCCAC/ds-2_3-CCCAC_x.pdb.gz
MCSYM-DB/2_3/CCCAG/
MCSYM-DB/2_3/CCCAG/2_3-CCCAG.mcs
MCSYM-DB/2_3/CCCAG/ds-2_3-CCCAG_x.pdb.gz
MCSYM-DB/2_3/CCCAU/
MCSYM-DB/2_3/CCCAU/2_3-CCCAU.mcs
MCSYM-DB/2_3/CCCAU/ds-2_3-CCCAU_x.pdb.gz
MCSYM-DB/2_3/CCCCA/
MCSYM-DB/2_3/CCCCA/2_3-CCCCA.mcs
MCSYM-DB/2_3/CCCCA/ds-2_3-CCCCA_x.pdb.gz
MCSYM-DB/2_3/CCCCC/
MCSYM-DB/2_3/CCCCC/2_3-CCCCC.mcs
MCSYM-DB/2_3/CCCCC/ds-2_3-CCCCC_x.pdb.gz
MCSYM-DB/2_3/CCCCG/
MCSYM-DB/2_3/CCCCG/2_3-CCCCG.mcs
MCSYM-DB/2_3/CCCCG/ds-2_3-CCCCG_x.pdb.gz
MCSYM-DB/2_3/CCCCU/
MCSYM-DB/2_3/CCCCU/2_3-CCCCU.mcs
MCSYM-DB/2_3/CCCCU/ds-2_3-CCCCU_x.pdb.gz
MCSYM-DB/2_3/CCCGA/
MCSYM-DB/2_3/CCCGA/2_3-CCCGA.mcs
MCSYM-DB/2_3/CCCGA/ds-2_3-CCCGA_x.pdb.gz
MCSYM-DB/2_3/CCCGC/
MCSYM-DB/2_3/CCCGC/2_3-CCCGC.mcs
MCSYM-DB/2_3/CCCGC/ds-2_3-CCCGC_x.pdb.gz
MCSYM-DB/2_3/CCCGG/
MCSYM-DB/2_3/CCCGG/2_3-CCCGG.mcs
MCSYM-DB/2_3/CCCGG/ds-2_3-CCCGG_x.pdb.gz
MCSYM-DB/2_3/CCCGU/
MCSYM-DB/2_3/CCCGU/ds-2_3-CCCGU_x.pdb.gz
MCSYM-DB/2_3/CCCUA/
MCSYM-DB/2_3/CCCUA/2_3-CCCUA.mcs
MCSYM-DB/2_3/CCCUA/ds-2_3-CCCUA_x.pdb.gz
MCSYM-DB/2_3/CCCUC/
MCSYM-DB/2_3/CCCUC/2_3-CCCUC.mcs
MCSYM-DB/2_3/CCCUC/ds-2_3-CCCUC_x.pdb.gz
MCSYM-DB/2_3/CCCUG/
MCSYM-DB/2_3/CCCUG/2_3-CCCUG.mcs
MCSYM-DB/2_3/CCCUG/ds-2_3-CCCUG_x.pdb.gz
MCSYM-DB/2_3/CCCUU/
MCSYM-DB/2_3/CCCUU/2_3-CCCUU.mcs
MCSYM-DB/2_3/CCCUU/ds-2_3-CCCUU_x.pdb.gz
MCSYM-DB/2_3/CCGAA/
MCSYM-DB/2_3/CCGAA/2_3-CCGAA.mcs
MCSYM-DB/2_3/CCGAA/ds-2_3-CCGAA_x.pdb.gz
MCSYM-DB/2_3/CCGAC/
MCSYM-DB/2_3/CCGAC/2_3-CCGAC.mcs
MCSYM-DB/2_3/CCGAC/ds-2_3-CCGAC_x.pdb.gz
MCSYM-DB/2_3/CCGAG/
MCSYM-DB/2_3/CCGAG/1K8S_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/1NC0_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/1SLP_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/1ZDK_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2BNY_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2C4Y_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2C4Z_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2C50_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2C51_model_1.pdb.gz
MCSYM-DB/2_3/CCGAG/2_3-CCGAG.mcs
MCSYM-DB/2_3/CCGAG/ds-2_3-CCGAG.pdb.gz
MCSYM-DB/2_3/CCGAG/ds-2_3-CCGAG_x.pdb.gz
MCSYM-DB/2_3/CCGAU/
MCSYM-DB/2_3/CCGAU/2_3-CCGAU.mcs
MCSYM-DB/2_3/CCGAU/ds-2_3-CCGAU_x.pdb.gz
MCSYM-DB/2_3/CCGCA/
MCSYM-DB/2_3/CCGCA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/CCGCA/2_3-CCGCA.mcs
MCSYM-DB/2_3/CCGCA/ds-2_3-CCGCA_x.pdb.gz
MCSYM-DB/2_3/CCGCC/
MCSYM-DB/2_3/CCGCC/2_3-CCGCC.mcs
MCSYM-DB/2_3/CCGCC/ds-2_3-CCGCC_x.pdb.gz
MCSYM-DB/2_3/CCGCG/
MCSYM-DB/2_3/CCGCG/1KUO_model_1.pdb.gz
MCSYM-DB/2_3/CCGCG/1S03_model_1.pdb.gz
MCSYM-DB/2_3/CCGCG/2_3-CCGCG.mcs
MCSYM-DB/2_3/CCGCG/ds-2_3-CCGCG_x.pdb.gz
MCSYM-DB/2_3/CCGCU/
MCSYM-DB/2_3/CCGCU/2_3-CCGCU.mcs
MCSYM-DB/2_3/CCGCU/ds-2_3-CCGCU_x.pdb.gz
MCSYM-DB/2_3/CCGGA/
MCSYM-DB/2_3/CCGGA/2_3-CCGGA.mcs
MCSYM-DB/2_3/CCGGA/ds-2_3-CCGGA_x.pdb.gz
MCSYM-DB/2_3/CCGGC/
MCSYM-DB/2_3/CCGGC/2_3-CCGGC.mcs
MCSYM-DB/2_3/CCGGC/ds-2_3-CCGGC_x.pdb.gz
MCSYM-DB/2_3/CCGGG/
MCSYM-DB/2_3/CCGGG/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/CCGGG/2_3-CCGGG.mcs
MCSYM-DB/2_3/CCGGG/ds-2_3-CCGGG_x.pdb.gz
MCSYM-DB/2_3/CCGGU/
MCSYM-DB/2_3/CCGGU/2_3-CCGGU.mcs
MCSYM-DB/2_3/CCGGU/ds-2_3-CCGGU_x.pdb.gz
MCSYM-DB/2_3/CCGUA/
MCSYM-DB/2_3/CCGUA/2_3-CCGUA.mcs
MCSYM-DB/2_3/CCGUA/ds-2_3-CCGUA_x.pdb.gz
MCSYM-DB/2_3/CCGUC/
MCSYM-DB/2_3/CCGUC/2_3-CCGUC.mcs
MCSYM-DB/2_3/CCGUC/ds-2_3-CCGUC_x.pdb.gz
MCSYM-DB/2_3/CCGUG/
MCSYM-DB/2_3/CCGUG/1DDY_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1ET4_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1JOX_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1P5M_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1P5O_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1RKJ_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1S2F_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1U6P_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/2A9X_model_1.pdb.gz
MCSYM-DB/2_3/CCGUG/2_3-CCGUG.mcs
MCSYM-DB/2_3/CCGUG/ds-2_3-CCGUG_x.pdb.gz
MCSYM-DB/2_3/CCGUU/
MCSYM-DB/2_3/CCGUU/2_3-CCGUU.mcs
MCSYM-DB/2_3/CCGUU/ds-2_3-CCGUU_x.pdb.gz
MCSYM-DB/2_3/CCUAA/
MCSYM-DB/2_3/CCUAA/2_3-CCUAA.mcs
MCSYM-DB/2_3/CCUAA/ds-2_3-CCUAA_x.pdb.gz
MCSYM-DB/2_3/CCUAC/
MCSYM-DB/2_3/CCUAC/2_3-CCUAC.mcs
MCSYM-DB/2_3/CCUAC/ds-2_3-CCUAC_x.pdb.gz
MCSYM-DB/2_3/CCUAG/
MCSYM-DB/2_3/CCUAG/2_3-CCUAG.mcs
MCSYM-DB/2_3/CCUAG/ds-2_3-CCUAG_x.pdb.gz
MCSYM-DB/2_3/CCUAU/
MCSYM-DB/2_3/CCUAU/ds-2_3-CCUAU_x.pdb.gz
MCSYM-DB/2_3/CCUCA/
MCSYM-DB/2_3/CCUCA/2_3-CCUCA.mcs
MCSYM-DB/2_3/CCUCA/ds-2_3-CCUCA_x.pdb.gz
MCSYM-DB/2_3/CCUCC/
MCSYM-DB/2_3/CCUCC/2_3-CCUCC.mcs
MCSYM-DB/2_3/CCUCC/ds-2_3-CCUCC_x.pdb.gz
MCSYM-DB/2_3/CCUCG/
MCSYM-DB/2_3/CCUCG/2_3-CCUCG.mcs
MCSYM-DB/2_3/CCUCG/ds-2_3-CCUCG_x.pdb.gz
MCSYM-DB/2_3/CCUCU/
MCSYM-DB/2_3/CCUCU/2_3-CCUCU.mcs
MCSYM-DB/2_3/CCUCU/ds-2_3-CCUCU_x.pdb.gz
MCSYM-DB/2_3/CCUGA/
MCSYM-DB/2_3/CCUGA/2_3-CCUGA.mcs
MCSYM-DB/2_3/CCUGA/ds-2_3-CCUGA_x.pdb.gz
MCSYM-DB/2_3/CCUGC/
MCSYM-DB/2_3/CCUGC/2_3-CCUGC.mcs
MCSYM-DB/2_3/CCUGC/ds-2_3-CCUGC_x.pdb.gz
MCSYM-DB/2_3/CCUGG/
MCSYM-DB/2_3/CCUGG/2_3-CCUGG.mcs
MCSYM-DB/2_3/CCUGG/ds-2_3-CCUGG_x.pdb.gz
MCSYM-DB/2_3/CCUGU/
MCSYM-DB/2_3/CCUGU/2_3-CCUGU.mcs
MCSYM-DB/2_3/CCUGU/ds-2_3-CCUGU_x.pdb.gz
MCSYM-DB/2_3/CCUUA/
MCSYM-DB/2_3/CCUUA/2_3-CCUUA.mcs
MCSYM-DB/2_3/CCUUA/ds-2_3-CCUUA_x.pdb.gz
MCSYM-DB/2_3/CCUUC/
MCSYM-DB/2_3/CCUUC/2_3-CCUUC.mcs
MCSYM-DB/2_3/CCUUC/ds-2_3-CCUUC_x.pdb.gz
MCSYM-DB/2_3/CCUUG/
MCSYM-DB/2_3/CCUUG/2_3-CCUUG.mcs
MCSYM-DB/2_3/CCUUG/ds-2_3-CCUUG_x.pdb.gz
MCSYM-DB/2_3/CCUUU/
MCSYM-DB/2_3/CCUUU/2_3-CCUUU.mcs
MCSYM-DB/2_3/CCUUU/ds-2_3-CCUUU_x.pdb.gz
MCSYM-DB/2_3/CGAAA/
MCSYM-DB/2_3/CGAAA/2_3-CGAAA.mcs
MCSYM-DB/2_3/CGAAA/ds-2_3-CGAAA_x.pdb.gz
MCSYM-DB/2_3/CGAAC/
MCSYM-DB/2_3/CGAAC/ds-2_3-CGAAC_x.pdb.gz
MCSYM-DB/2_3/CGAAG/
MCSYM-DB/2_3/CGAAG/2_3-CGAAG.mcs
MCSYM-DB/2_3/CGAAG/ds-2_3-CGAAG_x.pdb.gz
MCSYM-DB/2_3/CGAAU/
MCSYM-DB/2_3/CGAAU/ds-2_3-CGAAU_x.pdb.gz
MCSYM-DB/2_3/CGACA/
MCSYM-DB/2_3/CGACA/2_3-CGACA.mcs
MCSYM-DB/2_3/CGACA/ds-2_3-CGACA_x.pdb.gz
MCSYM-DB/2_3/CGACC/
MCSYM-DB/2_3/CGACC/ds-2_3-CGACC_x.pdb.gz
MCSYM-DB/2_3/CGACG/
MCSYM-DB/2_3/CGACG/2_3-CGACG.mcs
MCSYM-DB/2_3/CGACG/ds-2_3-CGACG_x.pdb.gz
MCSYM-DB/2_3/CGACU/
MCSYM-DB/2_3/CGACU/ds-2_3-CGACU_x.pdb.gz
MCSYM-DB/2_3/CGAGA/
MCSYM-DB/2_3/CGAGA/2_3-CGAGA.mcs
MCSYM-DB/2_3/CGAGA/ds-2_3-CGAGA_x.pdb.gz
MCSYM-DB/2_3/CGAGC/
MCSYM-DB/2_3/CGAGC/ds-2_3-CGAGC_x.pdb.gz
MCSYM-DB/2_3/CGAGG/
MCSYM-DB/2_3/CGAGG/2_3-CGAGG.mcs
MCSYM-DB/2_3/CGAGG/ds-2_3-CGAGG_x.pdb.gz
MCSYM-DB/2_3/CGAGU/
MCSYM-DB/2_3/CGAGU/2_3-CGAGU.mcs
MCSYM-DB/2_3/CGAGU/ds-2_3-CGAGU_x.pdb.gz
MCSYM-DB/2_3/CGAUA/
MCSYM-DB/2_3/CGAUA/2_3-CGAUA.mcs
MCSYM-DB/2_3/CGAUA/ds-2_3-CGAUA_x.pdb.gz
MCSYM-DB/2_3/CGAUC/
MCSYM-DB/2_3/CGAUC/2_3-CGAUC.mcs
MCSYM-DB/2_3/CGAUC/ds-2_3-CGAUC_x.pdb.gz
MCSYM-DB/2_3/CGAUG/
MCSYM-DB/2_3/CGAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CGAUG/2_3-CGAUG.mcs
MCSYM-DB/2_3/CGAUG/ds-2_3-CGAUG_x.pdb.gz
MCSYM-DB/2_3/CGAUU/
MCSYM-DB/2_3/CGAUU/2_3-CGAUU.mcs
MCSYM-DB/2_3/CGAUU/ds-2_3-CGAUU_x.pdb.gz
MCSYM-DB/2_3/CGCAA/
MCSYM-DB/2_3/CGCAA/2_3-CGCAA.mcs
MCSYM-DB/2_3/CGCAA/ds-2_3-CGCAA_x.pdb.gz
MCSYM-DB/2_3/CGCAC/
MCSYM-DB/2_3/CGCAC/2_3-CGCAC.mcs
MCSYM-DB/2_3/CGCAC/ds-2_3-CGCAC.pdb.gz
MCSYM-DB/2_3/CGCAC/ds-2_3-CGCAC_x.pdb.gz
MCSYM-DB/2_3/CGCAG/
MCSYM-DB/2_3/CGCAG/1K2G_model_1.pdb.gz
MCSYM-DB/2_3/CGCAG/1QC8_model_1.pdb.gz
MCSYM-DB/2_3/CGCAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CGCAG/2_3-CGCAG.mcs
MCSYM-DB/2_3/CGCAG/ds-2_3-CGCAG_x.pdb.gz
MCSYM-DB/2_3/CGCAU/
MCSYM-DB/2_3/CGCAU/2_3-CGCAU.mcs
MCSYM-DB/2_3/CGCAU/ds-2_3-CGCAU_x.pdb.gz
MCSYM-DB/2_3/CGCCA/
MCSYM-DB/2_3/CGCCA/2_3-CGCCA.mcs
MCSYM-DB/2_3/CGCCA/ds-2_3-CGCCA_x.pdb.gz
MCSYM-DB/2_3/CGCCC/
MCSYM-DB/2_3/CGCCC/2_3-CGCCC.mcs
MCSYM-DB/2_3/CGCCC/ds-2_3-CGCCC_x.pdb.gz
MCSYM-DB/2_3/CGCCG/
MCSYM-DB/2_3/CGCCG/2_3-CGCCG.mcs
MCSYM-DB/2_3/CGCCG/ds-2_3-CGCCG_x.pdb.gz
MCSYM-DB/2_3/CGCCU/
MCSYM-DB/2_3/CGCCU/2_3-CGCCU.mcs
MCSYM-DB/2_3/CGCCU/ds-2_3-CGCCU_x.pdb.gz
MCSYM-DB/2_3/CGCGA/
MCSYM-DB/2_3/CGCGA/2_3-CGCGA.mcs
MCSYM-DB/2_3/CGCGA/ds-2_3-CGCGA_x.pdb.gz
MCSYM-DB/2_3/CGCGC/
MCSYM-DB/2_3/CGCGC/2_3-CGCGC.mcs
MCSYM-DB/2_3/CGCGC/ds-2_3-CGCGC_x.pdb.gz
MCSYM-DB/2_3/CGCGG/
MCSYM-DB/2_3/CGCGG/1Z43_model_1.pdb.gz
MCSYM-DB/2_3/CGCGG/2_3-CGCGG.mcs
MCSYM-DB/2_3/CGCGG/ds-2_3-CGCGG_x.pdb.gz
MCSYM-DB/2_3/CGCGU/
MCSYM-DB/2_3/CGCGU/2_3-CGCGU.mcs
MCSYM-DB/2_3/CGCGU/ds-2_3-CGCGU_x.pdb.gz
MCSYM-DB/2_3/CGCUA/
MCSYM-DB/2_3/CGCUA/2_3-CGCUA.mcs
MCSYM-DB/2_3/CGCUA/ds-2_3-CGCUA_x.pdb.gz
MCSYM-DB/2_3/CGCUC/
MCSYM-DB/2_3/CGCUC/2_3-CGCUC.mcs
MCSYM-DB/2_3/CGCUC/ds-2_3-CGCUC_x.pdb.gz
MCSYM-DB/2_3/CGCUG/
MCSYM-DB/2_3/CGCUG/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/CGCUG/2_3-CGCUG.mcs
MCSYM-DB/2_3/CGCUG/ds-2_3-CGCUG_x.pdb.gz
MCSYM-DB/2_3/CGCUU/
MCSYM-DB/2_3/CGCUU/2_3-CGCUU.mcs
MCSYM-DB/2_3/CGCUU/ds-2_3-CGCUU_x.pdb.gz
MCSYM-DB/2_3/CGGAA/
MCSYM-DB/2_3/CGGAA/2_3-CGGAA.mcs
MCSYM-DB/2_3/CGGAA/ds-2_3-CGGAA_x.pdb.gz
MCSYM-DB/2_3/CGGAC/
MCSYM-DB/2_3/CGGAC/2_3-CGGAC.mcs
MCSYM-DB/2_3/CGGAC/ds-2_3-CGGAC_x.pdb.gz
MCSYM-DB/2_3/CGGAG/
MCSYM-DB/2_3/CGGAG/2_3-CGGAG.mcs
MCSYM-DB/2_3/CGGAG/ds-2_3-CGGAG_x.pdb.gz
MCSYM-DB/2_3/CGGAU/
MCSYM-DB/2_3/CGGAU/ds-2_3-CGGAU_x.pdb.gz
MCSYM-DB/2_3/CGGCA/
MCSYM-DB/2_3/CGGCA/2_3-CGGCA.mcs
MCSYM-DB/2_3/CGGCA/ds-2_3-CGGCA_x.pdb.gz
MCSYM-DB/2_3/CGGCC/
MCSYM-DB/2_3/CGGCC/2_3-CGGCC.mcs
MCSYM-DB/2_3/CGGCC/ds-2_3-CGGCC_x.pdb.gz
MCSYM-DB/2_3/CGGCG/
MCSYM-DB/2_3/CGGCG/2_3-CGGCG.mcs
MCSYM-DB/2_3/CGGCG/ds-2_3-CGGCG_x.pdb.gz
MCSYM-DB/2_3/CGGCU/
MCSYM-DB/2_3/CGGCU/2_3-CGGCU.mcs
MCSYM-DB/2_3/CGGCU/ds-2_3-CGGCU_x.pdb.gz
MCSYM-DB/2_3/CGGGA/
MCSYM-DB/2_3/CGGGA/ds-2_3-CGGGA_x.pdb.gz
MCSYM-DB/2_3/CGGGC/
MCSYM-DB/2_3/CGGGC/2_3-CGGGC.mcs
MCSYM-DB/2_3/CGGGC/ds-2_3-CGGGC_x.pdb.gz
MCSYM-DB/2_3/CGGGG/
MCSYM-DB/2_3/CGGGG/2_3-CGGGG.mcs
MCSYM-DB/2_3/CGGGG/ds-2_3-CGGGG_x.pdb.gz
MCSYM-DB/2_3/CGGGU/
MCSYM-DB/2_3/CGGGU/ds-2_3-CGGGU_x.pdb.gz
MCSYM-DB/2_3/CGGUA/
MCSYM-DB/2_3/CGGUA/ds-2_3-CGGUA_x.pdb.gz
MCSYM-DB/2_3/CGGUC/
MCSYM-DB/2_3/CGGUC/ds-2_3-CGGUC_x.pdb.gz
MCSYM-DB/2_3/CGGUG/
MCSYM-DB/2_3/CGGUG/2_3-CGGUG.mcs
MCSYM-DB/2_3/CGGUG/ds-2_3-CGGUG_x.pdb.gz
MCSYM-DB/2_3/CGGUU/
MCSYM-DB/2_3/CGGUU/2_3-CGGUU.mcs
MCSYM-DB/2_3/CGGUU/ds-2_3-CGGUU_x.pdb.gz
MCSYM-DB/2_3/CGUAA/
MCSYM-DB/2_3/CGUAA/2_3-CGUAA.mcs
MCSYM-DB/2_3/CGUAA/ds-2_3-CGUAA_x.pdb.gz
MCSYM-DB/2_3/CGUAC/
MCSYM-DB/2_3/CGUAC/2_3-CGUAC.mcs
MCSYM-DB/2_3/CGUAC/ds-2_3-CGUAC_x.pdb.gz
MCSYM-DB/2_3/CGUAG/
MCSYM-DB/2_3/CGUAG/2_3-CGUAG.mcs
MCSYM-DB/2_3/CGUAG/ds-2_3-CGUAG_x.pdb.gz
MCSYM-DB/2_3/CGUAU/
MCSYM-DB/2_3/CGUAU/2_3-CGUAU.mcs
MCSYM-DB/2_3/CGUAU/ds-2_3-CGUAU_x.pdb.gz
MCSYM-DB/2_3/CGUCA/
MCSYM-DB/2_3/CGUCA/2_3-CGUCA.mcs
MCSYM-DB/2_3/CGUCA/ds-2_3-CGUCA_x.pdb.gz
MCSYM-DB/2_3/CGUCC/
MCSYM-DB/2_3/CGUCC/2_3-CGUCC.mcs
MCSYM-DB/2_3/CGUCC/ds-2_3-CGUCC_x.pdb.gz
MCSYM-DB/2_3/CGUCG/
MCSYM-DB/2_3/CGUCG/2_3-CGUCG.mcs
MCSYM-DB/2_3/CGUCG/ds-2_3-CGUCG_x.pdb.gz
MCSYM-DB/2_3/CGUCU/
MCSYM-DB/2_3/CGUCU/2_3-CGUCU.mcs
MCSYM-DB/2_3/CGUCU/ds-2_3-CGUCU_x.pdb.gz
MCSYM-DB/2_3/CGUGA/
MCSYM-DB/2_3/CGUGA/2_3-CGUGA.mcs
MCSYM-DB/2_3/CGUGA/ds-2_3-CGUGA_x.pdb.gz
MCSYM-DB/2_3/CGUGC/
MCSYM-DB/2_3/CGUGC/ds-2_3-CGUGC_x.pdb.gz
MCSYM-DB/2_3/CGUGG/
MCSYM-DB/2_3/CGUGG/2_3-CGUGG.mcs
MCSYM-DB/2_3/CGUGG/ds-2_3-CGUGG_x.pdb.gz
MCSYM-DB/2_3/CGUGU/
MCSYM-DB/2_3/CGUGU/2_3-CGUGU.mcs
MCSYM-DB/2_3/CGUGU/ds-2_3-CGUGU_x.pdb.gz
MCSYM-DB/2_3/CGUUA/
MCSYM-DB/2_3/CGUUA/ds-2_3-CGUUA_x.pdb.gz
MCSYM-DB/2_3/CGUUC/
MCSYM-DB/2_3/CGUUC/ds-2_3-CGUUC_x.pdb.gz
MCSYM-DB/2_3/CGUUG/
MCSYM-DB/2_3/CGUUG/2_3-CGUUG.mcs
MCSYM-DB/2_3/CGUUG/ds-2_3-CGUUG_x.pdb.gz
MCSYM-DB/2_3/CGUUU/
MCSYM-DB/2_3/CGUUU/2_3-CGUUU.mcs
MCSYM-DB/2_3/CGUUU/ds-2_3-CGUUU_x.pdb.gz
MCSYM-DB/2_3/CUAAA/
MCSYM-DB/2_3/CUAAA/2_3-CUAAA.mcs
MCSYM-DB/2_3/CUAAA/ds-2_3-CUAAA_x.pdb.gz
MCSYM-DB/2_3/CUAAC/
MCSYM-DB/2_3/CUAAC/2_3-CUAAC.mcs
MCSYM-DB/2_3/CUAAC/ds-2_3-CUAAC_x.pdb.gz
MCSYM-DB/2_3/CUAAG/
MCSYM-DB/2_3/CUAAG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/CUAAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CUAAG/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/CUAAG/2_3-CUAAG.mcs
MCSYM-DB/2_3/CUAAG/ds-2_3-CUAAG_x.pdb.gz
MCSYM-DB/2_3/CUAAU/
MCSYM-DB/2_3/CUAAU/2_3-CUAAU.mcs
MCSYM-DB/2_3/CUAAU/ds-2_3-CUAAU_x.pdb.gz
MCSYM-DB/2_3/CUACA/
MCSYM-DB/2_3/CUACA/2_3-CUACA.mcs
MCSYM-DB/2_3/CUACA/ds-2_3-CUACA_x.pdb.gz
MCSYM-DB/2_3/CUACC/
MCSYM-DB/2_3/CUACC/2_3-CUACC.mcs
MCSYM-DB/2_3/CUACC/ds-2_3-CUACC_x.pdb.gz
MCSYM-DB/2_3/CUACG/
MCSYM-DB/2_3/CUACG/1BVJ_model_1.pdb.gz
MCSYM-DB/2_3/CUACG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CUACG/2_3-CUACG.mcs
MCSYM-DB/2_3/CUACG/ds-2_3-CUACG_x.pdb.gz
MCSYM-DB/2_3/CUACU/
MCSYM-DB/2_3/CUACU/2_3-CUACU.mcs
MCSYM-DB/2_3/CUACU/ds-2_3-CUACU_x.pdb.gz
MCSYM-DB/2_3/CUAGA/
MCSYM-DB/2_3/CUAGA/2_3-CUAGA.mcs
MCSYM-DB/2_3/CUAGA/ds-2_3-CUAGA_x.pdb.gz
MCSYM-DB/2_3/CUAGC/
MCSYM-DB/2_3/CUAGC/2_3-CUAGC.mcs
MCSYM-DB/2_3/CUAGC/ds-2_3-CUAGC_x.pdb.gz
MCSYM-DB/2_3/CUAGG/
MCSYM-DB/2_3/CUAGG/1M5L_model_1.pdb.gz
MCSYM-DB/2_3/CUAGG/2ES5_model_1.pdb.gz
MCSYM-DB/2_3/CUAGG/2_3-CUAGG.mcs
MCSYM-DB/2_3/CUAGG/ds-2_3-CUAGG_x.pdb.gz
MCSYM-DB/2_3/CUAGU/
MCSYM-DB/2_3/CUAGU/2_3-CUAGU.mcs
MCSYM-DB/2_3/CUAGU/ds-2_3-CUAGU_x.pdb.gz
MCSYM-DB/2_3/CUAUA/
MCSYM-DB/2_3/CUAUA/2_3-CUAUA.mcs
MCSYM-DB/2_3/CUAUA/ds-2_3-CUAUA_x.pdb.gz
MCSYM-DB/2_3/CUAUC/
MCSYM-DB/2_3/CUAUC/2_3-CUAUC.mcs
MCSYM-DB/2_3/CUAUC/ds-2_3-CUAUC_x.pdb.gz
MCSYM-DB/2_3/CUAUG/
MCSYM-DB/2_3/CUAUG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/1KXK_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/1L8V_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/1S03_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/2ADT_model_1.pdb.gz
MCSYM-DB/2_3/CUAUG/2_3-CUAUG.mcs
MCSYM-DB/2_3/CUAUG/ds-2_3-CUAUG_x.pdb.gz
MCSYM-DB/2_3/CUAUU/
MCSYM-DB/2_3/CUAUU/2_3-CUAUU.mcs
MCSYM-DB/2_3/CUAUU/ds-2_3-CUAUU_x.pdb.gz
MCSYM-DB/2_3/CUCAA/
MCSYM-DB/2_3/CUCAA/2_3-CUCAA.mcs
MCSYM-DB/2_3/CUCAA/ds-2_3-CUCAA_x.pdb.gz
MCSYM-DB/2_3/CUCAC/
MCSYM-DB/2_3/CUCAC/2_3-CUCAC.mcs
MCSYM-DB/2_3/CUCAC/ds-2_3-CUCAC_x.pdb.gz
MCSYM-DB/2_3/CUCAG/
MCSYM-DB/2_3/CUCAG/2_3-CUCAG.mcs
MCSYM-DB/2_3/CUCAG/ds-2_3-CUCAG_x.pdb.gz
MCSYM-DB/2_3/CUCAU/
MCSYM-DB/2_3/CUCAU/2_3-CUCAU.mcs
MCSYM-DB/2_3/CUCAU/ds-2_3-CUCAU_x.pdb.gz
MCSYM-DB/2_3/CUCCA/
MCSYM-DB/2_3/CUCCA/2_3-CUCCA.mcs
MCSYM-DB/2_3/CUCCA/ds-2_3-CUCCA_x.pdb.gz
MCSYM-DB/2_3/CUCCC/
MCSYM-DB/2_3/CUCCC/2_3-CUCCC.mcs
MCSYM-DB/2_3/CUCCC/ds-2_3-CUCCC_x.pdb.gz
MCSYM-DB/2_3/CUCCG/
MCSYM-DB/2_3/CUCCG/2_3-CUCCG.mcs
MCSYM-DB/2_3/CUCCG/ds-2_3-CUCCG_x.pdb.gz
MCSYM-DB/2_3/CUCCU/
MCSYM-DB/2_3/CUCCU/2_3-CUCCU.mcs
MCSYM-DB/2_3/CUCCU/ds-2_3-CUCCU_x.pdb.gz
MCSYM-DB/2_3/CUCGA/
MCSYM-DB/2_3/CUCGA/2_3-CUCGA.mcs
MCSYM-DB/2_3/CUCGA/ds-2_3-CUCGA_x.pdb.gz
MCSYM-DB/2_3/CUCGC/
MCSYM-DB/2_3/CUCGC/2_3-CUCGC.mcs
MCSYM-DB/2_3/CUCGC/ds-2_3-CUCGC_x.pdb.gz
MCSYM-DB/2_3/CUCGG/
MCSYM-DB/2_3/CUCGG/2_3-CUCGG.mcs
MCSYM-DB/2_3/CUCGG/ds-2_3-CUCGG_x.pdb.gz
MCSYM-DB/2_3/CUCGU/
MCSYM-DB/2_3/CUCGU/2_3-CUCGU.mcs
MCSYM-DB/2_3/CUCGU/ds-2_3-CUCGU_x.pdb.gz
MCSYM-DB/2_3/CUCUA/
MCSYM-DB/2_3/CUCUA/2_3-CUCUA.mcs
MCSYM-DB/2_3/CUCUA/ds-2_3-CUCUA_x.pdb.gz
MCSYM-DB/2_3/CUCUC/
MCSYM-DB/2_3/CUCUC/2_3-CUCUC.mcs
MCSYM-DB/2_3/CUCUC/ds-2_3-CUCUC_x.pdb.gz
MCSYM-DB/2_3/CUCUG/
MCSYM-DB/2_3/CUCUG/2_3-CUCUG.mcs
MCSYM-DB/2_3/CUCUG/ds-2_3-CUCUG_x.pdb.gz
MCSYM-DB/2_3/CUCUU/
MCSYM-DB/2_3/CUCUU/2_3-CUCUU.mcs
MCSYM-DB/2_3/CUCUU/ds-2_3-CUCUU_x.pdb.gz
MCSYM-DB/2_3/CUGAA/
MCSYM-DB/2_3/CUGAA/2_3-CUGAA.mcs
MCSYM-DB/2_3/CUGAA/ds-2_3-CUGAA_x.pdb.gz
MCSYM-DB/2_3/CUGAC/
MCSYM-DB/2_3/CUGAC/2_3-CUGAC.mcs
MCSYM-DB/2_3/CUGAC/ds-2_3-CUGAC_x.pdb.gz
MCSYM-DB/2_3/CUGAG/
MCSYM-DB/2_3/CUGAG/2_3-CUGAG.mcs
MCSYM-DB/2_3/CUGAG/ds-2_3-CUGAG_x.pdb.gz
MCSYM-DB/2_3/CUGAU/
MCSYM-DB/2_3/CUGAU/2_3-CUGAU.mcs
MCSYM-DB/2_3/CUGAU/ds-2_3-CUGAU_x.pdb.gz
MCSYM-DB/2_3/CUGCA/
MCSYM-DB/2_3/CUGCA/2_3-CUGCA.mcs
MCSYM-DB/2_3/CUGCA/ds-2_3-CUGCA_x.pdb.gz
MCSYM-DB/2_3/CUGCC/
MCSYM-DB/2_3/CUGCC/2_3-CUGCC.mcs
MCSYM-DB/2_3/CUGCC/ds-2_3-CUGCC_x.pdb.gz
MCSYM-DB/2_3/CUGCG/
MCSYM-DB/2_3/CUGCG/2_3-CUGCG.mcs
MCSYM-DB/2_3/CUGCG/ds-2_3-CUGCG_x.pdb.gz
MCSYM-DB/2_3/CUGCU/
MCSYM-DB/2_3/CUGCU/2_3-CUGCU.mcs
MCSYM-DB/2_3/CUGCU/ds-2_3-CUGCU_x.pdb.gz
MCSYM-DB/2_3/CUGGA/
MCSYM-DB/2_3/CUGGA/2_3-CUGGA.mcs
MCSYM-DB/2_3/CUGGA/ds-2_3-CUGGA_x.pdb.gz
MCSYM-DB/2_3/CUGGC/
MCSYM-DB/2_3/CUGGC/2_3-CUGGC.mcs
MCSYM-DB/2_3/CUGGC/ds-2_3-CUGGC_x.pdb.gz
MCSYM-DB/2_3/CUGGG/
MCSYM-DB/2_3/CUGGG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/CUGGG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/CUGGG/2_3-CUGGG.mcs
MCSYM-DB/2_3/CUGGG/ds-2_3-CUGGG_x.pdb.gz
MCSYM-DB/2_3/CUGGU/
MCSYM-DB/2_3/CUGGU/2_3-CUGGU.mcs
MCSYM-DB/2_3/CUGGU/ds-2_3-CUGGU_x.pdb.gz
MCSYM-DB/2_3/CUGUA/
MCSYM-DB/2_3/CUGUA/2_3-CUGUA.mcs
MCSYM-DB/2_3/CUGUA/ds-2_3-CUGUA_x.pdb.gz
MCSYM-DB/2_3/CUGUC/
MCSYM-DB/2_3/CUGUC/2_3-CUGUC.mcs
MCSYM-DB/2_3/CUGUC/ds-2_3-CUGUC_x.pdb.gz
MCSYM-DB/2_3/CUGUG/
MCSYM-DB/2_3/CUGUG/1Q75_model_1.pdb.gz
MCSYM-DB/2_3/CUGUG/1Y39_model_1.pdb.gz
MCSYM-DB/2_3/CUGUG/2_3-CUGUG.mcs
MCSYM-DB/2_3/CUGUG/ds-2_3-CUGUG_x.pdb.gz
MCSYM-DB/2_3/CUGUU/
MCSYM-DB/2_3/CUGUU/2_3-CUGUU.mcs
MCSYM-DB/2_3/CUGUU/ds-2_3-CUGUU_x.pdb.gz
MCSYM-DB/2_3/CUUAA/
MCSYM-DB/2_3/CUUAA/2_3-CUUAA.mcs
MCSYM-DB/2_3/CUUAA/ds-2_3-CUUAA_x.pdb.gz
MCSYM-DB/2_3/CUUAC/
MCSYM-DB/2_3/CUUAC/2_3-CUUAC.mcs
MCSYM-DB/2_3/CUUAC/ds-2_3-CUUAC_x.pdb.gz
MCSYM-DB/2_3/CUUAG/
MCSYM-DB/2_3/CUUAG/2_3-CUUAG.mcs
MCSYM-DB/2_3/CUUAG/ds-2_3-CUUAG_x.pdb.gz
MCSYM-DB/2_3/CUUAU/
MCSYM-DB/2_3/CUUAU/2_3-CUUAU.mcs
MCSYM-DB/2_3/CUUAU/ds-2_3-CUUAU_x.pdb.gz
MCSYM-DB/2_3/CUUCA/
MCSYM-DB/2_3/CUUCA/2_3-CUUCA.mcs
MCSYM-DB/2_3/CUUCA/ds-2_3-CUUCA_x.pdb.gz
MCSYM-DB/2_3/CUUCC/
MCSYM-DB/2_3/CUUCC/2_3-CUUCC.mcs
MCSYM-DB/2_3/CUUCC/ds-2_3-CUUCC_x.pdb.gz
MCSYM-DB/2_3/CUUCG/
MCSYM-DB/2_3/CUUCG/2_3-CUUCG.mcs
MCSYM-DB/2_3/CUUCG/ds-2_3-CUUCG_x.pdb.gz
MCSYM-DB/2_3/CUUCU/
MCSYM-DB/2_3/CUUCU/2_3-CUUCU.mcs
MCSYM-DB/2_3/CUUCU/ds-2_3-CUUCU_x.pdb.gz
MCSYM-DB/2_3/CUUGA/
MCSYM-DB/2_3/CUUGA/2_3-CUUGA.mcs
MCSYM-DB/2_3/CUUGA/ds-2_3-CUUGA_x.pdb.gz
MCSYM-DB/2_3/CUUGC/
MCSYM-DB/2_3/CUUGC/2_3-CUUGC.mcs
MCSYM-DB/2_3/CUUGC/ds-2_3-CUUGC_x.pdb.gz
MCSYM-DB/2_3/CUUGG/
MCSYM-DB/2_3/CUUGG/2_3-CUUGG.mcs
MCSYM-DB/2_3/CUUGG/ds-2_3-CUUGG_x.pdb.gz
MCSYM-DB/2_3/CUUGU/
MCSYM-DB/2_3/CUUGU/2_3-CUUGU.mcs
MCSYM-DB/2_3/CUUGU/ds-2_3-CUUGU_x.pdb.gz
MCSYM-DB/2_3/CUUUA/
MCSYM-DB/2_3/CUUUA/2_3-CUUUA.mcs
MCSYM-DB/2_3/CUUUA/ds-2_3-CUUUA_x.pdb.gz
MCSYM-DB/2_3/CUUUC/
MCSYM-DB/2_3/CUUUC/2_3-CUUUC.mcs
MCSYM-DB/2_3/CUUUC/ds-2_3-CUUUC_x.pdb.gz
MCSYM-DB/2_3/CUUUG/
MCSYM-DB/2_3/CUUUG/2_3-CUUUG.mcs
MCSYM-DB/2_3/CUUUG/ds-2_3-CUUUG_x.pdb.gz
MCSYM-DB/2_3/CUUUU/
MCSYM-DB/2_3/CUUUU/2_3-CUUUU.mcs
MCSYM-DB/2_3/CUUUU/ds-2_3-CUUUU_x.pdb.gz
MCSYM-DB/2_3/GAAAA/
MCSYM-DB/2_3/GAAAA/2_3-GAAAA.mcs
MCSYM-DB/2_3/GAAAA/ds-2_3-GAAAA_x.pdb.gz
MCSYM-DB/2_3/GAAAC/
MCSYM-DB/2_3/GAAAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAAAC/2_3-GAAAC.mcs
MCSYM-DB/2_3/GAAAC/ds-2_3-GAAAC_x.pdb.gz
MCSYM-DB/2_3/GAAAG/
MCSYM-DB/2_3/GAAAG/2_3-GAAAG.mcs
MCSYM-DB/2_3/GAAAG/ds-2_3-GAAAG_x.pdb.gz
MCSYM-DB/2_3/GAAAU/
MCSYM-DB/2_3/GAAAU/2_3-GAAAU.mcs
MCSYM-DB/2_3/GAAAU/ds-2_3-GAAAU_x.pdb.gz
MCSYM-DB/2_3/GAACA/
MCSYM-DB/2_3/GAACA/2_3-GAACA.mcs
MCSYM-DB/2_3/GAACA/ds-2_3-GAACA_x.pdb.gz
MCSYM-DB/2_3/GAACC/
MCSYM-DB/2_3/GAACC/2_3-GAACC.mcs
MCSYM-DB/2_3/GAACC/ds-2_3-GAACC_x.pdb.gz
MCSYM-DB/2_3/GAACG/
MCSYM-DB/2_3/GAACG/2_3-GAACG.mcs
MCSYM-DB/2_3/GAACG/ds-2_3-GAACG_x.pdb.gz
MCSYM-DB/2_3/GAACU/
MCSYM-DB/2_3/GAACU/2_3-GAACU.mcs
MCSYM-DB/2_3/GAACU/ds-2_3-GAACU_x.pdb.gz
MCSYM-DB/2_3/GAAGA/
MCSYM-DB/2_3/GAAGA/2_3-GAAGA.mcs
MCSYM-DB/2_3/GAAGA/ds-2_3-GAAGA_x.pdb.gz
MCSYM-DB/2_3/GAAGC/
MCSYM-DB/2_3/GAAGC/2_3-GAAGC.mcs
MCSYM-DB/2_3/GAAGC/ds-2_3-GAAGC_x.pdb.gz
MCSYM-DB/2_3/GAAGG/
MCSYM-DB/2_3/GAAGG/2_3-GAAGG.mcs
MCSYM-DB/2_3/GAAGG/ds-2_3-GAAGG_x.pdb.gz
MCSYM-DB/2_3/GAAGU/
MCSYM-DB/2_3/GAAGU/2_3-GAAGU.mcs
MCSYM-DB/2_3/GAAGU/ds-2_3-GAAGU_x.pdb.gz
MCSYM-DB/2_3/GAAUA/
MCSYM-DB/2_3/GAAUA/2_3-GAAUA.mcs
MCSYM-DB/2_3/GAAUA/ds-2_3-GAAUA_x.pdb.gz
MCSYM-DB/2_3/GAAUC/
MCSYM-DB/2_3/GAAUC/2_3-GAAUC.mcs
MCSYM-DB/2_3/GAAUC/ds-2_3-GAAUC_x.pdb.gz
MCSYM-DB/2_3/GAAUG/
MCSYM-DB/2_3/GAAUG/2_3-GAAUG.mcs
MCSYM-DB/2_3/GAAUG/ds-2_3-GAAUG_x.pdb.gz
MCSYM-DB/2_3/GAAUU/
MCSYM-DB/2_3/GAAUU/2_3-GAAUU.mcs
MCSYM-DB/2_3/GAAUU/ds-2_3-GAAUU_x.pdb.gz
MCSYM-DB/2_3/GACAA/
MCSYM-DB/2_3/GACAA/2_3-GACAA.mcs
MCSYM-DB/2_3/GACAA/ds-2_3-GACAA_x.pdb.gz
MCSYM-DB/2_3/GACAC/
MCSYM-DB/2_3/GACAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GACAC/2_3-GACAC.mcs
MCSYM-DB/2_3/GACAC/ds-2_3-GACAC.pdb.gz
MCSYM-DB/2_3/GACAC/ds-2_3-GACAC_x.pdb.gz
MCSYM-DB/2_3/GACAG/
MCSYM-DB/2_3/GACAG/2_3-GACAG.mcs
MCSYM-DB/2_3/GACAG/ds-2_3-GACAG_x.pdb.gz
MCSYM-DB/2_3/GACAU/
MCSYM-DB/2_3/GACAU/ds-2_3-GACAU_x.pdb.gz
MCSYM-DB/2_3/GACCA/
MCSYM-DB/2_3/GACCA/2_3-GACCA.mcs
MCSYM-DB/2_3/GACCA/ds-2_3-GACCA_x.pdb.gz
MCSYM-DB/2_3/GACCC/
MCSYM-DB/2_3/GACCC/2_3-GACCC.mcs
MCSYM-DB/2_3/GACCC/ds-2_3-GACCC_x.pdb.gz
MCSYM-DB/2_3/GACCG/
MCSYM-DB/2_3/GACCG/ds-2_3-GACCG_x.pdb.gz
MCSYM-DB/2_3/GACCU/
MCSYM-DB/2_3/GACCU/2_3-GACCU.mcs
MCSYM-DB/2_3/GACCU/ds-2_3-GACCU_x.pdb.gz
MCSYM-DB/2_3/GACGA/
MCSYM-DB/2_3/GACGA/ds-2_3-GACGA_x.pdb.gz
MCSYM-DB/2_3/GACGC/
MCSYM-DB/2_3/GACGC/2_3-GACGC.mcs
MCSYM-DB/2_3/GACGC/ds-2_3-GACGC_x.pdb.gz
MCSYM-DB/2_3/GACGG/
MCSYM-DB/2_3/GACGG/2_3-GACGG.mcs
MCSYM-DB/2_3/GACGG/ds-2_3-GACGG_x.pdb.gz
MCSYM-DB/2_3/GACGU/
MCSYM-DB/2_3/GACGU/2_3-GACGU.mcs
MCSYM-DB/2_3/GACGU/ds-2_3-GACGU_x.pdb.gz
MCSYM-DB/2_3/GACUA/
MCSYM-DB/2_3/GACUA/2_3-GACUA.mcs
MCSYM-DB/2_3/GACUA/ds-2_3-GACUA_x.pdb.gz
MCSYM-DB/2_3/GACUC/
MCSYM-DB/2_3/GACUC/2_3-GACUC.mcs
MCSYM-DB/2_3/GACUC/ds-2_3-GACUC_x.pdb.gz
MCSYM-DB/2_3/GACUG/
MCSYM-DB/2_3/GACUG/2_3-GACUG.mcs
MCSYM-DB/2_3/GACUG/ds-2_3-GACUG_x.pdb.gz
MCSYM-DB/2_3/GACUU/
MCSYM-DB/2_3/GACUU/2_3-GACUU.mcs
MCSYM-DB/2_3/GACUU/ds-2_3-GACUU_x.pdb.gz
MCSYM-DB/2_3/GAGAA/
MCSYM-DB/2_3/GAGAA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAGAA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GAGAA/2_3-GAGAA.mcs
MCSYM-DB/2_3/GAGAA/ds-2_3-GAGAA_x.pdb.gz
MCSYM-DB/2_3/GAGAC/
MCSYM-DB/2_3/GAGAC/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/GAGAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAGAC/2_3-GAGAC.mcs
MCSYM-DB/2_3/GAGAC/ds-2_3-GAGAC_x.pdb.gz
MCSYM-DB/2_3/GAGAG/
MCSYM-DB/2_3/GAGAG/2_3-GAGAG.mcs
MCSYM-DB/2_3/GAGAG/ds-2_3-GAGAG_x.pdb.gz
MCSYM-DB/2_3/GAGAU/
MCSYM-DB/2_3/GAGAU/2_3-GAGAU.mcs
MCSYM-DB/2_3/GAGAU/ds-2_3-GAGAU_x.pdb.gz
MCSYM-DB/2_3/GAGCA/
MCSYM-DB/2_3/GAGCA/2_3-GAGCA.mcs
MCSYM-DB/2_3/GAGCA/ds-2_3-GAGCA_x.pdb.gz
MCSYM-DB/2_3/GAGCC/
MCSYM-DB/2_3/GAGCC/2_3-GAGCC.mcs
MCSYM-DB/2_3/GAGCC/ds-2_3-GAGCC_x.pdb.gz
MCSYM-DB/2_3/GAGCG/
MCSYM-DB/2_3/GAGCG/2_3-GAGCG.mcs
MCSYM-DB/2_3/GAGCG/ds-2_3-GAGCG_x.pdb.gz
MCSYM-DB/2_3/GAGCU/
MCSYM-DB/2_3/GAGCU/2_3-GAGCU.mcs
MCSYM-DB/2_3/GAGCU/ds-2_3-GAGCU_x.pdb.gz
MCSYM-DB/2_3/GAGGA/
MCSYM-DB/2_3/GAGGA/2_3-GAGGA.mcs
MCSYM-DB/2_3/GAGGA/ds-2_3-GAGGA_x.pdb.gz
MCSYM-DB/2_3/GAGGC/
MCSYM-DB/2_3/GAGGC/2_3-GAGGC.mcs
MCSYM-DB/2_3/GAGGC/ds-2_3-GAGGC_x.pdb.gz
MCSYM-DB/2_3/GAGGG/
MCSYM-DB/2_3/GAGGG/2_3-GAGGG.mcs
MCSYM-DB/2_3/GAGGG/ds-2_3-GAGGG_x.pdb.gz
MCSYM-DB/2_3/GAGGU/
MCSYM-DB/2_3/GAGGU/2_3-GAGGU.mcs
MCSYM-DB/2_3/GAGGU/ds-2_3-GAGGU_x.pdb.gz
MCSYM-DB/2_3/GAGUA/
MCSYM-DB/2_3/GAGUA/2_3-GAGUA.mcs
MCSYM-DB/2_3/GAGUA/ds-2_3-GAGUA_x.pdb.gz
MCSYM-DB/2_3/GAGUC/
MCSYM-DB/2_3/GAGUC/2_3-GAGUC.mcs
MCSYM-DB/2_3/GAGUC/ds-2_3-GAGUC_x.pdb.gz
MCSYM-DB/2_3/GAGUG/
MCSYM-DB/2_3/GAGUG/2_3-GAGUG.mcs
MCSYM-DB/2_3/GAGUG/ds-2_3-GAGUG_x.pdb.gz
MCSYM-DB/2_3/GAGUU/
MCSYM-DB/2_3/GAGUU/2_3-GAGUU.mcs
MCSYM-DB/2_3/GAGUU/ds-2_3-GAGUU_x.pdb.gz
MCSYM-DB/2_3/GAUAA/
MCSYM-DB/2_3/GAUAA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAUAA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GAUAA/2_3-GAUAA.mcs
MCSYM-DB/2_3/GAUAA/ds-2_3-GAUAA_x.pdb.gz
MCSYM-DB/2_3/GAUAC/
MCSYM-DB/2_3/GAUAC/1F6U_model_1.pdb.gz
MCSYM-DB/2_3/GAUAC/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/GAUAC/1JZV_model_1.pdb.gz
MCSYM-DB/2_3/GAUAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAUAC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GAUAC/2_3-GAUAC.mcs
MCSYM-DB/2_3/GAUAC/ds-2_3-GAUAC_x.pdb.gz
MCSYM-DB/2_3/GAUAG/
MCSYM-DB/2_3/GAUAG/2_3-GAUAG.mcs
MCSYM-DB/2_3/GAUAG/ds-2_3-GAUAG_x.pdb.gz
MCSYM-DB/2_3/GAUAU/
MCSYM-DB/2_3/GAUAU/2_3-GAUAU.mcs
MCSYM-DB/2_3/GAUAU/ds-2_3-GAUAU_x.pdb.gz
MCSYM-DB/2_3/GAUCA/
MCSYM-DB/2_3/GAUCA/2_3-GAUCA.mcs
MCSYM-DB/2_3/GAUCA/ds-2_3-GAUCA_x.pdb.gz
MCSYM-DB/2_3/GAUCC/
MCSYM-DB/2_3/GAUCC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAUCC/2_3-GAUCC.mcs
MCSYM-DB/2_3/GAUCC/ds-2_3-GAUCC_x.pdb.gz
MCSYM-DB/2_3/GAUCG/
MCSYM-DB/2_3/GAUCG/2_3-GAUCG.mcs
MCSYM-DB/2_3/GAUCG/ds-2_3-GAUCG_x.pdb.gz
MCSYM-DB/2_3/GAUCU/
MCSYM-DB/2_3/GAUCU/2_3-GAUCU.mcs
MCSYM-DB/2_3/GAUCU/ds-2_3-GAUCU_x.pdb.gz
MCSYM-DB/2_3/GAUGA/
MCSYM-DB/2_3/GAUGA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAUGA/2_3-GAUGA.mcs
MCSYM-DB/2_3/GAUGA/ds-2_3-GAUGA_x.pdb.gz
MCSYM-DB/2_3/GAUGC/
MCSYM-DB/2_3/GAUGC/2_3-GAUGC.mcs
MCSYM-DB/2_3/GAUGC/ds-2_3-GAUGC_x.pdb.gz
MCSYM-DB/2_3/GAUGG/
MCSYM-DB/2_3/GAUGG/2_3-GAUGG.mcs
MCSYM-DB/2_3/GAUGG/ds-2_3-GAUGG_x.pdb.gz
MCSYM-DB/2_3/GAUGU/
MCSYM-DB/2_3/GAUGU/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GAUGU/2_3-GAUGU.mcs
MCSYM-DB/2_3/GAUGU/ds-2_3-GAUGU_x.pdb.gz
MCSYM-DB/2_3/GAUUA/
MCSYM-DB/2_3/GAUUA/2_3-GAUUA.mcs
MCSYM-DB/2_3/GAUUA/ds-2_3-GAUUA_x.pdb.gz
MCSYM-DB/2_3/GAUUC/
MCSYM-DB/2_3/GAUUC/1U6P_model_1.pdb.gz
MCSYM-DB/2_3/GAUUC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GAUUC/2_3-GAUUC.mcs
MCSYM-DB/2_3/GAUUC/ds-2_3-GAUUC_x.pdb.gz
MCSYM-DB/2_3/GAUUG/
MCSYM-DB/2_3/GAUUG/2_3-GAUUG.mcs
MCSYM-DB/2_3/GAUUG/ds-2_3-GAUUG_x.pdb.gz
MCSYM-DB/2_3/GAUUU/
MCSYM-DB/2_3/GAUUU/2_3-GAUUU.mcs
MCSYM-DB/2_3/GAUUU/ds-2_3-GAUUU_x.pdb.gz
MCSYM-DB/2_3/GCAAA/
MCSYM-DB/2_3/GCAAA/2_3-GCAAA.mcs
MCSYM-DB/2_3/GCAAA/ds-2_3-GCAAA_x.pdb.gz
MCSYM-DB/2_3/GCAAC/
MCSYM-DB/2_3/GCAAC/2_3-GCAAC.mcs
MCSYM-DB/2_3/GCAAC/ds-2_3-GCAAC_x.pdb.gz
MCSYM-DB/2_3/GCAAG/
MCSYM-DB/2_3/GCAAG/2_3-GCAAG.mcs
MCSYM-DB/2_3/GCAAG/ds-2_3-GCAAG_x.pdb.gz
MCSYM-DB/2_3/GCAAU/
MCSYM-DB/2_3/GCAAU/2_3-GCAAU.mcs
MCSYM-DB/2_3/GCAAU/ds-2_3-GCAAU_x.pdb.gz
MCSYM-DB/2_3/GCACA/
MCSYM-DB/2_3/GCACA/ds-2_3-GCACA_x.pdb.gz
MCSYM-DB/2_3/GCACC/
MCSYM-DB/2_3/GCACC/2_3-GCACC.mcs
MCSYM-DB/2_3/GCACC/ds-2_3-GCACC_x.pdb.gz
MCSYM-DB/2_3/GCACG/
MCSYM-DB/2_3/GCACG/2_3-GCACG.mcs
MCSYM-DB/2_3/GCACG/ds-2_3-GCACG_x.pdb.gz
MCSYM-DB/2_3/GCACU/
MCSYM-DB/2_3/GCACU/2_3-GCACU.mcs
MCSYM-DB/2_3/GCACU/ds-2_3-GCACU_x.pdb.gz
MCSYM-DB/2_3/GCAGA/
MCSYM-DB/2_3/GCAGA/2_3-GCAGA.mcs
MCSYM-DB/2_3/GCAGA/ds-2_3-GCAGA_x.pdb.gz
MCSYM-DB/2_3/GCAGC/
MCSYM-DB/2_3/GCAGC/2_3-GCAGC.mcs
MCSYM-DB/2_3/GCAGC/ds-2_3-GCAGC_x.pdb.gz
MCSYM-DB/2_3/GCAGG/
MCSYM-DB/2_3/GCAGG/2_3-GCAGG.mcs
MCSYM-DB/2_3/GCAGG/ds-2_3-GCAGG_x.pdb.gz
MCSYM-DB/2_3/GCAGU/
MCSYM-DB/2_3/GCAGU/2_3-GCAGU.mcs
MCSYM-DB/2_3/GCAGU/ds-2_3-GCAGU_x.pdb.gz
MCSYM-DB/2_3/GCAUA/
MCSYM-DB/2_3/GCAUA/2_3-GCAUA.mcs
MCSYM-DB/2_3/GCAUA/ds-2_3-GCAUA_x.pdb.gz
MCSYM-DB/2_3/GCAUC/
MCSYM-DB/2_3/GCAUC/2_3-GCAUC.mcs
MCSYM-DB/2_3/GCAUC/ds-2_3-GCAUC_x.pdb.gz
MCSYM-DB/2_3/GCAUG/
MCSYM-DB/2_3/GCAUG/2_3-GCAUG.mcs
MCSYM-DB/2_3/GCAUG/ds-2_3-GCAUG_x.pdb.gz
MCSYM-DB/2_3/GCAUU/
MCSYM-DB/2_3/GCAUU/2_3-GCAUU.mcs
MCSYM-DB/2_3/GCAUU/ds-2_3-GCAUU_x.pdb.gz
MCSYM-DB/2_3/GCCAA/
MCSYM-DB/2_3/GCCAA/2_3-GCCAA.mcs
MCSYM-DB/2_3/GCCAA/ds-2_3-GCCAA_x.pdb.gz
MCSYM-DB/2_3/GCCAC/
MCSYM-DB/2_3/GCCAC/2_3-GCCAC.mcs
MCSYM-DB/2_3/GCCAC/ds-2_3-GCCAC_x.pdb.gz
MCSYM-DB/2_3/GCCAG/
MCSYM-DB/2_3/GCCAG/2_3-GCCAG.mcs
MCSYM-DB/2_3/GCCAG/ds-2_3-GCCAG_x.pdb.gz
MCSYM-DB/2_3/GCCAU/
MCSYM-DB/2_3/GCCAU/2_3-GCCAU.mcs
MCSYM-DB/2_3/GCCAU/ds-2_3-GCCAU_x.pdb.gz
MCSYM-DB/2_3/GCCCA/
MCSYM-DB/2_3/GCCCA/2_3-GCCCA.mcs
MCSYM-DB/2_3/GCCCA/ds-2_3-GCCCA_x.pdb.gz
MCSYM-DB/2_3/GCCCC/
MCSYM-DB/2_3/GCCCC/2_3-GCCCC.mcs
MCSYM-DB/2_3/GCCCC/ds-2_3-GCCCC_x.pdb.gz
MCSYM-DB/2_3/GCCCG/
MCSYM-DB/2_3/GCCCG/2_3-GCCCG.mcs
MCSYM-DB/2_3/GCCCG/ds-2_3-GCCCG_x.pdb.gz
MCSYM-DB/2_3/GCCCU/
MCSYM-DB/2_3/GCCCU/2_3-GCCCU.mcs
MCSYM-DB/2_3/GCCCU/ds-2_3-GCCCU_x.pdb.gz
MCSYM-DB/2_3/GCCGA/
MCSYM-DB/2_3/GCCGA/2_3-GCCGA.mcs
MCSYM-DB/2_3/GCCGA/ds-2_3-GCCGA_x.pdb.gz
MCSYM-DB/2_3/GCCGC/
MCSYM-DB/2_3/GCCGC/2_3-GCCGC.mcs
MCSYM-DB/2_3/GCCGC/ds-2_3-GCCGC_x.pdb.gz
MCSYM-DB/2_3/GCCGG/
MCSYM-DB/2_3/GCCGG/ds-2_3-GCCGG_x.pdb.gz
MCSYM-DB/2_3/GCCGU/
MCSYM-DB/2_3/GCCGU/2_3-GCCGU.mcs
MCSYM-DB/2_3/GCCGU/ds-2_3-GCCGU_x.pdb.gz
MCSYM-DB/2_3/GCCUA/
MCSYM-DB/2_3/GCCUA/2_3-GCCUA.mcs
MCSYM-DB/2_3/GCCUA/ds-2_3-GCCUA_x.pdb.gz
MCSYM-DB/2_3/GCCUC/
MCSYM-DB/2_3/GCCUC/1A60_model_1.pdb.gz
MCSYM-DB/2_3/GCCUC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GCCUC/2_3-GCCUC.mcs
MCSYM-DB/2_3/GCCUC/ds-2_3-GCCUC_x.pdb.gz
MCSYM-DB/2_3/GCCUG/
MCSYM-DB/2_3/GCCUG/2_3-GCCUG.mcs
MCSYM-DB/2_3/GCCUG/ds-2_3-GCCUG_x.pdb.gz
MCSYM-DB/2_3/GCCUU/
MCSYM-DB/2_3/GCCUU/2_3-GCCUU.mcs
MCSYM-DB/2_3/GCCUU/ds-2_3-GCCUU_x.pdb.gz
MCSYM-DB/2_3/GCGAA/
MCSYM-DB/2_3/GCGAA/2_3-GCGAA.mcs
MCSYM-DB/2_3/GCGAA/ds-2_3-GCGAA_x.pdb.gz
MCSYM-DB/2_3/GCGAC/
MCSYM-DB/2_3/GCGAC/1CSL_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1DUQ_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1EBR_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1G70_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1I9F_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1U9S_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/1XSG_model_1.pdb.gz
MCSYM-DB/2_3/GCGAC/2_3-GCGAC.mcs
MCSYM-DB/2_3/GCGAC/ds-2_3-GCGAC_x.pdb.gz
MCSYM-DB/2_3/GCGAG/
MCSYM-DB/2_3/GCGAG/2_3-GCGAG.mcs
MCSYM-DB/2_3/GCGAG/ds-2_3-GCGAG_x.pdb.gz
MCSYM-DB/2_3/GCGAU/
MCSYM-DB/2_3/GCGAU/2_3-GCGAU.mcs
MCSYM-DB/2_3/GCGAU/ds-2_3-GCGAU_x.pdb.gz
MCSYM-DB/2_3/GCGCA/
MCSYM-DB/2_3/GCGCA/2_3-GCGCA.mcs
MCSYM-DB/2_3/GCGCA/ds-2_3-GCGCA_x.pdb.gz
MCSYM-DB/2_3/GCGCC/
MCSYM-DB/2_3/GCGCC/2_3-GCGCC.mcs
MCSYM-DB/2_3/GCGCC/ds-2_3-GCGCC_x.pdb.gz
MCSYM-DB/2_3/GCGCG/
MCSYM-DB/2_3/GCGCG/2_3-GCGCG.mcs
MCSYM-DB/2_3/GCGCG/ds-2_3-GCGCG_x.pdb.gz
MCSYM-DB/2_3/GCGCU/
MCSYM-DB/2_3/GCGCU/2_3-GCGCU.mcs
MCSYM-DB/2_3/GCGCU/ds-2_3-GCGCU_x.pdb.gz
MCSYM-DB/2_3/GCGGA/
MCSYM-DB/2_3/GCGGA/2_3-GCGGA.mcs
MCSYM-DB/2_3/GCGGA/ds-2_3-GCGGA_x.pdb.gz
MCSYM-DB/2_3/GCGGC/
MCSYM-DB/2_3/GCGGC/1KIS_model_1.pdb.gz
MCSYM-DB/2_3/GCGGC/1U9S_model_1.pdb.gz
MCSYM-DB/2_3/GCGGC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GCGGC/2_3-GCGGC.mcs
MCSYM-DB/2_3/GCGGC/ds-2_3-GCGGC_x.pdb.gz
MCSYM-DB/2_3/GCGGG/
MCSYM-DB/2_3/GCGGG/2_3-GCGGG.mcs
MCSYM-DB/2_3/GCGGG/ds-2_3-GCGGG_x.pdb.gz
MCSYM-DB/2_3/GCGGU/
MCSYM-DB/2_3/GCGGU/2_3-GCGGU.mcs
MCSYM-DB/2_3/GCGGU/ds-2_3-GCGGU_x.pdb.gz
MCSYM-DB/2_3/GCGUA/
MCSYM-DB/2_3/GCGUA/2_3-GCGUA.mcs
MCSYM-DB/2_3/GCGUA/ds-2_3-GCGUA_x.pdb.gz
MCSYM-DB/2_3/GCGUC/
MCSYM-DB/2_3/GCGUC/1F6X_model_1.pdb.gz
MCSYM-DB/2_3/GCGUC/1L2X_model_1.pdb.gz
MCSYM-DB/2_3/GCGUC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GCGUC/2A43_model_1.pdb.gz
MCSYM-DB/2_3/GCGUC/2_3-GCGUC.mcs
MCSYM-DB/2_3/GCGUC/ds-2_3-GCGUC.pdb.gz
MCSYM-DB/2_3/GCGUC/ds-2_3-GCGUC_x.pdb.gz
MCSYM-DB/2_3/GCGUG/
MCSYM-DB/2_3/GCGUG/2_3-GCGUG.mcs
MCSYM-DB/2_3/GCGUG/ds-2_3-GCGUG_x.pdb.gz
MCSYM-DB/2_3/GCGUU/
MCSYM-DB/2_3/GCGUU/2_3-GCGUU.mcs
MCSYM-DB/2_3/GCGUU/ds-2_3-GCGUU_x.pdb.gz
MCSYM-DB/2_3/GCUAA/
MCSYM-DB/2_3/GCUAA/2_3-GCUAA.mcs
MCSYM-DB/2_3/GCUAA/ds-2_3-GCUAA_x.pdb.gz
MCSYM-DB/2_3/GCUAC/
MCSYM-DB/2_3/GCUAC/2_3-GCUAC.mcs
MCSYM-DB/2_3/GCUAC/ds-2_3-GCUAC_x.pdb.gz
MCSYM-DB/2_3/GCUAG/
MCSYM-DB/2_3/GCUAG/ds-2_3-GCUAG_x.pdb.gz
MCSYM-DB/2_3/GCUAU/
MCSYM-DB/2_3/GCUAU/2_3-GCUAU.mcs
MCSYM-DB/2_3/GCUAU/ds-2_3-GCUAU_x.pdb.gz
MCSYM-DB/2_3/GCUCA/
MCSYM-DB/2_3/GCUCA/2_3-GCUCA.mcs
MCSYM-DB/2_3/GCUCA/ds-2_3-GCUCA_x.pdb.gz
MCSYM-DB/2_3/GCUCC/
MCSYM-DB/2_3/GCUCC/2_3-GCUCC.mcs
MCSYM-DB/2_3/GCUCC/ds-2_3-GCUCC_x.pdb.gz
MCSYM-DB/2_3/GCUCG/
MCSYM-DB/2_3/GCUCG/2_3-GCUCG.mcs
MCSYM-DB/2_3/GCUCG/ds-2_3-GCUCG_x.pdb.gz
MCSYM-DB/2_3/GCUCU/
MCSYM-DB/2_3/GCUCU/2_3-GCUCU.mcs
MCSYM-DB/2_3/GCUCU/ds-2_3-GCUCU_x.pdb.gz
MCSYM-DB/2_3/GCUGA/
MCSYM-DB/2_3/GCUGA/2_3-GCUGA.mcs
MCSYM-DB/2_3/GCUGA/ds-2_3-GCUGA_x.pdb.gz
MCSYM-DB/2_3/GCUGC/
MCSYM-DB/2_3/GCUGC/2_3-GCUGC.mcs
MCSYM-DB/2_3/GCUGC/ds-2_3-GCUGC_x.pdb.gz
MCSYM-DB/2_3/GCUGG/
MCSYM-DB/2_3/GCUGG/2_3-GCUGG.mcs
MCSYM-DB/2_3/GCUGG/ds-2_3-GCUGG_x.pdb.gz
MCSYM-DB/2_3/GCUGU/
MCSYM-DB/2_3/GCUGU/2_3-GCUGU.mcs
MCSYM-DB/2_3/GCUGU/ds-2_3-GCUGU_x.pdb.gz
MCSYM-DB/2_3/GCUUA/
MCSYM-DB/2_3/GCUUA/ds-2_3-GCUUA_x.pdb.gz
MCSYM-DB/2_3/GCUUC/
MCSYM-DB/2_3/GCUUC/2_3-GCUUC.mcs
MCSYM-DB/2_3/GCUUC/ds-2_3-GCUUC_x.pdb.gz
MCSYM-DB/2_3/GCUUG/
MCSYM-DB/2_3/GCUUG/2_3-GCUUG.mcs
MCSYM-DB/2_3/GCUUG/ds-2_3-GCUUG_x.pdb.gz
MCSYM-DB/2_3/GCUUU/
MCSYM-DB/2_3/GCUUU/2_3-GCUUU.mcs
MCSYM-DB/2_3/GCUUU/ds-2_3-GCUUU_x.pdb.gz
MCSYM-DB/2_3/GGAAA/
MCSYM-DB/2_3/GGAAA/2_3-GGAAA.mcs
MCSYM-DB/2_3/GGAAA/ds-2_3-GGAAA_x.pdb.gz
MCSYM-DB/2_3/GGAAC/
MCSYM-DB/2_3/GGAAC/2_3-GGAAC.mcs
MCSYM-DB/2_3/GGAAC/ds-2_3-GGAAC_x.pdb.gz
MCSYM-DB/2_3/GGAAG/
MCSYM-DB/2_3/GGAAG/2_3-GGAAG.mcs
MCSYM-DB/2_3/GGAAG/ds-2_3-GGAAG_x.pdb.gz
MCSYM-DB/2_3/GGAAU/
MCSYM-DB/2_3/GGAAU/2_3-GGAAU.mcs
MCSYM-DB/2_3/GGAAU/ds-2_3-GGAAU_x.pdb.gz
MCSYM-DB/2_3/GGACA/
MCSYM-DB/2_3/GGACA/2_3-GGACA.mcs
MCSYM-DB/2_3/GGACA/ds-2_3-GGACA_x.pdb.gz
MCSYM-DB/2_3/GGACC/
MCSYM-DB/2_3/GGACC/2_3-GGACC.mcs
MCSYM-DB/2_3/GGACC/ds-2_3-GGACC_x.pdb.gz
MCSYM-DB/2_3/GGACG/
MCSYM-DB/2_3/GGACG/2_3-GGACG.mcs
MCSYM-DB/2_3/GGACG/ds-2_3-GGACG_x.pdb.gz
MCSYM-DB/2_3/GGACU/
MCSYM-DB/2_3/GGACU/2_3-GGACU.mcs
MCSYM-DB/2_3/GGACU/ds-2_3-GGACU_x.pdb.gz
MCSYM-DB/2_3/GGAGA/
MCSYM-DB/2_3/GGAGA/2_3-GGAGA.mcs
MCSYM-DB/2_3/GGAGA/ds-2_3-GGAGA_x.pdb.gz
MCSYM-DB/2_3/GGAGC/
MCSYM-DB/2_3/GGAGC/1U9S_model_1.pdb.gz
MCSYM-DB/2_3/GGAGC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GGAGC/2_3-GGAGC.mcs
MCSYM-DB/2_3/GGAGC/ds-2_3-GGAGC_x.pdb.gz
MCSYM-DB/2_3/GGAGG/
MCSYM-DB/2_3/GGAGG/2_3-GGAGG.mcs
MCSYM-DB/2_3/GGAGG/ds-2_3-GGAGG_x.pdb.gz
MCSYM-DB/2_3/GGAGU/
MCSYM-DB/2_3/GGAGU/1KOD_model_1.pdb.gz
MCSYM-DB/2_3/GGAGU/2_3-GGAGU.mcs
MCSYM-DB/2_3/GGAGU/ds-2_3-GGAGU_x.pdb.gz
MCSYM-DB/2_3/GGAUA/
MCSYM-DB/2_3/GGAUA/2_3-GGAUA.mcs
MCSYM-DB/2_3/GGAUA/ds-2_3-GGAUA_x.pdb.gz
MCSYM-DB/2_3/GGAUC/
MCSYM-DB/2_3/GGAUC/2_3-GGAUC.mcs
MCSYM-DB/2_3/GGAUC/ds-2_3-GGAUC_x.pdb.gz
MCSYM-DB/2_3/GGAUG/
MCSYM-DB/2_3/GGAUG/2_3-GGAUG.mcs
MCSYM-DB/2_3/GGAUG/ds-2_3-GGAUG_x.pdb.gz
MCSYM-DB/2_3/GGAUU/
MCSYM-DB/2_3/GGAUU/2_3-GGAUU.mcs
MCSYM-DB/2_3/GGAUU/ds-2_3-GGAUU_x.pdb.gz
MCSYM-DB/2_3/GGCAA/
MCSYM-DB/2_3/GGCAA/2_3-GGCAA.mcs
MCSYM-DB/2_3/GGCAA/ds-2_3-GGCAA_x.pdb.gz
MCSYM-DB/2_3/GGCAC/
MCSYM-DB/2_3/GGCAC/1D0U_model_1.pdb.gz
MCSYM-DB/2_3/GGCAC/1TOB_model_1.pdb.gz
MCSYM-DB/2_3/GGCAC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GGCAC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GGCAC/2_3-GGCAC.mcs
MCSYM-DB/2_3/GGCAC/6MSF_model_1.pdb.gz
MCSYM-DB/2_3/GGCAC/ds-2_3-GGCAC_x.pdb.gz
MCSYM-DB/2_3/GGCAG/
MCSYM-DB/2_3/GGCAG/2_3-GGCAG.mcs
MCSYM-DB/2_3/GGCAG/ds-2_3-GGCAG_x.pdb.gz
MCSYM-DB/2_3/GGCAU/
MCSYM-DB/2_3/GGCAU/2_3-GGCAU.mcs
MCSYM-DB/2_3/GGCAU/ds-2_3-GGCAU_x.pdb.gz
MCSYM-DB/2_3/GGCCA/
MCSYM-DB/2_3/GGCCA/2_3-GGCCA.mcs
MCSYM-DB/2_3/GGCCA/ds-2_3-GGCCA_x.pdb.gz
MCSYM-DB/2_3/GGCCC/
MCSYM-DB/2_3/GGCCC/2_3-GGCCC.mcs
MCSYM-DB/2_3/GGCCC/ds-2_3-GGCCC_x.pdb.gz
MCSYM-DB/2_3/GGCCG/
MCSYM-DB/2_3/GGCCG/2_3-GGCCG.mcs
MCSYM-DB/2_3/GGCCG/ds-2_3-GGCCG_x.pdb.gz
MCSYM-DB/2_3/GGCCU/
MCSYM-DB/2_3/GGCCU/2_3-GGCCU.mcs
MCSYM-DB/2_3/GGCCU/ds-2_3-GGCCU_x.pdb.gz
MCSYM-DB/2_3/GGCGA/
MCSYM-DB/2_3/GGCGA/2_3-GGCGA.mcs
MCSYM-DB/2_3/GGCGA/ds-2_3-GGCGA_x.pdb.gz
MCSYM-DB/2_3/GGCGC/
MCSYM-DB/2_3/GGCGC/1GKW_model_1.pdb.gz
MCSYM-DB/2_3/GGCGC/1K2G_model_1.pdb.gz
MCSYM-DB/2_3/GGCGC/1NTA_model_1.pdb.gz
MCSYM-DB/2_3/GGCGC/2_3-GGCGC.mcs
MCSYM-DB/2_3/GGCGC/ds-2_3-GGCGC_x.pdb.gz
MCSYM-DB/2_3/GGCGG/
MCSYM-DB/2_3/GGCGG/2_3-GGCGG.mcs
MCSYM-DB/2_3/GGCGG/ds-2_3-GGCGG_x.pdb.gz
MCSYM-DB/2_3/GGCGU/
MCSYM-DB/2_3/GGCGU/2_3-GGCGU.mcs
MCSYM-DB/2_3/GGCGU/ds-2_3-GGCGU_x.pdb.gz
MCSYM-DB/2_3/GGCUA/
MCSYM-DB/2_3/GGCUA/2_3-GGCUA.mcs
MCSYM-DB/2_3/GGCUA/ds-2_3-GGCUA_x.pdb.gz
MCSYM-DB/2_3/GGCUC/
MCSYM-DB/2_3/GGCUC/1XSH_model_1.pdb.gz
MCSYM-DB/2_3/GGCUC/2_3-GGCUC.mcs
MCSYM-DB/2_3/GGCUC/ds-2_3-GGCUC_x.pdb.gz
MCSYM-DB/2_3/GGCUG/
MCSYM-DB/2_3/GGCUG/2_3-GGCUG.mcs
MCSYM-DB/2_3/GGCUG/ds-2_3-GGCUG_x.pdb.gz
MCSYM-DB/2_3/GGCUU/
MCSYM-DB/2_3/GGCUU/1G70_model_1.pdb.gz
MCSYM-DB/2_3/GGCUU/2_3-GGCUU.mcs
MCSYM-DB/2_3/GGCUU/ds-2_3-GGCUU_x.pdb.gz
MCSYM-DB/2_3/GGGAA/
MCSYM-DB/2_3/GGGAA/2_3-GGGAA.mcs
MCSYM-DB/2_3/GGGAA/ds-2_3-GGGAA_x.pdb.gz
MCSYM-DB/2_3/GGGAC/
MCSYM-DB/2_3/GGGAC/2_3-GGGAC.mcs
MCSYM-DB/2_3/GGGAC/ds-2_3-GGGAC_x.pdb.gz
MCSYM-DB/2_3/GGGAG/
MCSYM-DB/2_3/GGGAG/2_3-GGGAG.mcs
MCSYM-DB/2_3/GGGAG/ds-2_3-GGGAG_x.pdb.gz
MCSYM-DB/2_3/GGGAU/
MCSYM-DB/2_3/GGGAU/ds-2_3-GGGAU_x.pdb.gz
MCSYM-DB/2_3/GGGCA/
MCSYM-DB/2_3/GGGCA/2_3-GGGCA.mcs
MCSYM-DB/2_3/GGGCA/ds-2_3-GGGCA_x.pdb.gz
MCSYM-DB/2_3/GGGCC/
MCSYM-DB/2_3/GGGCC/2_3-GGGCC.mcs
MCSYM-DB/2_3/GGGCC/ds-2_3-GGGCC_x.pdb.gz
MCSYM-DB/2_3/GGGCG/
MCSYM-DB/2_3/GGGCG/2_3-GGGCG.mcs
MCSYM-DB/2_3/GGGCG/ds-2_3-GGGCG_x.pdb.gz
MCSYM-DB/2_3/GGGCU/
MCSYM-DB/2_3/GGGCU/2_3-GGGCU.mcs
MCSYM-DB/2_3/GGGCU/ds-2_3-GGGCU_x.pdb.gz
MCSYM-DB/2_3/GGGGA/
MCSYM-DB/2_3/GGGGA/2_3-GGGGA.mcs
MCSYM-DB/2_3/GGGGA/ds-2_3-GGGGA_x.pdb.gz
MCSYM-DB/2_3/GGGGC/
MCSYM-DB/2_3/GGGGC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GGGGC/2_3-GGGGC.mcs
MCSYM-DB/2_3/GGGGC/ds-2_3-GGGGC_x.pdb.gz
MCSYM-DB/2_3/GGGGG/
MCSYM-DB/2_3/GGGGG/2_3-GGGGG.mcs
MCSYM-DB/2_3/GGGGG/ds-2_3-GGGGG_x.pdb.gz
MCSYM-DB/2_3/GGGGU/
MCSYM-DB/2_3/GGGGU/2_3-GGGGU.mcs
MCSYM-DB/2_3/GGGGU/ds-2_3-GGGGU_x.pdb.gz
MCSYM-DB/2_3/GGGUA/
MCSYM-DB/2_3/GGGUA/2_3-GGGUA.mcs
MCSYM-DB/2_3/GGGUA/ds-2_3-GGGUA_x.pdb.gz
MCSYM-DB/2_3/GGGUC/
MCSYM-DB/2_3/GGGUC/2_3-GGGUC.mcs
MCSYM-DB/2_3/GGGUC/ds-2_3-GGGUC_x.pdb.gz
MCSYM-DB/2_3/GGGUG/
MCSYM-DB/2_3/GGGUG/2_3-GGGUG.mcs
MCSYM-DB/2_3/GGGUG/ds-2_3-GGGUG_x.pdb.gz
MCSYM-DB/2_3/GGGUU/
MCSYM-DB/2_3/GGGUU/ds-2_3-GGGUU_x.pdb.gz
MCSYM-DB/2_3/GGUAA/
MCSYM-DB/2_3/GGUAA/2_3-GGUAA.mcs
MCSYM-DB/2_3/GGUAA/ds-2_3-GGUAA_x.pdb.gz
MCSYM-DB/2_3/GGUAC/
MCSYM-DB/2_3/GGUAC/1XJR_model_1.pdb.gz
MCSYM-DB/2_3/GGUAC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/GGUAC/2_3-GGUAC.mcs
MCSYM-DB/2_3/GGUAC/ds-2_3-GGUAC_x.pdb.gz
MCSYM-DB/2_3/GGUAG/
MCSYM-DB/2_3/GGUAG/2_3-GGUAG.mcs
MCSYM-DB/2_3/GGUAG/ds-2_3-GGUAG_x.pdb.gz
MCSYM-DB/2_3/GGUAU/
MCSYM-DB/2_3/GGUAU/2_3-GGUAU.mcs
MCSYM-DB/2_3/GGUAU/ds-2_3-GGUAU.pdb.gz
MCSYM-DB/2_3/GGUAU/ds-2_3-GGUAU_x.pdb.gz
MCSYM-DB/2_3/GGUCA/
MCSYM-DB/2_3/GGUCA/2_3-GGUCA.mcs
MCSYM-DB/2_3/GGUCA/ds-2_3-GGUCA_x.pdb.gz
MCSYM-DB/2_3/GGUCC/
MCSYM-DB/2_3/GGUCC/2_3-GGUCC.mcs
MCSYM-DB/2_3/GGUCC/ds-2_3-GGUCC_x.pdb.gz
MCSYM-DB/2_3/GGUCG/
MCSYM-DB/2_3/GGUCG/2_3-GGUCG.mcs
MCSYM-DB/2_3/GGUCG/ds-2_3-GGUCG_x.pdb.gz
MCSYM-DB/2_3/GGUCU/
MCSYM-DB/2_3/GGUCU/2_3-GGUCU.mcs
MCSYM-DB/2_3/GGUCU/ds-2_3-GGUCU_x.pdb.gz
MCSYM-DB/2_3/GGUGA/
MCSYM-DB/2_3/GGUGA/2_3-GGUGA.mcs
MCSYM-DB/2_3/GGUGA/ds-2_3-GGUGA_x.pdb.gz
MCSYM-DB/2_3/GGUGC/
MCSYM-DB/2_3/GGUGC/1U9S_model_1.pdb.gz
MCSYM-DB/2_3/GGUGC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GGUGC/2_3-GGUGC.mcs
MCSYM-DB/2_3/GGUGC/ds-2_3-GGUGC_x.pdb.gz
MCSYM-DB/2_3/GGUGG/
MCSYM-DB/2_3/GGUGG/2_3-GGUGG.mcs
MCSYM-DB/2_3/GGUGG/ds-2_3-GGUGG_x.pdb.gz
MCSYM-DB/2_3/GGUGU/
MCSYM-DB/2_3/GGUGU/2_3-GGUGU.mcs
MCSYM-DB/2_3/GGUGU/ds-2_3-GGUGU_x.pdb.gz
MCSYM-DB/2_3/GGUUA/
MCSYM-DB/2_3/GGUUA/2_3-GGUUA.mcs
MCSYM-DB/2_3/GGUUA/ds-2_3-GGUUA_x.pdb.gz
MCSYM-DB/2_3/GGUUC/
MCSYM-DB/2_3/GGUUC/1F6Z_model_1.pdb.gz
MCSYM-DB/2_3/GGUUC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/GGUUC/2_3-GGUUC.mcs
MCSYM-DB/2_3/GGUUC/ds-2_3-GGUUC_x.pdb.gz
MCSYM-DB/2_3/GGUUG/
MCSYM-DB/2_3/GGUUG/2_3-GGUUG.mcs
MCSYM-DB/2_3/GGUUG/ds-2_3-GGUUG_x.pdb.gz
MCSYM-DB/2_3/GGUUU/
MCSYM-DB/2_3/GGUUU/2_3-GGUUU.mcs
MCSYM-DB/2_3/GGUUU/ds-2_3-GGUUU_x.pdb.gz
MCSYM-DB/2_3/GUAAA/
MCSYM-DB/2_3/GUAAA/2_3-GUAAA.mcs
MCSYM-DB/2_3/GUAAA/ds-2_3-GUAAA_x.pdb.gz
MCSYM-DB/2_3/GUAAC/
MCSYM-DB/2_3/GUAAC/2_3-GUAAC.mcs
MCSYM-DB/2_3/GUAAC/ds-2_3-GUAAC_x.pdb.gz
MCSYM-DB/2_3/GUAAG/
MCSYM-DB/2_3/GUAAG/2_3-GUAAG.mcs
MCSYM-DB/2_3/GUAAG/ds-2_3-GUAAG_x.pdb.gz
MCSYM-DB/2_3/GUAAU/
MCSYM-DB/2_3/GUAAU/2_3-GUAAU.mcs
MCSYM-DB/2_3/GUAAU/ds-2_3-GUAAU_x.pdb.gz
MCSYM-DB/2_3/GUACA/
MCSYM-DB/2_3/GUACA/2_3-GUACA.mcs
MCSYM-DB/2_3/GUACA/ds-2_3-GUACA_x.pdb.gz
MCSYM-DB/2_3/GUACC/
MCSYM-DB/2_3/GUACC/2_3-GUACC.mcs
MCSYM-DB/2_3/GUACC/ds-2_3-GUACC_x.pdb.gz
MCSYM-DB/2_3/GUACG/
MCSYM-DB/2_3/GUACG/2_3-GUACG.mcs
MCSYM-DB/2_3/GUACG/ds-2_3-GUACG_x.pdb.gz
MCSYM-DB/2_3/GUACU/
MCSYM-DB/2_3/GUACU/2_3-GUACU.mcs
MCSYM-DB/2_3/GUACU/ds-2_3-GUACU_x.pdb.gz
MCSYM-DB/2_3/GUAGA/
MCSYM-DB/2_3/GUAGA/2_3-GUAGA.mcs
MCSYM-DB/2_3/GUAGA/ds-2_3-GUAGA_x.pdb.gz
MCSYM-DB/2_3/GUAGC/
MCSYM-DB/2_3/GUAGC/1L8V_model_1.pdb.gz
MCSYM-DB/2_3/GUAGC/2_3-GUAGC.mcs
MCSYM-DB/2_3/GUAGC/ds-2_3-GUAGC_x.pdb.gz
MCSYM-DB/2_3/GUAGG/
MCSYM-DB/2_3/GUAGG/2_3-GUAGG.mcs
MCSYM-DB/2_3/GUAGG/ds-2_3-GUAGG_x.pdb.gz
MCSYM-DB/2_3/GUAGU/
MCSYM-DB/2_3/GUAGU/2_3-GUAGU.mcs
MCSYM-DB/2_3/GUAGU/ds-2_3-GUAGU_x.pdb.gz
MCSYM-DB/2_3/GUAUA/
MCSYM-DB/2_3/GUAUA/2_3-GUAUA.mcs
MCSYM-DB/2_3/GUAUA/ds-2_3-GUAUA_x.pdb.gz
MCSYM-DB/2_3/GUAUC/
MCSYM-DB/2_3/GUAUC/2TPK_model_1.pdb.gz
MCSYM-DB/2_3/GUAUC/2_3-GUAUC.mcs
MCSYM-DB/2_3/GUAUC/ds-2_3-GUAUC_x.pdb.gz
MCSYM-DB/2_3/GUAUG/
MCSYM-DB/2_3/GUAUG/2_3-GUAUG.mcs
MCSYM-DB/2_3/GUAUG/ds-2_3-GUAUG_x.pdb.gz
MCSYM-DB/2_3/GUAUU/
MCSYM-DB/2_3/GUAUU/2_3-GUAUU.mcs
MCSYM-DB/2_3/GUAUU/ds-2_3-GUAUU_x.pdb.gz
MCSYM-DB/2_3/GUCAA/
MCSYM-DB/2_3/GUCAA/2_3-GUCAA.mcs
MCSYM-DB/2_3/GUCAA/ds-2_3-GUCAA_x.pdb.gz
MCSYM-DB/2_3/GUCAC/
MCSYM-DB/2_3/GUCAC/2_3-GUCAC.mcs
MCSYM-DB/2_3/GUCAC/ds-2_3-GUCAC_x.pdb.gz
MCSYM-DB/2_3/GUCAG/
MCSYM-DB/2_3/GUCAG/2_3-GUCAG.mcs
MCSYM-DB/2_3/GUCAG/ds-2_3-GUCAG_x.pdb.gz
MCSYM-DB/2_3/GUCAU/
MCSYM-DB/2_3/GUCAU/2_3-GUCAU.mcs
MCSYM-DB/2_3/GUCAU/ds-2_3-GUCAU_x.pdb.gz
MCSYM-DB/2_3/GUCCA/
MCSYM-DB/2_3/GUCCA/2_3-GUCCA.mcs
MCSYM-DB/2_3/GUCCA/ds-2_3-GUCCA_x.pdb.gz
MCSYM-DB/2_3/GUCCC/
MCSYM-DB/2_3/GUCCC/2_3-GUCCC.mcs
MCSYM-DB/2_3/GUCCC/ds-2_3-GUCCC_x.pdb.gz
MCSYM-DB/2_3/GUCCG/
MCSYM-DB/2_3/GUCCG/2_3-GUCCG.mcs
MCSYM-DB/2_3/GUCCG/ds-2_3-GUCCG_x.pdb.gz
MCSYM-DB/2_3/GUCCU/
MCSYM-DB/2_3/GUCCU/2_3-GUCCU.mcs
MCSYM-DB/2_3/GUCCU/ds-2_3-GUCCU_x.pdb.gz
MCSYM-DB/2_3/GUCGA/
MCSYM-DB/2_3/GUCGA/2_3-GUCGA.mcs
MCSYM-DB/2_3/GUCGA/ds-2_3-GUCGA_x.pdb.gz
MCSYM-DB/2_3/GUCGC/
MCSYM-DB/2_3/GUCGC/2_3-GUCGC.mcs
MCSYM-DB/2_3/GUCGC/ds-2_3-GUCGC_x.pdb.gz
MCSYM-DB/2_3/GUCGG/
MCSYM-DB/2_3/GUCGG/2_3-GUCGG.mcs
MCSYM-DB/2_3/GUCGG/ds-2_3-GUCGG_x.pdb.gz
MCSYM-DB/2_3/GUCGU/
MCSYM-DB/2_3/GUCGU/2_3-GUCGU.mcs
MCSYM-DB/2_3/GUCGU/ds-2_3-GUCGU_x.pdb.gz
MCSYM-DB/2_3/GUCUA/
MCSYM-DB/2_3/GUCUA/2_3-GUCUA.mcs
MCSYM-DB/2_3/GUCUA/ds-2_3-GUCUA_x.pdb.gz
MCSYM-DB/2_3/GUCUC/
MCSYM-DB/2_3/GUCUC/2_3-GUCUC.mcs
MCSYM-DB/2_3/GUCUC/ds-2_3-GUCUC_x.pdb.gz
MCSYM-DB/2_3/GUCUG/
MCSYM-DB/2_3/GUCUG/2_3-GUCUG.mcs
MCSYM-DB/2_3/GUCUG/ds-2_3-GUCUG_x.pdb.gz
MCSYM-DB/2_3/GUCUU/
MCSYM-DB/2_3/GUCUU/2_3-GUCUU.mcs
MCSYM-DB/2_3/GUCUU/ds-2_3-GUCUU_x.pdb.gz
MCSYM-DB/2_3/GUGAA/
MCSYM-DB/2_3/GUGAA/2_3-GUGAA.mcs
MCSYM-DB/2_3/GUGAA/ds-2_3-GUGAA_x.pdb.gz
MCSYM-DB/2_3/GUGAC/
MCSYM-DB/2_3/GUGAC/2_3-GUGAC.mcs
MCSYM-DB/2_3/GUGAC/ds-2_3-GUGAC_x.pdb.gz
MCSYM-DB/2_3/GUGAG/
MCSYM-DB/2_3/GUGAG/2_3-GUGAG.mcs
MCSYM-DB/2_3/GUGAG/ds-2_3-GUGAG_x.pdb.gz
MCSYM-DB/2_3/GUGAU/
MCSYM-DB/2_3/GUGAU/2_3-GUGAU.mcs
MCSYM-DB/2_3/GUGAU/ds-2_3-GUGAU_x.pdb.gz
MCSYM-DB/2_3/GUGCA/
MCSYM-DB/2_3/GUGCA/2_3-GUGCA.mcs
MCSYM-DB/2_3/GUGCA/ds-2_3-GUGCA_x.pdb.gz
MCSYM-DB/2_3/GUGCC/
MCSYM-DB/2_3/GUGCC/2_3-GUGCC.mcs
MCSYM-DB/2_3/GUGCC/ds-2_3-GUGCC_x.pdb.gz
MCSYM-DB/2_3/GUGCG/
MCSYM-DB/2_3/GUGCG/2_3-GUGCG.mcs
MCSYM-DB/2_3/GUGCG/ds-2_3-GUGCG_x.pdb.gz
MCSYM-DB/2_3/GUGCU/
MCSYM-DB/2_3/GUGCU/2_3-GUGCU.mcs
MCSYM-DB/2_3/GUGCU/ds-2_3-GUGCU_x.pdb.gz
MCSYM-DB/2_3/GUGGA/
MCSYM-DB/2_3/GUGGA/2_3-GUGGA.mcs
MCSYM-DB/2_3/GUGGA/ds-2_3-GUGGA_x.pdb.gz
MCSYM-DB/2_3/GUGGC/
MCSYM-DB/2_3/GUGGC/2_3-GUGGC.mcs
MCSYM-DB/2_3/GUGGC/ds-2_3-GUGGC_x.pdb.gz
MCSYM-DB/2_3/GUGGG/
MCSYM-DB/2_3/GUGGG/2_3-GUGGG.mcs
MCSYM-DB/2_3/GUGGG/ds-2_3-GUGGG_x.pdb.gz
MCSYM-DB/2_3/GUGGU/
MCSYM-DB/2_3/GUGGU/2_3-GUGGU.mcs
MCSYM-DB/2_3/GUGGU/ds-2_3-GUGGU_x.pdb.gz
MCSYM-DB/2_3/GUGUA/
MCSYM-DB/2_3/GUGUA/2_3-GUGUA.mcs
MCSYM-DB/2_3/GUGUA/ds-2_3-GUGUA_x.pdb.gz
MCSYM-DB/2_3/GUGUC/
MCSYM-DB/2_3/GUGUC/1FQZ_model_1.pdb.gz
MCSYM-DB/2_3/GUGUC/2_3-GUGUC.mcs
MCSYM-DB/2_3/GUGUC/ds-2_3-GUGUC_x.pdb.gz
MCSYM-DB/2_3/GUGUG/
MCSYM-DB/2_3/GUGUG/2_3-GUGUG.mcs
MCSYM-DB/2_3/GUGUG/ds-2_3-GUGUG_x.pdb.gz
MCSYM-DB/2_3/GUGUU/
MCSYM-DB/2_3/GUGUU/2_3-GUGUU.mcs
MCSYM-DB/2_3/GUGUU/ds-2_3-GUGUU_x.pdb.gz
MCSYM-DB/2_3/GUUAA/
MCSYM-DB/2_3/GUUAA/2_3-GUUAA.mcs
MCSYM-DB/2_3/GUUAA/ds-2_3-GUUAA_x.pdb.gz
MCSYM-DB/2_3/GUUAC/
MCSYM-DB/2_3/GUUAC/2_3-GUUAC.mcs
MCSYM-DB/2_3/GUUAC/ds-2_3-GUUAC_x.pdb.gz
MCSYM-DB/2_3/GUUAG/
MCSYM-DB/2_3/GUUAG/ds-2_3-GUUAG_x.pdb.gz
MCSYM-DB/2_3/GUUAU/
MCSYM-DB/2_3/GUUAU/2_3-GUUAU.mcs
MCSYM-DB/2_3/GUUAU/ds-2_3-GUUAU_x.pdb.gz
MCSYM-DB/2_3/GUUCA/
MCSYM-DB/2_3/GUUCA/2_3-GUUCA.mcs
MCSYM-DB/2_3/GUUCA/ds-2_3-GUUCA_x.pdb.gz
MCSYM-DB/2_3/GUUCC/
MCSYM-DB/2_3/GUUCC/2_3-GUUCC.mcs
MCSYM-DB/2_3/GUUCC/ds-2_3-GUUCC_x.pdb.gz
MCSYM-DB/2_3/GUUCG/
MCSYM-DB/2_3/GUUCG/ds-2_3-GUUCG_x.pdb.gz
MCSYM-DB/2_3/GUUCU/
MCSYM-DB/2_3/GUUCU/2_3-GUUCU.mcs
MCSYM-DB/2_3/GUUCU/ds-2_3-GUUCU_x.pdb.gz
MCSYM-DB/2_3/GUUGA/
MCSYM-DB/2_3/GUUGA/2_3-GUUGA.mcs
MCSYM-DB/2_3/GUUGA/ds-2_3-GUUGA_x.pdb.gz
MCSYM-DB/2_3/GUUGC/
MCSYM-DB/2_3/GUUGC/2_3-GUUGC.mcs
MCSYM-DB/2_3/GUUGC/ds-2_3-GUUGC_x.pdb.gz
MCSYM-DB/2_3/GUUGG/
MCSYM-DB/2_3/GUUGG/2_3-GUUGG.mcs
MCSYM-DB/2_3/GUUGG/ds-2_3-GUUGG_x.pdb.gz
MCSYM-DB/2_3/GUUGU/
MCSYM-DB/2_3/GUUGU/2_3-GUUGU.mcs
MCSYM-DB/2_3/GUUGU/ds-2_3-GUUGU_x.pdb.gz
MCSYM-DB/2_3/GUUUA/
MCSYM-DB/2_3/GUUUA/2_3-GUUUA.mcs
MCSYM-DB/2_3/GUUUA/ds-2_3-GUUUA_x.pdb.gz
MCSYM-DB/2_3/GUUUC/
MCSYM-DB/2_3/GUUUC/2_3-GUUUC.mcs
MCSYM-DB/2_3/GUUUC/ds-2_3-GUUUC_x.pdb.gz
MCSYM-DB/2_3/GUUUG/
MCSYM-DB/2_3/GUUUG/ds-2_3-GUUUG_x.pdb.gz
MCSYM-DB/2_3/GUUUU/
MCSYM-DB/2_3/GUUUU/2_3-GUUUU.mcs
MCSYM-DB/2_3/GUUUU/ds-2_3-GUUUU_x.pdb.gz
MCSYM-DB/2_3/UAAAA/
MCSYM-DB/2_3/UAAAA/2_3-UAAAA.mcs
MCSYM-DB/2_3/UAAAA/ds-2_3-UAAAA_x.pdb.gz
MCSYM-DB/2_3/UAAAC/
MCSYM-DB/2_3/UAAAC/2_3-UAAAC.mcs
MCSYM-DB/2_3/UAAAC/ds-2_3-UAAAC_x.pdb.gz
MCSYM-DB/2_3/UAAAG/
MCSYM-DB/2_3/UAAAG/2_3-UAAAG.mcs
MCSYM-DB/2_3/UAAAG/ds-2_3-UAAAG_x.pdb.gz
MCSYM-DB/2_3/UAAAU/
MCSYM-DB/2_3/UAAAU/2_3-UAAAU.mcs
MCSYM-DB/2_3/UAAAU/ds-2_3-UAAAU_x.pdb.gz
MCSYM-DB/2_3/UAACA/
MCSYM-DB/2_3/UAACA/2_3-UAACA.mcs
MCSYM-DB/2_3/UAACA/ds-2_3-UAACA_x.pdb.gz
MCSYM-DB/2_3/UAACC/
MCSYM-DB/2_3/UAACC/ds-2_3-UAACC_x.pdb.gz
MCSYM-DB/2_3/UAACG/
MCSYM-DB/2_3/UAACG/2_3-UAACG.mcs
MCSYM-DB/2_3/UAACG/ds-2_3-UAACG_x.pdb.gz
MCSYM-DB/2_3/UAACU/
MCSYM-DB/2_3/UAACU/2_3-UAACU.mcs
MCSYM-DB/2_3/UAACU/ds-2_3-UAACU_x.pdb.gz
MCSYM-DB/2_3/UAAGA/
MCSYM-DB/2_3/UAAGA/2_3-UAAGA.mcs
MCSYM-DB/2_3/UAAGA/ds-2_3-UAAGA_x.pdb.gz
MCSYM-DB/2_3/UAAGC/
MCSYM-DB/2_3/UAAGC/ds-2_3-UAAGC_x.pdb.gz
MCSYM-DB/2_3/UAAGG/
MCSYM-DB/2_3/UAAGG/2_3-UAAGG.mcs
MCSYM-DB/2_3/UAAGG/ds-2_3-UAAGG_x.pdb.gz
MCSYM-DB/2_3/UAAGU/
MCSYM-DB/2_3/UAAGU/2_3-UAAGU.mcs
MCSYM-DB/2_3/UAAGU/ds-2_3-UAAGU_x.pdb.gz
MCSYM-DB/2_3/UAAUA/
MCSYM-DB/2_3/UAAUA/2_3-UAAUA.mcs
MCSYM-DB/2_3/UAAUA/ds-2_3-UAAUA_x.pdb.gz
MCSYM-DB/2_3/UAAUC/
MCSYM-DB/2_3/UAAUC/2_3-UAAUC.mcs
MCSYM-DB/2_3/UAAUC/ds-2_3-UAAUC_x.pdb.gz
MCSYM-DB/2_3/UAAUG/
MCSYM-DB/2_3/UAAUG/2_3-UAAUG.mcs
MCSYM-DB/2_3/UAAUG/ds-2_3-UAAUG_x.pdb.gz
MCSYM-DB/2_3/UAAUU/
MCSYM-DB/2_3/UAAUU/2_3-UAAUU.mcs
MCSYM-DB/2_3/UAAUU/bp.txt
MCSYM-DB/2_3/UAAUU/ds-2_3-UAAUU_x.pdb.gz
MCSYM-DB/2_3/UACAA/
MCSYM-DB/2_3/UACAA/2_3-UACAA.mcs
MCSYM-DB/2_3/UACAA/ds-2_3-UACAA_x.pdb.gz
MCSYM-DB/2_3/UACAC/
MCSYM-DB/2_3/UACAC/ds-2_3-UACAC_x.pdb.gz
MCSYM-DB/2_3/UACAG/
MCSYM-DB/2_3/UACAG/ds-2_3-UACAG_x.pdb.gz
MCSYM-DB/2_3/UACAU/
MCSYM-DB/2_3/UACAU/2_3-UACAU.mcs
MCSYM-DB/2_3/UACAU/ds-2_3-UACAU_x.pdb.gz
MCSYM-DB/2_3/UACCA/
MCSYM-DB/2_3/UACCA/2_3-UACCA.mcs
MCSYM-DB/2_3/UACCA/ds-2_3-UACCA_x.pdb.gz
MCSYM-DB/2_3/UACCC/
MCSYM-DB/2_3/UACCC/2_3-UACCC.mcs
MCSYM-DB/2_3/UACCC/ds-2_3-UACCC_x.pdb.gz
MCSYM-DB/2_3/UACCG/
MCSYM-DB/2_3/UACCG/2_3-UACCG.mcs
MCSYM-DB/2_3/UACCG/ds-2_3-UACCG_x.pdb.gz
MCSYM-DB/2_3/UACCU/
MCSYM-DB/2_3/UACCU/2_3-UACCU.mcs
MCSYM-DB/2_3/UACCU/ds-2_3-UACCU_x.pdb.gz
MCSYM-DB/2_3/UACGA/
MCSYM-DB/2_3/UACGA/2_3-UACGA.mcs
MCSYM-DB/2_3/UACGA/ds-2_3-UACGA_x.pdb.gz
MCSYM-DB/2_3/UACGC/
MCSYM-DB/2_3/UACGC/ds-2_3-UACGC_x.pdb.gz
MCSYM-DB/2_3/UACGG/
MCSYM-DB/2_3/UACGG/ds-2_3-UACGG_x.pdb.gz
MCSYM-DB/2_3/UACGU/
MCSYM-DB/2_3/UACGU/2_3-UACGU.mcs
MCSYM-DB/2_3/UACGU/ds-2_3-UACGU_x.pdb.gz
MCSYM-DB/2_3/UACUA/
MCSYM-DB/2_3/UACUA/2_3-UACUA.mcs
MCSYM-DB/2_3/UACUA/ds-2_3-UACUA_x.pdb.gz
MCSYM-DB/2_3/UACUC/
MCSYM-DB/2_3/UACUC/2_3-UACUC.mcs
MCSYM-DB/2_3/UACUC/ds-2_3-UACUC_x.pdb.gz
MCSYM-DB/2_3/UACUG/
MCSYM-DB/2_3/UACUG/2_3-UACUG.mcs
MCSYM-DB/2_3/UACUG/ds-2_3-UACUG_x.pdb.gz
MCSYM-DB/2_3/UACUU/
MCSYM-DB/2_3/UACUU/2_3-UACUU.mcs
MCSYM-DB/2_3/UACUU/ds-2_3-UACUU_x.pdb.gz
MCSYM-DB/2_3/UAGAA/
MCSYM-DB/2_3/UAGAA/1M5K_model_1.pdb.gz
MCSYM-DB/2_3/UAGAA/1ZFV_model_1.pdb.gz
MCSYM-DB/2_3/UAGAA/2_3-UAGAA.mcs
MCSYM-DB/2_3/UAGAA/ds-2_3-UAGAA_x.pdb.gz
MCSYM-DB/2_3/UAGAC/
MCSYM-DB/2_3/UAGAC/2_3-UAGAC.mcs
MCSYM-DB/2_3/UAGAC/ds-2_3-UAGAC_x.pdb.gz
MCSYM-DB/2_3/UAGAG/
MCSYM-DB/2_3/UAGAG/2_3-UAGAG.mcs
MCSYM-DB/2_3/UAGAG/ds-2_3-UAGAG_x.pdb.gz
MCSYM-DB/2_3/UAGAU/
MCSYM-DB/2_3/UAGAU/2_3-UAGAU.mcs
MCSYM-DB/2_3/UAGAU/ds-2_3-UAGAU_x.pdb.gz
MCSYM-DB/2_3/UAGCA/
MCSYM-DB/2_3/UAGCA/2_3-UAGCA.mcs
MCSYM-DB/2_3/UAGCA/ds-2_3-UAGCA_x.pdb.gz
MCSYM-DB/2_3/UAGCC/
MCSYM-DB/2_3/UAGCC/ds-2_3-UAGCC_x.pdb.gz
MCSYM-DB/2_3/UAGCG/
MCSYM-DB/2_3/UAGCG/2_3-UAGCG.mcs
MCSYM-DB/2_3/UAGCG/ds-2_3-UAGCG_x.pdb.gz
MCSYM-DB/2_3/UAGCU/
MCSYM-DB/2_3/UAGCU/2_3-UAGCU.mcs
MCSYM-DB/2_3/UAGCU/ds-2_3-UAGCU_x.pdb.gz
MCSYM-DB/2_3/UAGGA/
MCSYM-DB/2_3/UAGGA/2_3-UAGGA.mcs
MCSYM-DB/2_3/UAGGA/ds-2_3-UAGGA_x.pdb.gz
MCSYM-DB/2_3/UAGGC/
MCSYM-DB/2_3/UAGGC/ds-2_3-UAGGC_x.pdb.gz
MCSYM-DB/2_3/UAGGG/
MCSYM-DB/2_3/UAGGG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/UAGGG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UAGGG/2_3-UAGGG.mcs
MCSYM-DB/2_3/UAGGG/ds-2_3-UAGGG_x.pdb.gz
MCSYM-DB/2_3/UAGGU/
MCSYM-DB/2_3/UAGGU/2_3-UAGGU.mcs
MCSYM-DB/2_3/UAGGU/ds-2_3-UAGGU_x.pdb.gz
MCSYM-DB/2_3/UAGUA/
MCSYM-DB/2_3/UAGUA/1R2P_model_1.pdb.gz
MCSYM-DB/2_3/UAGUA/1YNC_model_1.pdb.gz
MCSYM-DB/2_3/UAGUA/2_3-UAGUA.mcs
MCSYM-DB/2_3/UAGUA/ds-2_3-UAGUA_x.pdb.gz
MCSYM-DB/2_3/UAGUC/
MCSYM-DB/2_3/UAGUC/ds-2_3-UAGUC_x.pdb.gz
MCSYM-DB/2_3/UAGUG/
MCSYM-DB/2_3/UAGUG/2_3-UAGUG.mcs
MCSYM-DB/2_3/UAGUG/ds-2_3-UAGUG_x.pdb.gz
MCSYM-DB/2_3/UAGUU/
MCSYM-DB/2_3/UAGUU/ds-2_3-UAGUU_x.pdb.gz
MCSYM-DB/2_3/UAUAA/
MCSYM-DB/2_3/UAUAA/1I9X_model_1.pdb.gz
MCSYM-DB/2_3/UAUAA/1LMV_model_1.pdb.gz
MCSYM-DB/2_3/UAUAA/1U0B_model_1.pdb.gz
MCSYM-DB/2_3/UAUAA/2_3-UAUAA.mcs
MCSYM-DB/2_3/UAUAA/ds-2_3-UAUAA_x.pdb.gz
MCSYM-DB/2_3/UAUAC/
MCSYM-DB/2_3/UAUAC/2_3-UAUAC.mcs
MCSYM-DB/2_3/UAUAC/ds-2_3-UAUAC_x.pdb.gz
MCSYM-DB/2_3/UAUAG/
MCSYM-DB/2_3/UAUAG/2_3-UAUAG.mcs
MCSYM-DB/2_3/UAUAG/ds-2_3-UAUAG_x.pdb.gz
MCSYM-DB/2_3/UAUAU/
MCSYM-DB/2_3/UAUAU/2_3-UAUAU.mcs
MCSYM-DB/2_3/UAUAU/ds-2_3-UAUAU_x.pdb.gz
MCSYM-DB/2_3/UAUCA/
MCSYM-DB/2_3/UAUCA/2_3-UAUCA.mcs
MCSYM-DB/2_3/UAUCA/ds-2_3-UAUCA_x.pdb.gz
MCSYM-DB/2_3/UAUCC/
MCSYM-DB/2_3/UAUCC/2_3-UAUCC.mcs
MCSYM-DB/2_3/UAUCC/ds-2_3-UAUCC_x.pdb.gz
MCSYM-DB/2_3/UAUCG/
MCSYM-DB/2_3/UAUCG/2_3-UAUCG.mcs
MCSYM-DB/2_3/UAUCG/ds-2_3-UAUCG_x.pdb.gz
MCSYM-DB/2_3/UAUCU/
MCSYM-DB/2_3/UAUCU/2_3-UAUCU.mcs
MCSYM-DB/2_3/UAUCU/ds-2_3-UAUCU_x.pdb.gz
MCSYM-DB/2_3/UAUGA/
MCSYM-DB/2_3/UAUGA/1XMQ_model_1.pdb.gz
MCSYM-DB/2_3/UAUGA/2_3-UAUGA.mcs
MCSYM-DB/2_3/UAUGA/ds-2_3-UAUGA_x.pdb.gz
MCSYM-DB/2_3/UAUGC/
MCSYM-DB/2_3/UAUGC/2_3-UAUGC.mcs
MCSYM-DB/2_3/UAUGC/ds-2_3-UAUGC_x.pdb.gz
MCSYM-DB/2_3/UAUGG/
MCSYM-DB/2_3/UAUGG/2_3-UAUGG.mcs
MCSYM-DB/2_3/UAUGG/ds-2_3-UAUGG_x.pdb.gz
MCSYM-DB/2_3/UAUGU/
MCSYM-DB/2_3/UAUGU/2_3-UAUGU.mcs
MCSYM-DB/2_3/UAUGU/ds-2_3-UAUGU_x.pdb.gz
MCSYM-DB/2_3/UAUUA/
MCSYM-DB/2_3/UAUUA/2_3-UAUUA.mcs
MCSYM-DB/2_3/UAUUA/ds-2_3-UAUUA_x.pdb.gz
MCSYM-DB/2_3/UAUUC/
MCSYM-DB/2_3/UAUUC/2_3-UAUUC.mcs
MCSYM-DB/2_3/UAUUC/ds-2_3-UAUUC_x.pdb.gz
MCSYM-DB/2_3/UAUUG/
MCSYM-DB/2_3/UAUUG/2_3-UAUUG.mcs
MCSYM-DB/2_3/UAUUG/ds-2_3-UAUUG_x.pdb.gz
MCSYM-DB/2_3/UAUUU/
MCSYM-DB/2_3/UAUUU/2_3-UAUUU.mcs
MCSYM-DB/2_3/UAUUU/ds-2_3-UAUUU_x.pdb.gz
MCSYM-DB/2_3/UCAAA/
MCSYM-DB/2_3/UCAAA/2_3-UCAAA.mcs
MCSYM-DB/2_3/UCAAA/ds-2_3-UCAAA_x.pdb.gz
MCSYM-DB/2_3/UCAAC/
MCSYM-DB/2_3/UCAAC/2_3-UCAAC.mcs
MCSYM-DB/2_3/UCAAC/ds-2_3-UCAAC_x.pdb.gz
MCSYM-DB/2_3/UCAAG/
MCSYM-DB/2_3/UCAAG/2_3-UCAAG.mcs
MCSYM-DB/2_3/UCAAG/ds-2_3-UCAAG_x.pdb.gz
MCSYM-DB/2_3/UCAAU/
MCSYM-DB/2_3/UCAAU/2_3-UCAAU.mcs
MCSYM-DB/2_3/UCAAU/ds-2_3-UCAAU_x.pdb.gz
MCSYM-DB/2_3/UCACA/
MCSYM-DB/2_3/UCACA/2_3-UCACA.mcs
MCSYM-DB/2_3/UCACA/ds-2_3-UCACA_x.pdb.gz
MCSYM-DB/2_3/UCACC/
MCSYM-DB/2_3/UCACC/2_3-UCACC.mcs
MCSYM-DB/2_3/UCACC/ds-2_3-UCACC_x.pdb.gz
MCSYM-DB/2_3/UCACG/
MCSYM-DB/2_3/UCACG/2_3-UCACG.mcs
MCSYM-DB/2_3/UCACG/ds-2_3-UCACG_x.pdb.gz
MCSYM-DB/2_3/UCACU/
MCSYM-DB/2_3/UCACU/2_3-UCACU.mcs
MCSYM-DB/2_3/UCACU/ds-2_3-UCACU_x.pdb.gz
MCSYM-DB/2_3/UCAGA/
MCSYM-DB/2_3/UCAGA/2_3-UCAGA.mcs
MCSYM-DB/2_3/UCAGA/ds-2_3-UCAGA_x.pdb.gz
MCSYM-DB/2_3/UCAGC/
MCSYM-DB/2_3/UCAGC/2_3-UCAGC.mcs
MCSYM-DB/2_3/UCAGC/ds-2_3-UCAGC_x.pdb.gz
MCSYM-DB/2_3/UCAGG/
MCSYM-DB/2_3/UCAGG/2_3-UCAGG.mcs
MCSYM-DB/2_3/UCAGG/ds-2_3-UCAGG_x.pdb.gz
MCSYM-DB/2_3/UCAGU/
MCSYM-DB/2_3/UCAGU/2_3-UCAGU.mcs
MCSYM-DB/2_3/UCAGU/ds-2_3-UCAGU_x.pdb.gz
MCSYM-DB/2_3/UCAUA/
MCSYM-DB/2_3/UCAUA/2_3-UCAUA.mcs
MCSYM-DB/2_3/UCAUA/ds-2_3-UCAUA_x.pdb.gz
MCSYM-DB/2_3/UCAUC/
MCSYM-DB/2_3/UCAUC/2_3-UCAUC.mcs
MCSYM-DB/2_3/UCAUC/ds-2_3-UCAUC_x.pdb.gz
MCSYM-DB/2_3/UCAUG/
MCSYM-DB/2_3/UCAUG/2_3-UCAUG.mcs
MCSYM-DB/2_3/UCAUG/ds-2_3-UCAUG_x.pdb.gz
MCSYM-DB/2_3/UCAUU/
MCSYM-DB/2_3/UCAUU/2_3-UCAUU.mcs
MCSYM-DB/2_3/UCAUU/ds-2_3-UCAUU_x.pdb.gz
MCSYM-DB/2_3/UCCAA/
MCSYM-DB/2_3/UCCAA/2_3-UCCAA.mcs
MCSYM-DB/2_3/UCCAA/ds-2_3-UCCAA_x.pdb.gz
MCSYM-DB/2_3/UCCAC/
MCSYM-DB/2_3/UCCAC/2_3-UCCAC.mcs
MCSYM-DB/2_3/UCCAC/ds-2_3-UCCAC_x.pdb.gz
MCSYM-DB/2_3/UCCAG/
MCSYM-DB/2_3/UCCAG/2_3-UCCAG.mcs
MCSYM-DB/2_3/UCCAG/ds-2_3-UCCAG_x.pdb.gz
MCSYM-DB/2_3/UCCAU/
MCSYM-DB/2_3/UCCAU/2_3-UCCAU.mcs
MCSYM-DB/2_3/UCCAU/ds-2_3-UCCAU_x.pdb.gz
MCSYM-DB/2_3/UCCCA/
MCSYM-DB/2_3/UCCCA/2_3-UCCCA.mcs
MCSYM-DB/2_3/UCCCA/ds-2_3-UCCCA_x.pdb.gz
MCSYM-DB/2_3/UCCCC/
MCSYM-DB/2_3/UCCCC/2_3-UCCCC.mcs
MCSYM-DB/2_3/UCCCC/ds-2_3-UCCCC_x.pdb.gz
MCSYM-DB/2_3/UCCCG/
MCSYM-DB/2_3/UCCCG/2_3-UCCCG.mcs
MCSYM-DB/2_3/UCCCG/ds-2_3-UCCCG_x.pdb.gz
MCSYM-DB/2_3/UCCCU/
MCSYM-DB/2_3/UCCCU/2_3-UCCCU.mcs
MCSYM-DB/2_3/UCCCU/ds-2_3-UCCCU_x.pdb.gz
MCSYM-DB/2_3/UCCGA/
MCSYM-DB/2_3/UCCGA/2_3-UCCGA.mcs
MCSYM-DB/2_3/UCCGA/ds-2_3-UCCGA_x.pdb.gz
MCSYM-DB/2_3/UCCGC/
MCSYM-DB/2_3/UCCGC/2_3-UCCGC.mcs
MCSYM-DB/2_3/UCCGC/ds-2_3-UCCGC_x.pdb.gz
MCSYM-DB/2_3/UCCGG/
MCSYM-DB/2_3/UCCGG/2_3-UCCGG.mcs
MCSYM-DB/2_3/UCCGG/ds-2_3-UCCGG_x.pdb.gz
MCSYM-DB/2_3/UCCGU/
MCSYM-DB/2_3/UCCGU/ds-2_3-UCCGU_x.pdb.gz
MCSYM-DB/2_3/UCCUA/
MCSYM-DB/2_3/UCCUA/2_3-UCCUA.mcs
MCSYM-DB/2_3/UCCUA/ds-2_3-UCCUA_x.pdb.gz
MCSYM-DB/2_3/UCCUC/
MCSYM-DB/2_3/UCCUC/2_3-UCCUC.mcs
MCSYM-DB/2_3/UCCUC/ds-2_3-UCCUC_x.pdb.gz
MCSYM-DB/2_3/UCCUG/
MCSYM-DB/2_3/UCCUG/2_3-UCCUG.mcs
MCSYM-DB/2_3/UCCUG/ds-2_3-UCCUG_x.pdb.gz
MCSYM-DB/2_3/UCCUU/
MCSYM-DB/2_3/UCCUU/2_3-UCCUU.mcs
MCSYM-DB/2_3/UCCUU/ds-2_3-UCCUU_x.pdb.gz
MCSYM-DB/2_3/UCGAA/
MCSYM-DB/2_3/UCGAA/2_3-UCGAA.mcs
MCSYM-DB/2_3/UCGAA/ds-2_3-UCGAA_x.pdb.gz
MCSYM-DB/2_3/UCGAC/
MCSYM-DB/2_3/UCGAC/2_3-UCGAC.mcs
MCSYM-DB/2_3/UCGAC/ds-2_3-UCGAC_x.pdb.gz
MCSYM-DB/2_3/UCGAG/
MCSYM-DB/2_3/UCGAG/1Y39_model_1.pdb.gz
MCSYM-DB/2_3/UCGAG/2_3-UCGAG.mcs
MCSYM-DB/2_3/UCGAG/ds-2_3-UCGAG_x.pdb.gz
MCSYM-DB/2_3/UCGAU/
MCSYM-DB/2_3/UCGAU/2_3-UCGAU.mcs
MCSYM-DB/2_3/UCGAU/ds-2_3-UCGAU_x.pdb.gz
MCSYM-DB/2_3/UCGCA/
MCSYM-DB/2_3/UCGCA/2B6G_model_1.pdb.gz
MCSYM-DB/2_3/UCGCA/2ES5_model_1.pdb.gz
MCSYM-DB/2_3/UCGCA/2_3-UCGCA.mcs
MCSYM-DB/2_3/UCGCA/ds-2_3-UCGCA_x.pdb.gz
MCSYM-DB/2_3/UCGCC/
MCSYM-DB/2_3/UCGCC/2_3-UCGCC.mcs
MCSYM-DB/2_3/UCGCC/ds-2_3-UCGCC_x.pdb.gz
MCSYM-DB/2_3/UCGCG/
MCSYM-DB/2_3/UCGCG/2_3-UCGCG.mcs
MCSYM-DB/2_3/UCGCG/ds-2_3-UCGCG_x.pdb.gz
MCSYM-DB/2_3/UCGCU/
MCSYM-DB/2_3/UCGCU/2_3-UCGCU.mcs
MCSYM-DB/2_3/UCGCU/ds-2_3-UCGCU_x.pdb.gz
MCSYM-DB/2_3/UCGGA/
MCSYM-DB/2_3/UCGGA/2_3-UCGGA.mcs
MCSYM-DB/2_3/UCGGA/ds-2_3-UCGGA_x.pdb.gz
MCSYM-DB/2_3/UCGGC/
MCSYM-DB/2_3/UCGGC/2_3-UCGGC.mcs
MCSYM-DB/2_3/UCGGC/ds-2_3-UCGGC_x.pdb.gz
MCSYM-DB/2_3/UCGGG/
MCSYM-DB/2_3/UCGGG/2_3-UCGGG.mcs
MCSYM-DB/2_3/UCGGG/ds-2_3-UCGGG_x.pdb.gz
MCSYM-DB/2_3/UCGGU/
MCSYM-DB/2_3/UCGGU/2_3-UCGGU.mcs
MCSYM-DB/2_3/UCGGU/ds-2_3-UCGGU_x.pdb.gz
MCSYM-DB/2_3/UCGUA/
MCSYM-DB/2_3/UCGUA/2A9X_model_1.pdb.gz
MCSYM-DB/2_3/UCGUA/2_3-UCGUA.mcs
MCSYM-DB/2_3/UCGUA/ds-2_3-UCGUA_x.pdb.gz
MCSYM-DB/2_3/UCGUC/
MCSYM-DB/2_3/UCGUC/2_3-UCGUC.mcs
MCSYM-DB/2_3/UCGUC/ds-2_3-UCGUC_x.pdb.gz
MCSYM-DB/2_3/UCGUG/
MCSYM-DB/2_3/UCGUG/1P5M_model_1.pdb.gz
MCSYM-DB/2_3/UCGUG/1P5O_model_1.pdb.gz
MCSYM-DB/2_3/UCGUG/2_3-UCGUG.mcs
MCSYM-DB/2_3/UCGUG/ds-2_3-UCGUG_x.pdb.gz
MCSYM-DB/2_3/UCGUU/
MCSYM-DB/2_3/UCGUU/2_3-UCGUU.mcs
MCSYM-DB/2_3/UCGUU/ds-2_3-UCGUU_x.pdb.gz
MCSYM-DB/2_3/UCUAA/
MCSYM-DB/2_3/UCUAA/2_3-UCUAA.mcs
MCSYM-DB/2_3/UCUAA/ds-2_3-UCUAA_x.pdb.gz
MCSYM-DB/2_3/UCUAC/
MCSYM-DB/2_3/UCUAC/ds-2_3-UCUAC_x.pdb.gz
MCSYM-DB/2_3/UCUAG/
MCSYM-DB/2_3/UCUAG/2_3-UCUAG.mcs
MCSYM-DB/2_3/UCUAG/ds-2_3-UCUAG_x.pdb.gz
MCSYM-DB/2_3/UCUAU/
MCSYM-DB/2_3/UCUAU/2_3-UCUAU.mcs
MCSYM-DB/2_3/UCUAU/ds-2_3-UCUAU_x.pdb.gz
MCSYM-DB/2_3/UCUCA/
MCSYM-DB/2_3/UCUCA/2_3-UCUCA.mcs
MCSYM-DB/2_3/UCUCA/ds-2_3-UCUCA_x.pdb.gz
MCSYM-DB/2_3/UCUCC/
MCSYM-DB/2_3/UCUCC/2_3-UCUCC.mcs
MCSYM-DB/2_3/UCUCC/ds-2_3-UCUCC_x.pdb.gz
MCSYM-DB/2_3/UCUCG/
MCSYM-DB/2_3/UCUCG/2_3-UCUCG.mcs
MCSYM-DB/2_3/UCUCG/ds-2_3-UCUCG_x.pdb.gz
MCSYM-DB/2_3/UCUCU/
MCSYM-DB/2_3/UCUCU/2_3-UCUCU.mcs
MCSYM-DB/2_3/UCUCU/ds-2_3-UCUCU_x.pdb.gz
MCSYM-DB/2_3/UCUGA/
MCSYM-DB/2_3/UCUGA/2_3-UCUGA.mcs
MCSYM-DB/2_3/UCUGA/ds-2_3-UCUGA_x.pdb.gz
MCSYM-DB/2_3/UCUGC/
MCSYM-DB/2_3/UCUGC/2_3-UCUGC.mcs
MCSYM-DB/2_3/UCUGC/ds-2_3-UCUGC_x.pdb.gz
MCSYM-DB/2_3/UCUGG/
MCSYM-DB/2_3/UCUGG/2_3-UCUGG.mcs
MCSYM-DB/2_3/UCUGG/ds-2_3-UCUGG_x.pdb.gz
MCSYM-DB/2_3/UCUGU/
MCSYM-DB/2_3/UCUGU/2_3-UCUGU.mcs
MCSYM-DB/2_3/UCUGU/ds-2_3-UCUGU_x.pdb.gz
MCSYM-DB/2_3/UCUUA/
MCSYM-DB/2_3/UCUUA/2_3-UCUUA.mcs
MCSYM-DB/2_3/UCUUA/ds-2_3-UCUUA_x.pdb.gz
MCSYM-DB/2_3/UCUUC/
MCSYM-DB/2_3/UCUUC/2_3-UCUUC.mcs
MCSYM-DB/2_3/UCUUC/ds-2_3-UCUUC_x.pdb.gz
MCSYM-DB/2_3/UCUUG/
MCSYM-DB/2_3/UCUUG/2_3-UCUUG.mcs
MCSYM-DB/2_3/UCUUG/ds-2_3-UCUUG_x.pdb.gz
MCSYM-DB/2_3/UCUUU/
MCSYM-DB/2_3/UCUUU/2_3-UCUUU.mcs
MCSYM-DB/2_3/UCUUU/ds-2_3-UCUUU_x.pdb.gz
MCSYM-DB/2_3/UGAAA/
MCSYM-DB/2_3/UGAAA/2_3-UGAAA.mcs
MCSYM-DB/2_3/UGAAA/ds-2_3-UGAAA_x.pdb.gz
MCSYM-DB/2_3/UGAAC/
MCSYM-DB/2_3/UGAAC/2_3-UGAAC.mcs
MCSYM-DB/2_3/UGAAC/ds-2_3-UGAAC_x.pdb.gz
MCSYM-DB/2_3/UGAAG/
MCSYM-DB/2_3/UGAAG/2_3-UGAAG.mcs
MCSYM-DB/2_3/UGAAG/ds-2_3-UGAAG_x.pdb.gz
MCSYM-DB/2_3/UGAAU/
MCSYM-DB/2_3/UGAAU/2_3-UGAAU.mcs
MCSYM-DB/2_3/UGAAU/ds-2_3-UGAAU_x.pdb.gz
MCSYM-DB/2_3/UGACA/
MCSYM-DB/2_3/UGACA/2_3-UGACA.mcs
MCSYM-DB/2_3/UGACA/ds-2_3-UGACA_x.pdb.gz
MCSYM-DB/2_3/UGACC/
MCSYM-DB/2_3/UGACC/2_3-UGACC.mcs
MCSYM-DB/2_3/UGACC/ds-2_3-UGACC_x.pdb.gz
MCSYM-DB/2_3/UGACG/
MCSYM-DB/2_3/UGACG/2_3-UGACG.mcs
MCSYM-DB/2_3/UGACG/ds-2_3-UGACG_x.pdb.gz
MCSYM-DB/2_3/UGACU/
MCSYM-DB/2_3/UGACU/2_3-UGACU.mcs
MCSYM-DB/2_3/UGACU/ds-2_3-UGACU_x.pdb.gz
MCSYM-DB/2_3/UGAGA/
MCSYM-DB/2_3/UGAGA/1AM0_model_1.pdb.gz
MCSYM-DB/2_3/UGAGA/2_3-UGAGA.mcs
MCSYM-DB/2_3/UGAGA/ds-2_3-UGAGA_x.pdb.gz
MCSYM-DB/2_3/UGAGC/
MCSYM-DB/2_3/UGAGC/ds-2_3-UGAGC_x.pdb.gz
MCSYM-DB/2_3/UGAGG/
MCSYM-DB/2_3/UGAGG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UGAGG/2_3-UGAGG.mcs
MCSYM-DB/2_3/UGAGG/ds-2_3-UGAGG_x.pdb.gz
MCSYM-DB/2_3/UGAGU/
MCSYM-DB/2_3/UGAGU/2_3-UGAGU.mcs
MCSYM-DB/2_3/UGAGU/ds-2_3-UGAGU_x.pdb.gz
MCSYM-DB/2_3/UGAUA/
MCSYM-DB/2_3/UGAUA/2_3-UGAUA.mcs
MCSYM-DB/2_3/UGAUA/ds-2_3-UGAUA_x.pdb.gz
MCSYM-DB/2_3/UGAUC/
MCSYM-DB/2_3/UGAUC/2_3-UGAUC.mcs
MCSYM-DB/2_3/UGAUC/ds-2_3-UGAUC_x.pdb.gz
MCSYM-DB/2_3/UGAUG/
MCSYM-DB/2_3/UGAUG/2_3-UGAUG.mcs
MCSYM-DB/2_3/UGAUG/ds-2_3-UGAUG_x.pdb.gz
MCSYM-DB/2_3/UGAUU/
MCSYM-DB/2_3/UGAUU/2_3-UGAUU.mcs
MCSYM-DB/2_3/UGAUU/ds-2_3-UGAUU_x.pdb.gz
MCSYM-DB/2_3/UGCAA/
MCSYM-DB/2_3/UGCAA/1S03_model_1.pdb.gz
MCSYM-DB/2_3/UGCAA/2_3-UGCAA.mcs
MCSYM-DB/2_3/UGCAA/ds-2_3-UGCAA_x.pdb.gz
MCSYM-DB/2_3/UGCAC/
MCSYM-DB/2_3/UGCAC/2_3-UGCAC.mcs
MCSYM-DB/2_3/UGCAC/ds-2_3-UGCAC_x.pdb.gz
MCSYM-DB/2_3/UGCAG/
MCSYM-DB/2_3/UGCAG/2_3-UGCAG.mcs
MCSYM-DB/2_3/UGCAG/ds-2_3-UGCAG_x.pdb.gz
MCSYM-DB/2_3/UGCAU/
MCSYM-DB/2_3/UGCAU/2_3-UGCAU.mcs
MCSYM-DB/2_3/UGCAU/ds-2_3-UGCAU_x.pdb.gz
MCSYM-DB/2_3/UGCCA/
MCSYM-DB/2_3/UGCCA/1DDY_model_1.pdb.gz
MCSYM-DB/2_3/UGCCA/2_3-UGCCA.mcs
MCSYM-DB/2_3/UGCCA/ds-2_3-UGCCA_x.pdb.gz
MCSYM-DB/2_3/UGCCC/
MCSYM-DB/2_3/UGCCC/2_3-UGCCC.mcs
MCSYM-DB/2_3/UGCCC/ds-2_3-UGCCC_x.pdb.gz
MCSYM-DB/2_3/UGCCG/
MCSYM-DB/2_3/UGCCG/2_3-UGCCG.mcs
MCSYM-DB/2_3/UGCCG/ds-2_3-UGCCG_x.pdb.gz
MCSYM-DB/2_3/UGCCU/
MCSYM-DB/2_3/UGCCU/2_3-UGCCU.mcs
MCSYM-DB/2_3/UGCCU/ds-2_3-UGCCU_x.pdb.gz
MCSYM-DB/2_3/UGCGA/
MCSYM-DB/2_3/UGCGA/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/UGCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UGCGA/2_3-UGCGA.mcs
MCSYM-DB/2_3/UGCGA/ds-2_3-UGCGA_x.pdb.gz
MCSYM-DB/2_3/UGCGC/
MCSYM-DB/2_3/UGCGC/2_3-UGCGC.mcs
MCSYM-DB/2_3/UGCGC/ds-2_3-UGCGC_x.pdb.gz
MCSYM-DB/2_3/UGCGG/
MCSYM-DB/2_3/UGCGG/2_3-UGCGG.mcs
MCSYM-DB/2_3/UGCGG/ds-2_3-UGCGG_x.pdb.gz
MCSYM-DB/2_3/UGCGU/
MCSYM-DB/2_3/UGCGU/2_3-UGCGU.mcs
MCSYM-DB/2_3/UGCGU/ds-2_3-UGCGU_x.pdb.gz
MCSYM-DB/2_3/UGCUA/
MCSYM-DB/2_3/UGCUA/2_3-UGCUA.mcs
MCSYM-DB/2_3/UGCUA/ds-2_3-UGCUA_x.pdb.gz
MCSYM-DB/2_3/UGCUC/
MCSYM-DB/2_3/UGCUC/2_3-UGCUC.mcs
MCSYM-DB/2_3/UGCUC/ds-2_3-UGCUC_x.pdb.gz
MCSYM-DB/2_3/UGCUG/
MCSYM-DB/2_3/UGCUG/2_3-UGCUG.mcs
MCSYM-DB/2_3/UGCUG/ds-2_3-UGCUG_x.pdb.gz
MCSYM-DB/2_3/UGCUU/
MCSYM-DB/2_3/UGCUU/2_3-UGCUU.mcs
MCSYM-DB/2_3/UGCUU/ds-2_3-UGCUU_x.pdb.gz
MCSYM-DB/2_3/UGGAA/
MCSYM-DB/2_3/UGGAA/2_3-UGGAA.mcs
MCSYM-DB/2_3/UGGAA/ds-2_3-UGGAA_x.pdb.gz
MCSYM-DB/2_3/UGGAC/
MCSYM-DB/2_3/UGGAC/ds-2_3-UGGAC_x.pdb.gz
MCSYM-DB/2_3/UGGAG/
MCSYM-DB/2_3/UGGAG/2_3-UGGAG.mcs
MCSYM-DB/2_3/UGGAG/ds-2_3-UGGAG_x.pdb.gz
MCSYM-DB/2_3/UGGAU/
MCSYM-DB/2_3/UGGAU/2_3-UGGAU.mcs
MCSYM-DB/2_3/UGGAU/ds-2_3-UGGAU_x.pdb.gz
MCSYM-DB/2_3/UGGCA/
MCSYM-DB/2_3/UGGCA/2_3-UGGCA.mcs
MCSYM-DB/2_3/UGGCA/ds-2_3-UGGCA_x.pdb.gz
MCSYM-DB/2_3/UGGCC/
MCSYM-DB/2_3/UGGCC/2_3-UGGCC.mcs
MCSYM-DB/2_3/UGGCC/ds-2_3-UGGCC_x.pdb.gz
MCSYM-DB/2_3/UGGCG/
MCSYM-DB/2_3/UGGCG/2_3-UGGCG.mcs
MCSYM-DB/2_3/UGGCG/ds-2_3-UGGCG_x.pdb.gz
MCSYM-DB/2_3/UGGCU/
MCSYM-DB/2_3/UGGCU/2_3-UGGCU.mcs
MCSYM-DB/2_3/UGGCU/ds-2_3-UGGCU_x.pdb.gz
MCSYM-DB/2_3/UGGGA/
MCSYM-DB/2_3/UGGGA/2_3-UGGGA.mcs
MCSYM-DB/2_3/UGGGA/ds-2_3-UGGGA_x.pdb.gz
MCSYM-DB/2_3/UGGGC/
MCSYM-DB/2_3/UGGGC/2_3-UGGGC.mcs
MCSYM-DB/2_3/UGGGC/ds-2_3-UGGGC_x.pdb.gz
MCSYM-DB/2_3/UGGGG/
MCSYM-DB/2_3/UGGGG/2_3-UGGGG.mcs
MCSYM-DB/2_3/UGGGG/ds-2_3-UGGGG_x.pdb.gz
MCSYM-DB/2_3/UGGGU/
MCSYM-DB/2_3/UGGGU/2_3-UGGGU.mcs
MCSYM-DB/2_3/UGGGU/ds-2_3-UGGGU_x.pdb.gz
MCSYM-DB/2_3/UGGUA/
MCSYM-DB/2_3/UGGUA/2_3-UGGUA.mcs
MCSYM-DB/2_3/UGGUA/ds-2_3-UGGUA_x.pdb.gz
MCSYM-DB/2_3/UGGUC/
MCSYM-DB/2_3/UGGUC/2_3-UGGUC.mcs
MCSYM-DB/2_3/UGGUC/ds-2_3-UGGUC_x.pdb.gz
MCSYM-DB/2_3/UGGUG/
MCSYM-DB/2_3/UGGUG/2_3-UGGUG.mcs
MCSYM-DB/2_3/UGGUG/ds-2_3-UGGUG_x.pdb.gz
MCSYM-DB/2_3/UGGUU/
MCSYM-DB/2_3/UGGUU/2_3-UGGUU.mcs
MCSYM-DB/2_3/UGGUU/ds-2_3-UGGUU_x.pdb.gz
MCSYM-DB/2_3/UGUAA/
MCSYM-DB/2_3/UGUAA/1BGZ_model_1.pdb.gz
MCSYM-DB/2_3/UGUAA/1I6U_model_1.pdb.gz
MCSYM-DB/2_3/UGUAA/2_3-UGUAA.mcs
MCSYM-DB/2_3/UGUAA/ds-2_3-UGUAA_x.pdb.gz
MCSYM-DB/2_3/UGUAC/
MCSYM-DB/2_3/UGUAC/2_3-UGUAC.mcs
MCSYM-DB/2_3/UGUAC/ds-2_3-UGUAC_x.pdb.gz
MCSYM-DB/2_3/UGUAG/
MCSYM-DB/2_3/UGUAG/2_3-UGUAG.mcs
MCSYM-DB/2_3/UGUAG/ds-2_3-UGUAG_x.pdb.gz
MCSYM-DB/2_3/UGUAU/
MCSYM-DB/2_3/UGUAU/2_3-UGUAU.mcs
MCSYM-DB/2_3/UGUAU/ds-2_3-UGUAU_x.pdb.gz
MCSYM-DB/2_3/UGUCA/
MCSYM-DB/2_3/UGUCA/2_3-UGUCA.mcs
MCSYM-DB/2_3/UGUCA/ds-2_3-UGUCA_x.pdb.gz
MCSYM-DB/2_3/UGUCC/
MCSYM-DB/2_3/UGUCC/2_3-UGUCC.mcs
MCSYM-DB/2_3/UGUCC/ds-2_3-UGUCC_x.pdb.gz
MCSYM-DB/2_3/UGUCG/
MCSYM-DB/2_3/UGUCG/2_3-UGUCG.mcs
MCSYM-DB/2_3/UGUCG/ds-2_3-UGUCG_x.pdb.gz
MCSYM-DB/2_3/UGUCU/
MCSYM-DB/2_3/UGUCU/2_3-UGUCU.mcs
MCSYM-DB/2_3/UGUCU/ds-2_3-UGUCU_x.pdb.gz
MCSYM-DB/2_3/UGUGA/
MCSYM-DB/2_3/UGUGA/2_3-UGUGA.mcs
MCSYM-DB/2_3/UGUGA/ds-2_3-UGUGA_x.pdb.gz
MCSYM-DB/2_3/UGUGC/
MCSYM-DB/2_3/UGUGC/2_3-UGUGC.mcs
MCSYM-DB/2_3/UGUGC/ds-2_3-UGUGC_x.pdb.gz
MCSYM-DB/2_3/UGUGG/
MCSYM-DB/2_3/UGUGG/2_3-UGUGG.mcs
MCSYM-DB/2_3/UGUGG/ds-2_3-UGUGG_x.pdb.gz
MCSYM-DB/2_3/UGUGU/
MCSYM-DB/2_3/UGUGU/2_3-UGUGU.mcs
MCSYM-DB/2_3/UGUGU/ds-2_3-UGUGU_x.pdb.gz
MCSYM-DB/2_3/UGUUA/
MCSYM-DB/2_3/UGUUA/2_3-UGUUA.mcs
MCSYM-DB/2_3/UGUUA/ds-2_3-UGUUA_x.pdb.gz
MCSYM-DB/2_3/UGUUC/
MCSYM-DB/2_3/UGUUC/2_3-UGUUC.mcs
MCSYM-DB/2_3/UGUUC/ds-2_3-UGUUC_x.pdb.gz
MCSYM-DB/2_3/UGUUG/
MCSYM-DB/2_3/UGUUG/2_3-UGUUG.mcs
MCSYM-DB/2_3/UGUUG/ds-2_3-UGUUG_x.pdb.gz
MCSYM-DB/2_3/UGUUU/
MCSYM-DB/2_3/UGUUU/2_3-UGUUU.mcs
MCSYM-DB/2_3/UGUUU/ds-2_3-UGUUU_x.pdb.gz
MCSYM-DB/2_3/UUAA/
MCSYM-DB/2_3/UUAAA/
MCSYM-DB/2_3/UUAAA/2_3-UUAAA.mcs
MCSYM-DB/2_3/UUAAA/ds-2_3-UUAAA_x.pdb.gz
MCSYM-DB/2_3/UUAAC/
MCSYM-DB/2_3/UUAAC/2_3-UUAAC.mcs
MCSYM-DB/2_3/UUAAC/ds-2_3-UUAAC_x.pdb.gz
MCSYM-DB/2_3/UUAAG/
MCSYM-DB/2_3/UUAAG/2_3-UUAAG.mcs
MCSYM-DB/2_3/UUAAG/ds-2_3-UUAAG_x.pdb.gz
MCSYM-DB/2_3/UUAAU/
MCSYM-DB/2_3/UUAAU/2_3-UUAAU.mcs
MCSYM-DB/2_3/UUAAU/ds-2_3-UUAAU_x.pdb.gz
MCSYM-DB/2_3/UUACA/
MCSYM-DB/2_3/UUACA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UUACA/2_3-UUACA.mcs
MCSYM-DB/2_3/UUACA/ds-2_3-UUACA_x.pdb.gz
MCSYM-DB/2_3/UUACC/
MCSYM-DB/2_3/UUACC/2_3-UUACC.mcs
MCSYM-DB/2_3/UUACC/ds-2_3-UUACC_x.pdb.gz
MCSYM-DB/2_3/UUACG/
MCSYM-DB/2_3/UUACG/2_3-UUACG.mcs
MCSYM-DB/2_3/UUACG/ds-2_3-UUACG_x.pdb.gz
MCSYM-DB/2_3/UUACU/
MCSYM-DB/2_3/UUACU/2_3-UUACU.mcs
MCSYM-DB/2_3/UUACU/ds-2_3-UUACU_x.pdb.gz
MCSYM-DB/2_3/UUAGA/
MCSYM-DB/2_3/UUAGA/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/UUAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UUAGA/2_3-UUAGA.mcs
MCSYM-DB/2_3/UUAGA/ds-2_3-UUAGA_x.pdb.gz
MCSYM-DB/2_3/UUAGC/
MCSYM-DB/2_3/UUAGC/2_3-UUAGC.mcs
MCSYM-DB/2_3/UUAGC/ds-2_3-UUAGC_x.pdb.gz
MCSYM-DB/2_3/UUAGG/
MCSYM-DB/2_3/UUAGG/2_3-UUAGG.mcs
MCSYM-DB/2_3/UUAGG/ds-2_3-UUAGG_x.pdb.gz
MCSYM-DB/2_3/UUAGU/
MCSYM-DB/2_3/UUAGU/2_3-UUAGU.mcs
MCSYM-DB/2_3/UUAGU/ds-2_3-UUAGU_x.pdb.gz
MCSYM-DB/2_3/UUAUA/
MCSYM-DB/2_3/UUAUA/2_3-UUAUA.mcs
MCSYM-DB/2_3/UUAUA/ds-2_3-UUAUA_x.pdb.gz
MCSYM-DB/2_3/UUAUC/
MCSYM-DB/2_3/UUAUC/2_3-UUAUC.mcs
MCSYM-DB/2_3/UUAUC/ds-2_3-UUAUC_x.pdb.gz
MCSYM-DB/2_3/UUAUG/
MCSYM-DB/2_3/UUAUG/1FG0_model_1.pdb.gz
MCSYM-DB/2_3/UUAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_3/UUAUG/2_3-UUAUG.mcs
MCSYM-DB/2_3/UUAUG/ds-2_3-UUAUG_x.pdb.gz
MCSYM-DB/2_3/UUAUU/
MCSYM-DB/2_3/UUAUU/2_3-UUAUU.mcs
MCSYM-DB/2_3/UUAUU/ds-2_3-UUAUU_x.pdb.gz
MCSYM-DB/2_3/UUCAA/
MCSYM-DB/2_3/UUCAA/2_3-UUCAA.mcs
MCSYM-DB/2_3/UUCAA/ds-2_3-UUCAA_x.pdb.gz
MCSYM-DB/2_3/UUCAC/
MCSYM-DB/2_3/UUCAC/2_3-UUCAC.mcs
MCSYM-DB/2_3/UUCAC/ds-2_3-UUCAC_x.pdb.gz
MCSYM-DB/2_3/UUCAG/
MCSYM-DB/2_3/UUCAG/2_3-UUCAG.mcs
MCSYM-DB/2_3/UUCAG/ds-2_3-UUCAG_x.pdb.gz
MCSYM-DB/2_3/UUCAU/
MCSYM-DB/2_3/UUCAU/2_3-UUCAU.mcs
MCSYM-DB/2_3/UUCAU/ds-2_3-UUCAU_x.pdb.gz
MCSYM-DB/2_3/UUCCA/
MCSYM-DB/2_3/UUCCA/2_3-UUCCA.mcs
MCSYM-DB/2_3/UUCCA/ds-2_3-UUCCA_x.pdb.gz
MCSYM-DB/2_3/UUCCC/
MCSYM-DB/2_3/UUCCC/2_3-UUCCC.mcs
MCSYM-DB/2_3/UUCCC/ds-2_3-UUCCC_x.pdb.gz
MCSYM-DB/2_3/UUCCG/
MCSYM-DB/2_3/UUCCG/2_3-UUCCG.mcs
MCSYM-DB/2_3/UUCCG/ds-2_3-UUCCG_x.pdb.gz
MCSYM-DB/2_3/UUCCU/
MCSYM-DB/2_3/UUCCU/2_3-UUCCU.mcs
MCSYM-DB/2_3/UUCCU/ds-2_3-UUCCU_x.pdb.gz
MCSYM-DB/2_3/UUCGA/
MCSYM-DB/2_3/UUCGA/2_3-UUCGA.mcs
MCSYM-DB/2_3/UUCGA/ds-2_3-UUCGA_x.pdb.gz
MCSYM-DB/2_3/UUCGC/
MCSYM-DB/2_3/UUCGC/ds-2_3-UUCGC_x.pdb.gz
MCSYM-DB/2_3/UUCGG/
MCSYM-DB/2_3/UUCGG/2_3-UUCGG.mcs
MCSYM-DB/2_3/UUCGG/ds-2_3-UUCGG_x.pdb.gz
MCSYM-DB/2_3/UUCGU/
MCSYM-DB/2_3/UUCGU/2_3-UUCGU.mcs
MCSYM-DB/2_3/UUCGU/ds-2_3-UUCGU_x.pdb.gz
MCSYM-DB/2_3/UUCUA/
MCSYM-DB/2_3/UUCUA/2_3-UUCUA.mcs
MCSYM-DB/2_3/UUCUA/ds-2_3-UUCUA_x.pdb.gz
MCSYM-DB/2_3/UUCUC/
MCSYM-DB/2_3/UUCUC/ds-2_3-UUCUC_x.pdb.gz
MCSYM-DB/2_3/UUCUG/
MCSYM-DB/2_3/UUCUG/2_3-UUCUG.mcs
MCSYM-DB/2_3/UUCUG/ds-2_3-UUCUG_x.pdb.gz
MCSYM-DB/2_3/UUCUU/
MCSYM-DB/2_3/UUCUU/2_3-UUCUU.mcs
MCSYM-DB/2_3/UUCUU/ds-2_3-UUCUU_x.pdb.gz
MCSYM-DB/2_3/UUGAA/
MCSYM-DB/2_3/UUGAA/2_3-UUGAA.mcs
MCSYM-DB/2_3/UUGAA/ds-2_3-UUGAA_x.pdb.gz
MCSYM-DB/2_3/UUGAC/
MCSYM-DB/2_3/UUGAC/2_3-UUGAC.mcs
MCSYM-DB/2_3/UUGAC/ds-2_3-UUGAC_x.pdb.gz
MCSYM-DB/2_3/UUGAG/
MCSYM-DB/2_3/UUGAG/2_3-UUGAG.mcs
MCSYM-DB/2_3/UUGAG/ds-2_3-UUGAG_x.pdb.gz
MCSYM-DB/2_3/UUGAU/
MCSYM-DB/2_3/UUGAU/2_3-UUGAU.mcs
MCSYM-DB/2_3/UUGAU/ds-2_3-UUGAU_x.pdb.gz
MCSYM-DB/2_3/UUGCA/
MCSYM-DB/2_3/UUGCA/2_3-UUGCA.mcs
MCSYM-DB/2_3/UUGCA/ds-2_3-UUGCA_x.pdb.gz
MCSYM-DB/2_3/UUGCC/
MCSYM-DB/2_3/UUGCC/2_3-UUGCC.mcs
MCSYM-DB/2_3/UUGCC/ds-2_3-UUGCC_x.pdb.gz
MCSYM-DB/2_3/UUGCG/
MCSYM-DB/2_3/UUGCG/2_3-UUGCG.mcs
MCSYM-DB/2_3/UUGCG/ds-2_3-UUGCG_x.pdb.gz
MCSYM-DB/2_3/UUGCU/
MCSYM-DB/2_3/UUGCU/2_3-UUGCU.mcs
MCSYM-DB/2_3/UUGCU/ds-2_3-UUGCU_x.pdb.gz
MCSYM-DB/2_3/UUGGA/
MCSYM-DB/2_3/UUGGA/2_3-UUGGA.mcs
MCSYM-DB/2_3/UUGGA/ds-2_3-UUGGA_x.pdb.gz
MCSYM-DB/2_3/UUGGC/
MCSYM-DB/2_3/UUGGC/ds-2_3-UUGGC_x.pdb.gz
MCSYM-DB/2_3/UUGGG/
MCSYM-DB/2_3/UUGGG/2_3-UUGGG.mcs
MCSYM-DB/2_3/UUGGG/ds-2_3-UUGGG_x.pdb.gz
MCSYM-DB/2_3/UUGGU/
MCSYM-DB/2_3/UUGGU/2_3-UUGGU.mcs
MCSYM-DB/2_3/UUGGU/ds-2_3-UUGGU_x.pdb.gz
MCSYM-DB/2_3/UUGUA/
MCSYM-DB/2_3/UUGUA/2_3-UUGUA.mcs
MCSYM-DB/2_3/UUGUA/ds-2_3-UUGUA_x.pdb.gz
MCSYM-DB/2_3/UUGUC/
MCSYM-DB/2_3/UUGUC/2_3-UUGUC.mcs
MCSYM-DB/2_3/UUGUC/ds-2_3-UUGUC_x.pdb.gz
MCSYM-DB/2_3/UUGUG/
MCSYM-DB/2_3/UUGUG/2_3-UUGUG.mcs
MCSYM-DB/2_3/UUGUG/ds-2_3-UUGUG_x.pdb.gz
MCSYM-DB/2_3/UUGUU/
MCSYM-DB/2_3/UUGUU/2_3-UUGUU.mcs
MCSYM-DB/2_3/UUGUU/ds-2_3-UUGUU_x.pdb.gz
MCSYM-DB/2_3/UUUAA/
MCSYM-DB/2_3/UUUAA/2_3-UUUAA.mcs
MCSYM-DB/2_3/UUUAA/ds-2_3-UUUAA_x.pdb.gz
MCSYM-DB/2_3/UUUAC/
MCSYM-DB/2_3/UUUAC/2_3-UUUAC.mcs
MCSYM-DB/2_3/UUUAC/ds-2_3-UUUAC_x.pdb.gz
MCSYM-DB/2_3/UUUAG/
MCSYM-DB/2_3/UUUAG/2_3-UUUAG.mcs
MCSYM-DB/2_3/UUUAG/ds-2_3-UUUAG_x.pdb.gz
MCSYM-DB/2_3/UUUAU/
MCSYM-DB/2_3/UUUAU/2_3-UUUAU.mcs
MCSYM-DB/2_3/UUUAU/ds-2_3-UUUAU_x.pdb.gz
MCSYM-DB/2_3/UUUCA/
MCSYM-DB/2_3/UUUCA/2_3-UUUCA.mcs
MCSYM-DB/2_3/UUUCA/ds-2_3-UUUCA_x.pdb.gz
MCSYM-DB/2_3/UUUCC/
MCSYM-DB/2_3/UUUCC/2_3-UUUCC.mcs
MCSYM-DB/2_3/UUUCC/ds-2_3-UUUCC_x.pdb.gz
MCSYM-DB/2_3/UUUCG/
MCSYM-DB/2_3/UUUCG/2_3-UUUCG.mcs
MCSYM-DB/2_3/UUUCG/ds-2_3-UUUCG_x.pdb.gz
MCSYM-DB/2_3/UUUCU/
MCSYM-DB/2_3/UUUCU/2_3-UUUCU.mcs
MCSYM-DB/2_3/UUUCU/ds-2_3-UUUCU_x.pdb.gz
MCSYM-DB/2_3/UUUGA/
MCSYM-DB/2_3/UUUGA/2_3-UUUGA.mcs
MCSYM-DB/2_3/UUUGA/ds-2_3-UUUGA_x.pdb.gz
MCSYM-DB/2_3/UUUGC/
MCSYM-DB/2_3/UUUGC/2_3-UUUGC.mcs
MCSYM-DB/2_3/UUUGC/ds-2_3-UUUGC_x.pdb.gz
MCSYM-DB/2_3/UUUGG/
MCSYM-DB/2_3/UUUGG/2_3-UUUGG.mcs
MCSYM-DB/2_3/UUUGG/ds-2_3-UUUGG_x.pdb.gz
MCSYM-DB/2_3/UUUGU/
MCSYM-DB/2_3/UUUGU/2_3-UUUGU.mcs
MCSYM-DB/2_3/UUUGU/ds-2_3-UUUGU_x.pdb.gz
MCSYM-DB/2_3/UUUUA/
MCSYM-DB/2_3/UUUUA/2_3-UUUUA.mcs
MCSYM-DB/2_3/UUUUA/ds-2_3-UUUUA_x.pdb.gz
MCSYM-DB/2_3/UUUUC/
MCSYM-DB/2_3/UUUUC/2_3-UUUUC.mcs
MCSYM-DB/2_3/UUUUC/ds-2_3-UUUUC_x.pdb.gz
MCSYM-DB/2_3/UUUUG/
MCSYM-DB/2_3/UUUUG/2_3-UUUUG.mcs
MCSYM-DB/2_3/UUUUG/ds-2_3-UUUUG_x.pdb.gz
MCSYM-DB/2_3/UUUUU/
MCSYM-DB/2_3/UUUUU/2_3-UUUUU.mcs
MCSYM-DB/2_3/UUUUU/ds-2_3-UUUUU_x.pdb.gz
MCSYM-DB/2_3/2_3.stats
MCSYM-DB/2_3/make_2_3.bat
MCSYM-DB/2_3/make_2_3.mut.bat
MCSYM-DB/2_4/
MCSYM-DB/2_4/AAAAAA/
MCSYM-DB/2_4/AAAAAA/2_4-AAAAAA.mcs
MCSYM-DB/2_4/AAAAAA/ds-2_4-AAAAAA_x.pdb.gz
MCSYM-DB/2_4/AAAAAG/
MCSYM-DB/2_4/AAAAAG/2_4-AAAAAG.mcs
MCSYM-DB/2_4/AAAAAG/ds-2_4-AAAAAG_x.pdb.gz
MCSYM-DB/2_4/AAAAAU/
MCSYM-DB/2_4/AAAAAU/2_4-AAAAAU.mcs
MCSYM-DB/2_4/AAAAAU/ds-2_4-AAAAAU_x.pdb.gz
MCSYM-DB/2_4/AAAACC/
MCSYM-DB/2_4/AAAACC/2_4-AAAACC.mcs
MCSYM-DB/2_4/AAAACU/
MCSYM-DB/2_4/AAAACU/2_4-AAAACU.mcs
MCSYM-DB/2_4/AAAACU/ds-2_4-AAAACU_x.pdb.gz
MCSYM-DB/2_4/AAAAGA/
MCSYM-DB/2_4/AAAAGA/2_4-AAAAGA.mcs
MCSYM-DB/2_4/AAAAGA/ds-2_4-AAAAGA_x.pdb.gz
MCSYM-DB/2_4/AAAAUG/
MCSYM-DB/2_4/AAAAUG/2_4-AAAAUG.mcs
MCSYM-DB/2_4/AAAAUG/ds-2_4-AAAAUG_x.pdb.gz
MCSYM-DB/2_4/AAACAC/
MCSYM-DB/2_4/AAACAC/2_4-AAACAC.mcs
MCSYM-DB/2_4/AAACAC/ds-2_4-AAACAC_x.pdb.gz
MCSYM-DB/2_4/AAACAU/
MCSYM-DB/2_4/AAACAU/2_4-AAACAU.mcs
MCSYM-DB/2_4/AAACCA/
MCSYM-DB/2_4/AAACCA/2_4-AAACCA.mcs
MCSYM-DB/2_4/AAACCA/ds-2_4-AAACCA_x.pdb.gz
MCSYM-DB/2_4/AAACCU/
MCSYM-DB/2_4/AAACCU/2_4-AAACCU.mcs
MCSYM-DB/2_4/AAACCU/ds-2_4-AAACCU_x.pdb.gz
MCSYM-DB/2_4/AAACGG/
MCSYM-DB/2_4/AAACGG/2_4-AAACGG.mcs
MCSYM-DB/2_4/AAAGAA/
MCSYM-DB/2_4/AAAGAA/2_4-AAAGAA.mcs
MCSYM-DB/2_4/AAAGAA/ds-2_4-AAAGAA_x.pdb.gz
MCSYM-DB/2_4/AAAGCU/
MCSYM-DB/2_4/AAAGCU/2_4-AAAGCU.mcs
MCSYM-DB/2_4/AAAGCU/ds-2_4-AAAGCU_x.pdb.gz
MCSYM-DB/2_4/AAAGGA/
MCSYM-DB/2_4/AAAGGA/2_4-AAAGGA.mcs
MCSYM-DB/2_4/AAAGGA/ds-2_4-AAAGGA_x.pdb.gz
MCSYM-DB/2_4/AAAGUU/
MCSYM-DB/2_4/AAAGUU/2_4-AAAGUU.mcs
MCSYM-DB/2_4/AAAUAU/
MCSYM-DB/2_4/AAAUAU/2_4-AAAUAU.mcs
MCSYM-DB/2_4/AAAUAU/ds-2_4-AAAUAU_x.pdb.gz
MCSYM-DB/2_4/AAAUGU/
MCSYM-DB/2_4/AAAUGU/2_4-AAAUGU.mcs
MCSYM-DB/2_4/AAAUGU/ds-2_4-AAAUGU_x.pdb.gz
MCSYM-DB/2_4/AAAUUU/
MCSYM-DB/2_4/AAAUUU/2_4-AAAUUU.mcs
MCSYM-DB/2_4/AACAAA/
MCSYM-DB/2_4/AACAAA/2_4-AACAAA.mcs
MCSYM-DB/2_4/AACAAC/
MCSYM-DB/2_4/AACAAC/2_4-AACAAC.mcs
MCSYM-DB/2_4/AACAAU/
MCSYM-DB/2_4/AACAAU/2_4-AACAAU.mcs
MCSYM-DB/2_4/AACACU/
MCSYM-DB/2_4/AACACU/2_4-AACACU.mcs
MCSYM-DB/2_4/AACACU/ds-2_4-AACACU_x.pdb.gz
MCSYM-DB/2_4/AACAGC/
MCSYM-DB/2_4/AACAGC/2_4-AACAGC.mcs
MCSYM-DB/2_4/AACAGC/ds-2_4-AACAGC_x.pdb.gz
MCSYM-DB/2_4/AACAUA/
MCSYM-DB/2_4/AACAUA/2_4-AACAUA.mcs
MCSYM-DB/2_4/AACAUC/
MCSYM-DB/2_4/AACAUC/2_4-AACAUC.mcs
MCSYM-DB/2_4/AACAUC/ds-2_4-AACAUC_x.pdb.gz
MCSYM-DB/2_4/AACAUU/
MCSYM-DB/2_4/AACAUU/2_4-AACAUU.mcs
MCSYM-DB/2_4/AACCAG/
MCSYM-DB/2_4/AACCAG/2_4-AACCAG.mcs
MCSYM-DB/2_4/AACCAG/ds-2_4-AACCAG_x.pdb.gz
MCSYM-DB/2_4/AACCCA/
MCSYM-DB/2_4/AACCCA/2_4-AACCCA.mcs
MCSYM-DB/2_4/AACCCA/ds-2_4-AACCCA_x.pdb.gz
MCSYM-DB/2_4/AACCCC/
MCSYM-DB/2_4/AACCCC/2_4-AACCCC.mcs
MCSYM-DB/2_4/AACCCU/
MCSYM-DB/2_4/AACCCU/2_4-AACCCU.mcs
MCSYM-DB/2_4/AACCGU/
MCSYM-DB/2_4/AACCGU/2_4-AACCGU.mcs
MCSYM-DB/2_4/AACCGU/ds-2_4-AACCGU_x.pdb.gz
MCSYM-DB/2_4/AACCUU/
MCSYM-DB/2_4/AACCUU/2_4-AACCUU.mcs
MCSYM-DB/2_4/AACGAA/
MCSYM-DB/2_4/AACGAA/2_4-AACGAA.mcs
MCSYM-DB/2_4/AACGAA/ds-2_4-AACGAA_x.pdb.gz
MCSYM-DB/2_4/AACGGG/
MCSYM-DB/2_4/AACGGG/2_4-AACGGG.mcs
MCSYM-DB/2_4/AACGGG/ds-2_4-AACGGG_x.pdb.gz
MCSYM-DB/2_4/AACUCU/
MCSYM-DB/2_4/AACUCU/2_4-AACUCU.mcs
MCSYM-DB/2_4/AACUCU/ds-2_4-AACUCU_x.pdb.gz
MCSYM-DB/2_4/AACUUG/
MCSYM-DB/2_4/AACUUG/2_4-AACUUG.mcs
MCSYM-DB/2_4/AACUUG/ds-2_4-AACUUG_x.pdb.gz
MCSYM-DB/2_4/AAGAAA/
MCSYM-DB/2_4/AAGAAA/2_4-AAGAAA.mcs
MCSYM-DB/2_4/AAGAAA/ds-2_4-AAGAAA_x.pdb.gz
MCSYM-DB/2_4/AAGAAG/
MCSYM-DB/2_4/AAGAAG/2_4-AAGAAG.mcs
MCSYM-DB/2_4/AAGAAU/
MCSYM-DB/2_4/AAGAAU/2_4-AAGAAU.mcs
MCSYM-DB/2_4/AAGAAU/ds-2_4-AAGAAU_x.pdb.gz
MCSYM-DB/2_4/AAGACA/
MCSYM-DB/2_4/AAGACA/2_4-AAGACA.mcs
MCSYM-DB/2_4/AAGACA/ds-2_4-AAGACA_x.pdb.gz
MCSYM-DB/2_4/AAGAGA/
MCSYM-DB/2_4/AAGAGA/2_4-AAGAGA.mcs
MCSYM-DB/2_4/AAGAGA/ds-2_4-AAGAGA_x.pdb.gz
MCSYM-DB/2_4/AAGAGC/
MCSYM-DB/2_4/AAGAGC/2_4-AAGAGC.mcs
MCSYM-DB/2_4/AAGAGC/ds-2_4-AAGAGC_x.pdb.gz
MCSYM-DB/2_4/AAGAGG/
MCSYM-DB/2_4/AAGAGG/2_4-AAGAGG.mcs
MCSYM-DB/2_4/AAGAGG/ds-2_4-AAGAGG_x.pdb.gz
MCSYM-DB/2_4/AAGCAA/
MCSYM-DB/2_4/AAGCAA/2_4-AAGCAA.mcs
MCSYM-DB/2_4/AAGCAA/ds-2_4-AAGCAA_x.pdb.gz
MCSYM-DB/2_4/AAGCAU/
MCSYM-DB/2_4/AAGCAU/2_4-AAGCAU.mcs
MCSYM-DB/2_4/AAGCAU/ds-2_4-AAGCAU_x.pdb.gz
MCSYM-DB/2_4/AAGCCU/
MCSYM-DB/2_4/AAGCCU/2_4-AAGCCU.mcs
MCSYM-DB/2_4/AAGCCU/ds-2_4-AAGCCU_x.pdb.gz
MCSYM-DB/2_4/AAGCGA/
MCSYM-DB/2_4/AAGCGA/2_4-AAGCGA.mcs
MCSYM-DB/2_4/AAGCGA/ds-2_4-AAGCGA_x.pdb.gz
MCSYM-DB/2_4/AAGGAA/
MCSYM-DB/2_4/AAGGAA/2_4-AAGGAA.mcs
MCSYM-DB/2_4/AAGGAA/ds-2_4-AAGGAA_x.pdb.gz
MCSYM-DB/2_4/AAGGAG/
MCSYM-DB/2_4/AAGGAG/2_4-AAGGAG.mcs
MCSYM-DB/2_4/AAGGAG/ds-2_4-AAGGAG_x.pdb.gz
MCSYM-DB/2_4/AAGGCC/
MCSYM-DB/2_4/AAGGCC/2_4-AAGGCC.mcs
MCSYM-DB/2_4/AAGGCC/ds-2_4-AAGGCC_x.pdb.gz
MCSYM-DB/2_4/AAGGUG/
MCSYM-DB/2_4/AAGGUG/2_4-AAGGUG.mcs
MCSYM-DB/2_4/AAGUAU/
MCSYM-DB/2_4/AAGUAU/2_4-AAGUAU.mcs
MCSYM-DB/2_4/AAGUAU/ds-2_4-AAGUAU_x.pdb.gz
MCSYM-DB/2_4/AAGUCU/
MCSYM-DB/2_4/AAGUCU/2_4-AAGUCU.mcs
MCSYM-DB/2_4/AAGUGU/
MCSYM-DB/2_4/AAGUGU/2_4-AAGUGU.mcs
MCSYM-DB/2_4/AAGUUC/
MCSYM-DB/2_4/AAGUUC/2_4-AAGUUC.mcs
MCSYM-DB/2_4/AAGUUC/ds-2_4-AAGUUC_x.pdb.gz
MCSYM-DB/2_4/AAGUUU/
MCSYM-DB/2_4/AAGUUU/2_4-AAGUUU.mcs
MCSYM-DB/2_4/AAUAAA/
MCSYM-DB/2_4/AAUAAA/2_4-AAUAAA.mcs
MCSYM-DB/2_4/AAUAAA/ds-2_4-AAUAAA_x.pdb.gz
MCSYM-DB/2_4/AAUAAG/
MCSYM-DB/2_4/AAUAAG/2_4-AAUAAG.mcs
MCSYM-DB/2_4/AAUAAG/ds-2_4-AAUAAG_x.pdb.gz
MCSYM-DB/2_4/AAUAAU/
MCSYM-DB/2_4/AAUAAU/2_4-AAUAAU.mcs
MCSYM-DB/2_4/AAUAAU/ds-2_4-AAUAAU_x.pdb.gz
MCSYM-DB/2_4/AAUACU/
MCSYM-DB/2_4/AAUACU/2_4-AAUACU.mcs
MCSYM-DB/2_4/AAUACU/ds-2_4-AAUACU_x.pdb.gz
MCSYM-DB/2_4/AAUAGC/
MCSYM-DB/2_4/AAUAGC/2_4-AAUAGC.mcs
MCSYM-DB/2_4/AAUAGU/
MCSYM-DB/2_4/AAUAGU/2_4-AAUAGU.mcs
MCSYM-DB/2_4/AAUAGU/ds-2_4-AAUAGU_x.pdb.gz
MCSYM-DB/2_4/AAUAUG/
MCSYM-DB/2_4/AAUAUG/2_4-AAUAUG.mcs
MCSYM-DB/2_4/AAUAUG/ds-2_4-AAUAUG_x.pdb.gz
MCSYM-DB/2_4/AAUAUU/
MCSYM-DB/2_4/AAUAUU/2_4-AAUAUU.mcs
MCSYM-DB/2_4/AAUAUU/ds-2_4-AAUAUU_x.pdb.gz
MCSYM-DB/2_4/AAUCAA/
MCSYM-DB/2_4/AAUCAA/2_4-AAUCAA.mcs
MCSYM-DB/2_4/AAUCAA/ds-2_4-AAUCAA_x.pdb.gz
MCSYM-DB/2_4/AAUCAC/
MCSYM-DB/2_4/AAUCAC/2_4-AAUCAC.mcs
MCSYM-DB/2_4/AAUCAC/ds-2_4-AAUCAC_x.pdb.gz
MCSYM-DB/2_4/AAUCAG/
MCSYM-DB/2_4/AAUCAG/2_4-AAUCAG.mcs
MCSYM-DB/2_4/AAUCAG/ds-2_4-AAUCAG_x.pdb.gz
MCSYM-DB/2_4/AAUCAU/
MCSYM-DB/2_4/AAUCAU/2_4-AAUCAU.mcs
MCSYM-DB/2_4/AAUCAU/ds-2_4-AAUCAU_x.pdb.gz
MCSYM-DB/2_4/AAUCCC/
MCSYM-DB/2_4/AAUCCC/2_4-AAUCCC.mcs
MCSYM-DB/2_4/AAUCCU/
MCSYM-DB/2_4/AAUCCU/2_4-AAUCCU.mcs
MCSYM-DB/2_4/AAUCCU/ds-2_4-AAUCCU_x.pdb.gz
MCSYM-DB/2_4/AAUCGA/
MCSYM-DB/2_4/AAUCGA/2_4-AAUCGA.mcs
MCSYM-DB/2_4/AAUCGU/
MCSYM-DB/2_4/AAUCGU/2_4-AAUCGU.mcs
MCSYM-DB/2_4/AAUCGU/ds-2_4-AAUCGU_x.pdb.gz
MCSYM-DB/2_4/AAUCUA/
MCSYM-DB/2_4/AAUCUA/2_4-AAUCUA.mcs
MCSYM-DB/2_4/AAUCUA/ds-2_4-AAUCUA_x.pdb.gz
MCSYM-DB/2_4/AAUCUG/
MCSYM-DB/2_4/AAUCUG/2_4-AAUCUG.mcs
MCSYM-DB/2_4/AAUCUG/ds-2_4-AAUCUG_x.pdb.gz
MCSYM-DB/2_4/AAUCUU/
MCSYM-DB/2_4/AAUCUU/2_4-AAUCUU.mcs
MCSYM-DB/2_4/AAUCUU/ds-2_4-AAUCUU_x.pdb.gz
MCSYM-DB/2_4/AAUGAA/
MCSYM-DB/2_4/AAUGAA/2_4-AAUGAA.mcs
MCSYM-DB/2_4/AAUGAA/ds-2_4-AAUGAA_x.pdb.gz
MCSYM-DB/2_4/AAUGAC/
MCSYM-DB/2_4/AAUGAC/2_4-AAUGAC.mcs
MCSYM-DB/2_4/AAUGAG/
MCSYM-DB/2_4/AAUGAG/2_4-AAUGAG.mcs
MCSYM-DB/2_4/AAUGAG/ds-2_4-AAUGAG_x.pdb.gz
MCSYM-DB/2_4/AAUGAU/
MCSYM-DB/2_4/AAUGAU/2_4-AAUGAU.mcs
MCSYM-DB/2_4/AAUGAU/ds-2_4-AAUGAU_x.pdb.gz
MCSYM-DB/2_4/AAUGCA/
MCSYM-DB/2_4/AAUGCA/2_4-AAUGCA.mcs
MCSYM-DB/2_4/AAUGCC/
MCSYM-DB/2_4/AAUGCC/2_4-AAUGCC.mcs
MCSYM-DB/2_4/AAUGCG/
MCSYM-DB/2_4/AAUGCG/2_4-AAUGCG.mcs
MCSYM-DB/2_4/AAUGCG/ds-2_4-AAUGCG_x.pdb.gz
MCSYM-DB/2_4/AAUGCU/
MCSYM-DB/2_4/AAUGCU/1XOK_model_1.pdb.gz
MCSYM-DB/2_4/AAUGCU/2_4-AAUGCU.mcs
MCSYM-DB/2_4/AAUGCU/ds-2_4-AAUGCU_x.pdb.gz
MCSYM-DB/2_4/AAUGGA/
MCSYM-DB/2_4/AAUGGA/2_4-AAUGGA.mcs
MCSYM-DB/2_4/AAUGGA/ds-2_4-AAUGGA_x.pdb.gz
MCSYM-DB/2_4/AAUGGG/
MCSYM-DB/2_4/AAUGGG/2_4-AAUGGG.mcs
MCSYM-DB/2_4/AAUGGG/ds-2_4-AAUGGG_x.pdb.gz
MCSYM-DB/2_4/AAUGGU/
MCSYM-DB/2_4/AAUGGU/2_4-AAUGGU.mcs
MCSYM-DB/2_4/AAUGGU/ds-2_4-AAUGGU_x.pdb.gz
MCSYM-DB/2_4/AAUGUC/
MCSYM-DB/2_4/AAUGUC/2_4-AAUGUC.mcs
MCSYM-DB/2_4/AAUGUU/
MCSYM-DB/2_4/AAUGUU/2_4-AAUGUU.mcs
MCSYM-DB/2_4/AAUGUU/ds-2_4-AAUGUU_x.pdb.gz
MCSYM-DB/2_4/AAUUAG/
MCSYM-DB/2_4/AAUUAG/2_4-AAUUAG.mcs
MCSYM-DB/2_4/AAUUAU/
MCSYM-DB/2_4/AAUUAU/2_4-AAUUAU.mcs
MCSYM-DB/2_4/AAUUAU/ds-2_4-AAUUAU_x.pdb.gz
MCSYM-DB/2_4/AAUUCA/
MCSYM-DB/2_4/AAUUCA/2_4-AAUUCA.mcs
MCSYM-DB/2_4/AAUUCA/ds-2_4-AAUUCA_x.pdb.gz
MCSYM-DB/2_4/AAUUCU/
MCSYM-DB/2_4/AAUUCU/2_4-AAUUCU.mcs
MCSYM-DB/2_4/AAUUCU/ds-2_4-AAUUCU_x.pdb.gz
MCSYM-DB/2_4/AAUUGC/
MCSYM-DB/2_4/AAUUGC/2_4-AAUUGC.mcs
MCSYM-DB/2_4/AAUUGG/
MCSYM-DB/2_4/AAUUGG/2_4-AAUUGG.mcs
MCSYM-DB/2_4/AAUUGU/
MCSYM-DB/2_4/AAUUGU/2_4-AAUUGU.mcs
MCSYM-DB/2_4/AAUUGU/ds-2_4-AAUUGU_x.pdb.gz
MCSYM-DB/2_4/AAUUUC/
MCSYM-DB/2_4/AAUUUC/2_4-AAUUUC.mcs
MCSYM-DB/2_4/AAUUUU/
MCSYM-DB/2_4/AAUUUU/2_4-AAUUUU.mcs
MCSYM-DB/2_4/AAUUUU/ds-2_4-AAUUUU_x.pdb.gz
MCSYM-DB/2_4/ACAACA/
MCSYM-DB/2_4/ACAACA/2_4-ACAACA.mcs
MCSYM-DB/2_4/ACAAGU/
MCSYM-DB/2_4/ACAAGU/2_4-ACAAGU.mcs
MCSYM-DB/2_4/ACAAUC/
MCSYM-DB/2_4/ACAAUC/2_4-ACAAUC.mcs
MCSYM-DB/2_4/ACAAUU/
MCSYM-DB/2_4/ACAAUU/2_4-ACAAUU.mcs
MCSYM-DB/2_4/ACAAUU/ds-2_4-ACAAUU_x.pdb.gz
MCSYM-DB/2_4/ACACAU/
MCSYM-DB/2_4/ACACAU/2_4-ACACAU.mcs
MCSYM-DB/2_4/ACACCA/
MCSYM-DB/2_4/ACACCA/2_4-ACACCA.mcs
MCSYM-DB/2_4/ACACCC/
MCSYM-DB/2_4/ACACCC/2_4-ACACCC.mcs
MCSYM-DB/2_4/ACACCU/
MCSYM-DB/2_4/ACACCU/2_4-ACACCU.mcs
MCSYM-DB/2_4/ACACCU/ds-2_4-ACACCU_x.pdb.gz
MCSYM-DB/2_4/ACACUU/
MCSYM-DB/2_4/ACACUU/2_4-ACACUU.mcs
MCSYM-DB/2_4/ACAGAG/
MCSYM-DB/2_4/ACAGAG/2_4-ACAGAG.mcs
MCSYM-DB/2_4/ACAGAG/ds-2_4-ACAGAG_x.pdb.gz
MCSYM-DB/2_4/ACAGGA/
MCSYM-DB/2_4/ACAGGA/2_4-ACAGGA.mcs
MCSYM-DB/2_4/ACAGGA/ds-2_4-ACAGGA_x.pdb.gz
MCSYM-DB/2_4/ACAGUU/
MCSYM-DB/2_4/ACAGUU/2_4-ACAGUU.mcs
MCSYM-DB/2_4/ACAUAU/
MCSYM-DB/2_4/ACAUAU/2_4-ACAUAU.mcs
MCSYM-DB/2_4/ACAUUU/
MCSYM-DB/2_4/ACAUUU/2_4-ACAUUU.mcs
MCSYM-DB/2_4/ACAUUU/ds-2_4-ACAUUU_x.pdb.gz
MCSYM-DB/2_4/ACCAAA/
MCSYM-DB/2_4/ACCAAA/2_4-ACCAAA.mcs
MCSYM-DB/2_4/ACCAAA/ds-2_4-ACCAAA_x.pdb.gz
MCSYM-DB/2_4/ACCAAU/
MCSYM-DB/2_4/ACCAAU/2_4-ACCAAU.mcs
MCSYM-DB/2_4/ACCAAU/ds-2_4-ACCAAU_x.pdb.gz
MCSYM-DB/2_4/ACCAUU/
MCSYM-DB/2_4/ACCAUU/2_4-ACCAUU.mcs
MCSYM-DB/2_4/ACCAUU/ds-2_4-ACCAUU_x.pdb.gz
MCSYM-DB/2_4/ACCCAU/
MCSYM-DB/2_4/ACCCAU/2_4-ACCCAU.mcs
MCSYM-DB/2_4/ACCCAU/ds-2_4-ACCCAU_x.pdb.gz
MCSYM-DB/2_4/ACCCCA/
MCSYM-DB/2_4/ACCCCA/2_4-ACCCCA.mcs
MCSYM-DB/2_4/ACCCCA/ds-2_4-ACCCCA_x.pdb.gz
MCSYM-DB/2_4/ACCCUC/
MCSYM-DB/2_4/ACCCUC/2_4-ACCCUC.mcs
MCSYM-DB/2_4/ACCCUU/
MCSYM-DB/2_4/ACCCUU/2_4-ACCCUU.mcs
MCSYM-DB/2_4/ACCCUU/ds-2_4-ACCCUU_x.pdb.gz
MCSYM-DB/2_4/ACCUCU/
MCSYM-DB/2_4/ACCUCU/2_4-ACCUCU.mcs
MCSYM-DB/2_4/ACCUCU/ds-2_4-ACCUCU_x.pdb.gz
MCSYM-DB/2_4/ACCUUU/
MCSYM-DB/2_4/ACCUUU/2_4-ACCUUU.mcs
MCSYM-DB/2_4/ACGAAA/
MCSYM-DB/2_4/ACGAAA/2_4-ACGAAA.mcs
MCSYM-DB/2_4/ACGAAA/ds-2_4-ACGAAA_x.pdb.gz
MCSYM-DB/2_4/ACGAAC/
MCSYM-DB/2_4/ACGAAC/2_4-ACGAAC.mcs
MCSYM-DB/2_4/ACGAAG/
MCSYM-DB/2_4/ACGAAG/2_4-ACGAAG.mcs
MCSYM-DB/2_4/ACGAAG/ds-2_4-ACGAAG_x.pdb.gz
MCSYM-DB/2_4/ACGAAU/
MCSYM-DB/2_4/ACGAAU/2_4-ACGAAU.mcs
MCSYM-DB/2_4/ACGAAU/ds-2_4-ACGAAU_x.pdb.gz
MCSYM-DB/2_4/ACGACA/
MCSYM-DB/2_4/ACGACA/2_4-ACGACA.mcs
MCSYM-DB/2_4/ACGACA/ds-2_4-ACGACA_x.pdb.gz
MCSYM-DB/2_4/ACGACG/
MCSYM-DB/2_4/ACGACG/2_4-ACGACG.mcs
MCSYM-DB/2_4/ACGACU/
MCSYM-DB/2_4/ACGACU/2_4-ACGACU.mcs
MCSYM-DB/2_4/ACGACU/ds-2_4-ACGACU_x.pdb.gz
MCSYM-DB/2_4/ACGAGA/
MCSYM-DB/2_4/ACGAGA/2_4-ACGAGA.mcs
MCSYM-DB/2_4/ACGAGA/ds-2_4-ACGAGA_x.pdb.gz
MCSYM-DB/2_4/ACGAGC/
MCSYM-DB/2_4/ACGAGC/2_4-ACGAGC.mcs
MCSYM-DB/2_4/ACGAGU/
MCSYM-DB/2_4/ACGAGU/2_4-ACGAGU.mcs
MCSYM-DB/2_4/ACGAUA/
MCSYM-DB/2_4/ACGAUA/2_4-ACGAUA.mcs
MCSYM-DB/2_4/ACGAUA/ds-2_4-ACGAUA_x.pdb.gz
MCSYM-DB/2_4/ACGAUU/
MCSYM-DB/2_4/ACGAUU/2_4-ACGAUU.mcs
MCSYM-DB/2_4/ACGAUU/ds-2_4-ACGAUU_x.pdb.gz
MCSYM-DB/2_4/ACGCAA/
MCSYM-DB/2_4/ACGCAA/2_4-ACGCAA.mcs
MCSYM-DB/2_4/ACGCAA/ds-2_4-ACGCAA_x.pdb.gz
MCSYM-DB/2_4/ACGCAU/
MCSYM-DB/2_4/ACGCAU/2_4-ACGCAU.mcs
MCSYM-DB/2_4/ACGCAU/ds-2_4-ACGCAU_x.pdb.gz
MCSYM-DB/2_4/ACGCCA/
MCSYM-DB/2_4/ACGCCA/2_4-ACGCCA.mcs
MCSYM-DB/2_4/ACGCCA/ds-2_4-ACGCCA_x.pdb.gz
MCSYM-DB/2_4/ACGCCG/
MCSYM-DB/2_4/ACGCCG/2_4-ACGCCG.mcs
MCSYM-DB/2_4/ACGCCG/ds-2_4-ACGCCG_x.pdb.gz
MCSYM-DB/2_4/ACGCCU/
MCSYM-DB/2_4/ACGCCU/2_4-ACGCCU.mcs
MCSYM-DB/2_4/ACGCCU/ds-2_4-ACGCCU_x.pdb.gz
MCSYM-DB/2_4/ACGCGU/
MCSYM-DB/2_4/ACGCGU/2_4-ACGCGU.mcs
MCSYM-DB/2_4/ACGCGU/ds-2_4-ACGCGU_x.pdb.gz
MCSYM-DB/2_4/ACGCUA/
MCSYM-DB/2_4/ACGCUA/2_4-ACGCUA.mcs
MCSYM-DB/2_4/ACGCUA/ds-2_4-ACGCUA_x.pdb.gz
MCSYM-DB/2_4/ACGCUC/
MCSYM-DB/2_4/ACGCUC/2_4-ACGCUC.mcs
MCSYM-DB/2_4/ACGCUG/
MCSYM-DB/2_4/ACGCUG/2_4-ACGCUG.mcs
MCSYM-DB/2_4/ACGCUU/
MCSYM-DB/2_4/ACGCUU/2_4-ACGCUU.mcs
MCSYM-DB/2_4/ACGCUU/ds-2_4-ACGCUU_x.pdb.gz
MCSYM-DB/2_4/ACGGAA/
MCSYM-DB/2_4/ACGGAA/2_4-ACGGAA.mcs
MCSYM-DB/2_4/ACGGAA/ds-2_4-ACGGAA_x.pdb.gz
MCSYM-DB/2_4/ACGGAC/
MCSYM-DB/2_4/ACGGAC/2_4-ACGGAC.mcs
MCSYM-DB/2_4/ACGGAG/
MCSYM-DB/2_4/ACGGAG/2_4-ACGGAG.mcs
MCSYM-DB/2_4/ACGGAG/ds-2_4-ACGGAG_x.pdb.gz
MCSYM-DB/2_4/ACGGAU/
MCSYM-DB/2_4/ACGGAU/2_4-ACGGAU.mcs
MCSYM-DB/2_4/ACGGAU/ds-2_4-ACGGAU_x.pdb.gz
MCSYM-DB/2_4/ACGGCA/
MCSYM-DB/2_4/ACGGCA/2_4-ACGGCA.mcs
MCSYM-DB/2_4/ACGGCG/
MCSYM-DB/2_4/ACGGCG/2_4-ACGGCG.mcs
MCSYM-DB/2_4/ACGGCG/ds-2_4-ACGGCG_x.pdb.gz
MCSYM-DB/2_4/ACGGCU/
MCSYM-DB/2_4/ACGGCU/2_4-ACGGCU.mcs
MCSYM-DB/2_4/ACGGCU/ds-2_4-ACGGCU_x.pdb.gz
MCSYM-DB/2_4/ACGGGA/
MCSYM-DB/2_4/ACGGGA/2_4-ACGGGA.mcs
MCSYM-DB/2_4/ACGGGU/
MCSYM-DB/2_4/ACGGGU/2_4-ACGGGU.mcs
MCSYM-DB/2_4/ACGGGU/ds-2_4-ACGGGU_x.pdb.gz
MCSYM-DB/2_4/ACGGUA/
MCSYM-DB/2_4/ACGGUA/2_4-ACGGUA.mcs
MCSYM-DB/2_4/ACGGUA/ds-2_4-ACGGUA_x.pdb.gz
MCSYM-DB/2_4/ACGGUC/
MCSYM-DB/2_4/ACGGUC/2_4-ACGGUC.mcs
MCSYM-DB/2_4/ACGGUG/
MCSYM-DB/2_4/ACGGUG/2_4-ACGGUG.mcs
MCSYM-DB/2_4/ACGGUU/
MCSYM-DB/2_4/ACGGUU/2_4-ACGGUU.mcs
MCSYM-DB/2_4/ACGGUU/ds-2_4-ACGGUU_x.pdb.gz
MCSYM-DB/2_4/ACGUAC/
MCSYM-DB/2_4/ACGUAC/2_4-ACGUAC.mcs
MCSYM-DB/2_4/ACGUAU/
MCSYM-DB/2_4/ACGUAU/2_4-ACGUAU.mcs
MCSYM-DB/2_4/ACGUAU/ds-2_4-ACGUAU_x.pdb.gz
MCSYM-DB/2_4/ACGUCA/
MCSYM-DB/2_4/ACGUCA/2_4-ACGUCA.mcs
MCSYM-DB/2_4/ACGUCU/
MCSYM-DB/2_4/ACGUCU/2_4-ACGUCU.mcs
MCSYM-DB/2_4/ACGUCU/ds-2_4-ACGUCU_x.pdb.gz
MCSYM-DB/2_4/ACGUGA/
MCSYM-DB/2_4/ACGUGA/2_4-ACGUGA.mcs
MCSYM-DB/2_4/ACGUGA/ds-2_4-ACGUGA_x.pdb.gz
MCSYM-DB/2_4/ACGUGU/
MCSYM-DB/2_4/ACGUGU/2_4-ACGUGU.mcs
MCSYM-DB/2_4/ACGUUG/
MCSYM-DB/2_4/ACGUUG/2_4-ACGUUG.mcs
MCSYM-DB/2_4/ACGUUU/
MCSYM-DB/2_4/ACGUUU/2_4-ACGUUU.mcs
MCSYM-DB/2_4/ACGUUU/ds-2_4-ACGUUU_x.pdb.gz
MCSYM-DB/2_4/ACUAAU/
MCSYM-DB/2_4/ACUAAU/2_4-ACUAAU.mcs
MCSYM-DB/2_4/ACUAUG/
MCSYM-DB/2_4/ACUAUG/2_4-ACUAUG.mcs
MCSYM-DB/2_4/ACUAUG/ds-2_4-ACUAUG_x.pdb.gz
MCSYM-DB/2_4/ACUCAU/
MCSYM-DB/2_4/ACUCAU/2_4-ACUCAU.mcs
MCSYM-DB/2_4/ACUCCA/
MCSYM-DB/2_4/ACUCCA/2_4-ACUCCA.mcs
MCSYM-DB/2_4/ACUCCA/ds-2_4-ACUCCA_x.pdb.gz
MCSYM-DB/2_4/ACUCCU/
MCSYM-DB/2_4/ACUCCU/2_4-ACUCCU.mcs
MCSYM-DB/2_4/ACUGAU/
MCSYM-DB/2_4/ACUGAU/2_4-ACUGAU.mcs
MCSYM-DB/2_4/ACUGGG/
MCSYM-DB/2_4/ACUGGG/2_4-ACUGGG.mcs
MCSYM-DB/2_4/ACUGGG/ds-2_4-ACUGGG_x.pdb.gz
MCSYM-DB/2_4/ACUGUU/
MCSYM-DB/2_4/ACUGUU/2_4-ACUGUU.mcs
MCSYM-DB/2_4/ACUUCU/
MCSYM-DB/2_4/ACUUCU/2_4-ACUUCU.mcs
MCSYM-DB/2_4/ACUUUU/
MCSYM-DB/2_4/ACUUUU/2_4-ACUUUU.mcs
MCSYM-DB/2_4/ACUUUU/ds-2_4-ACUUUU_x.pdb.gz
MCSYM-DB/2_4/AGAAAA/
MCSYM-DB/2_4/AGAAAA/2_4-AGAAAA.mcs
MCSYM-DB/2_4/AGAAAA/ds-2_4-AGAAAA_x.pdb.gz
MCSYM-DB/2_4/AGAAAG/
MCSYM-DB/2_4/AGAAAG/2_4-AGAAAG.mcs
MCSYM-DB/2_4/AGAAAG/ds-2_4-AGAAAG_x.pdb.gz
MCSYM-DB/2_4/AGAAAU/
MCSYM-DB/2_4/AGAAAU/2_4-AGAAAU.mcs
MCSYM-DB/2_4/AGAAAU/ds-2_4-AGAAAU_x.pdb.gz
MCSYM-DB/2_4/AGAACU/
MCSYM-DB/2_4/AGAACU/2_4-AGAACU.mcs
MCSYM-DB/2_4/AGAACU/ds-2_4-AGAACU_x.pdb.gz
MCSYM-DB/2_4/AGAAGA/
MCSYM-DB/2_4/AGAAGA/2_4-AGAAGA.mcs
MCSYM-DB/2_4/AGAAGA/ds-2_4-AGAAGA_x.pdb.gz
MCSYM-DB/2_4/AGAAGG/
MCSYM-DB/2_4/AGAAGG/2_4-AGAAGG.mcs
MCSYM-DB/2_4/AGAAGG/ds-2_4-AGAAGG_x.pdb.gz
MCSYM-DB/2_4/AGAAGU/
MCSYM-DB/2_4/AGAAGU/2_4-AGAAGU.mcs
MCSYM-DB/2_4/AGAAGU/ds-2_4-AGAAGU_x.pdb.gz
MCSYM-DB/2_4/AGAAUA/
MCSYM-DB/2_4/AGAAUA/2_4-AGAAUA.mcs
MCSYM-DB/2_4/AGAAUC/
MCSYM-DB/2_4/AGAAUC/2_4-AGAAUC.mcs
MCSYM-DB/2_4/AGACAA/
MCSYM-DB/2_4/AGACAA/2_4-AGACAA.mcs
MCSYM-DB/2_4/AGACAA/ds-2_4-AGACAA_x.pdb.gz
MCSYM-DB/2_4/AGACAU/
MCSYM-DB/2_4/AGACAU/2_4-AGACAU.mcs
MCSYM-DB/2_4/AGACCC/
MCSYM-DB/2_4/AGACCC/2_4-AGACCC.mcs
MCSYM-DB/2_4/AGACCC/ds-2_4-AGACCC_x.pdb.gz
MCSYM-DB/2_4/AGACCU/
MCSYM-DB/2_4/AGACCU/2_4-AGACCU.mcs
MCSYM-DB/2_4/AGAGAA/
MCSYM-DB/2_4/AGAGAA/2_4-AGAGAA.mcs
MCSYM-DB/2_4/AGAGAA/ds-2_4-AGAGAA_x.pdb.gz
MCSYM-DB/2_4/AGAGAG/
MCSYM-DB/2_4/AGAGAG/2_4-AGAGAG.mcs
MCSYM-DB/2_4/AGAGAG/ds-2_4-AGAGAG_x.pdb.gz
MCSYM-DB/2_4/AGAGAU/
MCSYM-DB/2_4/AGAGAU/2_4-AGAGAU.mcs
MCSYM-DB/2_4/AGAGAU/ds-2_4-AGAGAU_x.pdb.gz
MCSYM-DB/2_4/AGAGCU/
MCSYM-DB/2_4/AGAGCU/2_4-AGAGCU.mcs
MCSYM-DB/2_4/AGAGGA/
MCSYM-DB/2_4/AGAGGA/2_4-AGAGGA.mcs
MCSYM-DB/2_4/AGAGGA/ds-2_4-AGAGGA_x.pdb.gz
MCSYM-DB/2_4/AGAGGU/
MCSYM-DB/2_4/AGAGGU/2_4-AGAGGU.mcs
MCSYM-DB/2_4/AGAGGU/ds-2_4-AGAGGU_x.pdb.gz
MCSYM-DB/2_4/AGAGUC/
MCSYM-DB/2_4/AGAGUC/2_4-AGAGUC.mcs
MCSYM-DB/2_4/AGAGUU/
MCSYM-DB/2_4/AGAGUU/2_4-AGAGUU.mcs
MCSYM-DB/2_4/AGAGUU/ds-2_4-AGAGUU_x.pdb.gz
MCSYM-DB/2_4/AGAUAU/
MCSYM-DB/2_4/AGAUAU/2_4-AGAUAU.mcs
MCSYM-DB/2_4/AGAUAU/ds-2_4-AGAUAU_x.pdb.gz
MCSYM-DB/2_4/AGAUCU/
MCSYM-DB/2_4/AGAUCU/2_4-AGAUCU.mcs
MCSYM-DB/2_4/AGAUGU/
MCSYM-DB/2_4/AGAUGU/2_4-AGAUGU.mcs
MCSYM-DB/2_4/AGAUGU/ds-2_4-AGAUGU_x.pdb.gz
MCSYM-DB/2_4/AGAUUU/
MCSYM-DB/2_4/AGAUUU/2_4-AGAUUU.mcs
MCSYM-DB/2_4/AGCAAA/
MCSYM-DB/2_4/AGCAAA/2_4-AGCAAA.mcs
MCSYM-DB/2_4/AGCAAA/ds-2_4-AGCAAA_x.pdb.gz
MCSYM-DB/2_4/AGCAAC/
MCSYM-DB/2_4/AGCAAC/2_4-AGCAAC.mcs
MCSYM-DB/2_4/AGCAAG/
MCSYM-DB/2_4/AGCAAG/2_4-AGCAAG.mcs
MCSYM-DB/2_4/AGCAAG/ds-2_4-AGCAAG_x.pdb.gz
MCSYM-DB/2_4/AGCAAU/
MCSYM-DB/2_4/AGCAAU/2_4-AGCAAU.mcs
MCSYM-DB/2_4/AGCAAU/ds-2_4-AGCAAU_x.pdb.gz
MCSYM-DB/2_4/AGCACA/
MCSYM-DB/2_4/AGCACA/2_4-AGCACA.mcs
MCSYM-DB/2_4/AGCACC/
MCSYM-DB/2_4/AGCACC/2_4-AGCACC.mcs
MCSYM-DB/2_4/AGCACG/
MCSYM-DB/2_4/AGCACG/2_4-AGCACG.mcs
MCSYM-DB/2_4/AGCACU/
MCSYM-DB/2_4/AGCACU/2_4-AGCACU.mcs
MCSYM-DB/2_4/AGCACU/ds-2_4-AGCACU_x.pdb.gz
MCSYM-DB/2_4/AGCAGA/
MCSYM-DB/2_4/AGCAGA/2_4-AGCAGA.mcs
MCSYM-DB/2_4/AGCAGC/
MCSYM-DB/2_4/AGCAGC/2_4-AGCAGC.mcs
MCSYM-DB/2_4/AGCAGG/
MCSYM-DB/2_4/AGCAGG/2_4-AGCAGG.mcs
MCSYM-DB/2_4/AGCAGU/
MCSYM-DB/2_4/AGCAGU/2_4-AGCAGU.mcs
MCSYM-DB/2_4/AGCAGU/ds-2_4-AGCAGU_x.pdb.gz
MCSYM-DB/2_4/AGCAUC/
MCSYM-DB/2_4/AGCAUC/2_4-AGCAUC.mcs
MCSYM-DB/2_4/AGCAUG/
MCSYM-DB/2_4/AGCAUG/2_4-AGCAUG.mcs
MCSYM-DB/2_4/AGCAUG/ds-2_4-AGCAUG_x.pdb.gz
MCSYM-DB/2_4/AGCAUU/
MCSYM-DB/2_4/AGCAUU/2_4-AGCAUU.mcs
MCSYM-DB/2_4/AGCAUU/ds-2_4-AGCAUU_x.pdb.gz
MCSYM-DB/2_4/AGCCAA/
MCSYM-DB/2_4/AGCCAA/2_4-AGCCAA.mcs
MCSYM-DB/2_4/AGCCAA/ds-2_4-AGCCAA_x.pdb.gz
MCSYM-DB/2_4/AGCCAC/
MCSYM-DB/2_4/AGCCAC/2_4-AGCCAC.mcs
MCSYM-DB/2_4/AGCCAC/ds-2_4-AGCCAC_x.pdb.gz
MCSYM-DB/2_4/AGCCAG/
MCSYM-DB/2_4/AGCCAG/2_4-AGCCAG.mcs
MCSYM-DB/2_4/AGCCAG/ds-2_4-AGCCAG_x.pdb.gz
MCSYM-DB/2_4/AGCCAU/
MCSYM-DB/2_4/AGCCAU/2_4-AGCCAU.mcs
MCSYM-DB/2_4/AGCCAU/ds-2_4-AGCCAU_x.pdb.gz
MCSYM-DB/2_4/AGCCCA/
MCSYM-DB/2_4/AGCCCA/2_4-AGCCCA.mcs
MCSYM-DB/2_4/AGCCCA/ds-2_4-AGCCCA_x.pdb.gz
MCSYM-DB/2_4/AGCCCC/
MCSYM-DB/2_4/AGCCCC/2_4-AGCCCC.mcs
MCSYM-DB/2_4/AGCCCC/ds-2_4-AGCCCC_x.pdb.gz
MCSYM-DB/2_4/AGCCCG/
MCSYM-DB/2_4/AGCCCG/2_4-AGCCCG.mcs
MCSYM-DB/2_4/AGCCCG/ds-2_4-AGCCCG_x.pdb.gz
MCSYM-DB/2_4/AGCCCU/
MCSYM-DB/2_4/AGCCCU/2_4-AGCCCU.mcs
MCSYM-DB/2_4/AGCCCU/ds-2_4-AGCCCU_x.pdb.gz
MCSYM-DB/2_4/AGCCGC/
MCSYM-DB/2_4/AGCCGC/2_4-AGCCGC.mcs
MCSYM-DB/2_4/AGCCGC/ds-2_4-AGCCGC_x.pdb.gz
MCSYM-DB/2_4/AGCCGG/
MCSYM-DB/2_4/AGCCGG/2_4-AGCCGG.mcs
MCSYM-DB/2_4/AGCCGU/
MCSYM-DB/2_4/AGCCGU/2_4-AGCCGU.mcs
MCSYM-DB/2_4/AGCCGU/ds-2_4-AGCCGU_x.pdb.gz
MCSYM-DB/2_4/AGCCUA/
MCSYM-DB/2_4/AGCCUA/2_4-AGCCUA.mcs
MCSYM-DB/2_4/AGCCUC/
MCSYM-DB/2_4/AGCCUC/2_4-AGCCUC.mcs
MCSYM-DB/2_4/AGCCUG/
MCSYM-DB/2_4/AGCCUG/2_4-AGCCUG.mcs
MCSYM-DB/2_4/AGCCUG/ds-2_4-AGCCUG_x.pdb.gz
MCSYM-DB/2_4/AGCCUU/
MCSYM-DB/2_4/AGCCUU/2_4-AGCCUU.mcs
MCSYM-DB/2_4/AGCCUU/ds-2_4-AGCCUU_x.pdb.gz
MCSYM-DB/2_4/AGCGAA/
MCSYM-DB/2_4/AGCGAA/2_4-AGCGAA.mcs
MCSYM-DB/2_4/AGCGAA/ds-2_4-AGCGAA_x.pdb.gz
MCSYM-DB/2_4/AGCGAG/
MCSYM-DB/2_4/AGCGAG/2_4-AGCGAG.mcs
MCSYM-DB/2_4/AGCGAG/ds-2_4-AGCGAG_x.pdb.gz
MCSYM-DB/2_4/AGCGAU/
MCSYM-DB/2_4/AGCGAU/2_4-AGCGAU.mcs
MCSYM-DB/2_4/AGCGAU/ds-2_4-AGCGAU_x.pdb.gz
MCSYM-DB/2_4/AGCGCA/
MCSYM-DB/2_4/AGCGCA/2_4-AGCGCA.mcs
MCSYM-DB/2_4/AGCGCA/ds-2_4-AGCGCA_x.pdb.gz
MCSYM-DB/2_4/AGCGCG/
MCSYM-DB/2_4/AGCGCG/2_4-AGCGCG.mcs
MCSYM-DB/2_4/AGCGCG/ds-2_4-AGCGCG_x.pdb.gz
MCSYM-DB/2_4/AGCGCU/
MCSYM-DB/2_4/AGCGCU/2_4-AGCGCU.mcs
MCSYM-DB/2_4/AGCGCU/ds-2_4-AGCGCU_x.pdb.gz
MCSYM-DB/2_4/AGCGGG/
MCSYM-DB/2_4/AGCGGG/2_4-AGCGGG.mcs
MCSYM-DB/2_4/AGCGGG/ds-2_4-AGCGGG_x.pdb.gz
MCSYM-DB/2_4/AGCGGU/
MCSYM-DB/2_4/AGCGGU/2_4-AGCGGU.mcs
MCSYM-DB/2_4/AGCGGU/ds-2_4-AGCGGU_x.pdb.gz
MCSYM-DB/2_4/AGCGUA/
MCSYM-DB/2_4/AGCGUA/2_4-AGCGUA.mcs
MCSYM-DB/2_4/AGCGUG/
MCSYM-DB/2_4/AGCGUG/2_4-AGCGUG.mcs
MCSYM-DB/2_4/AGCGUG/ds-2_4-AGCGUG_x.pdb.gz
MCSYM-DB/2_4/AGCGUU/
MCSYM-DB/2_4/AGCGUU/2_4-AGCGUU.mcs
MCSYM-DB/2_4/AGCGUU/ds-2_4-AGCGUU_x.pdb.gz
MCSYM-DB/2_4/AGCUAA/
MCSYM-DB/2_4/AGCUAA/2_4-AGCUAA.mcs
MCSYM-DB/2_4/AGCUAU/
MCSYM-DB/2_4/AGCUAU/2_4-AGCUAU.mcs
MCSYM-DB/2_4/AGCUAU/ds-2_4-AGCUAU_x.pdb.gz
MCSYM-DB/2_4/AGCUCC/
MCSYM-DB/2_4/AGCUCC/2_4-AGCUCC.mcs
MCSYM-DB/2_4/AGCUCU/
MCSYM-DB/2_4/AGCUCU/2_4-AGCUCU.mcs
MCSYM-DB/2_4/AGCUCU/ds-2_4-AGCUCU_x.pdb.gz
MCSYM-DB/2_4/AGCUGA/
MCSYM-DB/2_4/AGCUGA/2_4-AGCUGA.mcs
MCSYM-DB/2_4/AGCUGC/
MCSYM-DB/2_4/AGCUGC/2_4-AGCUGC.mcs
MCSYM-DB/2_4/AGCUGU/
MCSYM-DB/2_4/AGCUGU/2_4-AGCUGU.mcs
MCSYM-DB/2_4/AGCUGU/ds-2_4-AGCUGU_x.pdb.gz
MCSYM-DB/2_4/AGCUUA/
MCSYM-DB/2_4/AGCUUA/2_4-AGCUUA.mcs
MCSYM-DB/2_4/AGCUUG/
MCSYM-DB/2_4/AGCUUG/2_4-AGCUUG.mcs
MCSYM-DB/2_4/AGCUUU/
MCSYM-DB/2_4/AGCUUU/2_4-AGCUUU.mcs
MCSYM-DB/2_4/AGCUUU/ds-2_4-AGCUUU_x.pdb.gz
MCSYM-DB/2_4/AGGACC/
MCSYM-DB/2_4/AGGACC/2_4-AGGACC.mcs
MCSYM-DB/2_4/AGGACC/ds-2_4-AGGACC_x.pdb.gz
MCSYM-DB/2_4/AGGAGA/
MCSYM-DB/2_4/AGGAGA/2_4-AGGAGA.mcs
MCSYM-DB/2_4/AGGAGA/ds-2_4-AGGAGA_x.pdb.gz
MCSYM-DB/2_4/AGGAGU/
MCSYM-DB/2_4/AGGAGU/2_4-AGGAGU.mcs
MCSYM-DB/2_4/AGGAGU/ds-2_4-AGGAGU_x.pdb.gz
MCSYM-DB/2_4/AGGCGU/
MCSYM-DB/2_4/AGGCGU/2_4-AGGCGU.mcs
MCSYM-DB/2_4/AGGCGU/ds-2_4-AGGCGU_x.pdb.gz
MCSYM-DB/2_4/AGGGCA/
MCSYM-DB/2_4/AGGGCA/2_4-AGGGCA.mcs
MCSYM-DB/2_4/AGGGCA/ds-2_4-AGGGCA_x.pdb.gz
MCSYM-DB/2_4/AGGGCU/
MCSYM-DB/2_4/AGGGCU/2_4-AGGGCU.mcs
MCSYM-DB/2_4/AGGGGC/
MCSYM-DB/2_4/AGGGGC/2_4-AGGGGC.mcs
MCSYM-DB/2_4/AGGGGC/ds-2_4-AGGGGC_x.pdb.gz
MCSYM-DB/2_4/AGGGGG/
MCSYM-DB/2_4/AGGGGG/2_4-AGGGGG.mcs
MCSYM-DB/2_4/AGGGGG/ds-2_4-AGGGGG_x.pdb.gz
MCSYM-DB/2_4/AGGGGU/
MCSYM-DB/2_4/AGGGGU/2_4-AGGGGU.mcs
MCSYM-DB/2_4/AGGGUC/
MCSYM-DB/2_4/AGGGUC/2_4-AGGGUC.mcs
MCSYM-DB/2_4/AGGGUC/ds-2_4-AGGGUC_x.pdb.gz
MCSYM-DB/2_4/AGGGUU/
MCSYM-DB/2_4/AGGGUU/2_4-AGGGUU.mcs
MCSYM-DB/2_4/AGGUAG/
MCSYM-DB/2_4/AGGUAG/2_4-AGGUAG.mcs
MCSYM-DB/2_4/AGGUAG/ds-2_4-AGGUAG_x.pdb.gz
MCSYM-DB/2_4/AGGUGC/
MCSYM-DB/2_4/AGGUGC/2_4-AGGUGC.mcs
MCSYM-DB/2_4/AGGUGC/ds-2_4-AGGUGC_x.pdb.gz
MCSYM-DB/2_4/AGGUGU/
MCSYM-DB/2_4/AGGUGU/2_4-AGGUGU.mcs
MCSYM-DB/2_4/AGGUGU/ds-2_4-AGGUGU_x.pdb.gz
MCSYM-DB/2_4/AGGUUG/
MCSYM-DB/2_4/AGGUUG/2_4-AGGUUG.mcs
MCSYM-DB/2_4/AGGUUG/ds-2_4-AGGUUG_x.pdb.gz
MCSYM-DB/2_4/AGUAAA/
MCSYM-DB/2_4/AGUAAA/2_4-AGUAAA.mcs
MCSYM-DB/2_4/AGUAAG/
MCSYM-DB/2_4/AGUAAG/2_4-AGUAAG.mcs
MCSYM-DB/2_4/AGUAAU/
MCSYM-DB/2_4/AGUAAU/2_4-AGUAAU.mcs
MCSYM-DB/2_4/AGUAAU/ds-2_4-AGUAAU_x.pdb.gz
MCSYM-DB/2_4/AGUAGA/
MCSYM-DB/2_4/AGUAGA/2_4-AGUAGA.mcs
MCSYM-DB/2_4/AGUAGU/
MCSYM-DB/2_4/AGUAGU/2_4-AGUAGU.mcs
MCSYM-DB/2_4/AGUAGU/ds-2_4-AGUAGU_x.pdb.gz
MCSYM-DB/2_4/AGUAUA/
MCSYM-DB/2_4/AGUAUA/2_4-AGUAUA.mcs
MCSYM-DB/2_4/AGUAUC/
MCSYM-DB/2_4/AGUAUC/2_4-AGUAUC.mcs
MCSYM-DB/2_4/AGUAUC/ds-2_4-AGUAUC_x.pdb.gz
MCSYM-DB/2_4/AGUAUU/
MCSYM-DB/2_4/AGUAUU/2_4-AGUAUU.mcs
MCSYM-DB/2_4/AGUAUU/ds-2_4-AGUAUU_x.pdb.gz
MCSYM-DB/2_4/AGUCAG/
MCSYM-DB/2_4/AGUCAG/2_4-AGUCAG.mcs
MCSYM-DB/2_4/AGUCCA/
MCSYM-DB/2_4/AGUCCA/2_4-AGUCCA.mcs
MCSYM-DB/2_4/AGUCCA/ds-2_4-AGUCCA_x.pdb.gz
MCSYM-DB/2_4/AGUCGG/
MCSYM-DB/2_4/AGUCGG/2_4-AGUCGG.mcs
MCSYM-DB/2_4/AGUCGG/ds-2_4-AGUCGG_x.pdb.gz
MCSYM-DB/2_4/AGUCGU/
MCSYM-DB/2_4/AGUCGU/2_4-AGUCGU.mcs
MCSYM-DB/2_4/AGUCGU/ds-2_4-AGUCGU_x.pdb.gz
MCSYM-DB/2_4/AGUCUU/
MCSYM-DB/2_4/AGUCUU/2_4-AGUCUU.mcs
MCSYM-DB/2_4/AGUCUU/ds-2_4-AGUCUU_x.pdb.gz
MCSYM-DB/2_4/AGUGAA/
MCSYM-DB/2_4/AGUGAA/2_4-AGUGAA.mcs
MCSYM-DB/2_4/AGUGAA/ds-2_4-AGUGAA_x.pdb.gz
MCSYM-DB/2_4/AGUGAC/
MCSYM-DB/2_4/AGUGAC/2_4-AGUGAC.mcs
MCSYM-DB/2_4/AGUGAG/
MCSYM-DB/2_4/AGUGAG/2_4-AGUGAG.mcs
MCSYM-DB/2_4/AGUGAU/
MCSYM-DB/2_4/AGUGAU/2_4-AGUGAU.mcs
MCSYM-DB/2_4/AGUGAU/ds-2_4-AGUGAU_x.pdb.gz
MCSYM-DB/2_4/AGUGCU/
MCSYM-DB/2_4/AGUGCU/2_4-AGUGCU.mcs
MCSYM-DB/2_4/AGUGGA/
MCSYM-DB/2_4/AGUGGA/2_4-AGUGGA.mcs
MCSYM-DB/2_4/AGUGGA/ds-2_4-AGUGGA_x.pdb.gz
MCSYM-DB/2_4/AGUGGU/
MCSYM-DB/2_4/AGUGGU/2_4-AGUGGU.mcs
MCSYM-DB/2_4/AGUGGU/ds-2_4-AGUGGU_x.pdb.gz
MCSYM-DB/2_4/AGUGUA/
MCSYM-DB/2_4/AGUGUA/2_4-AGUGUA.mcs
MCSYM-DB/2_4/AGUGUA/ds-2_4-AGUGUA_x.pdb.gz
MCSYM-DB/2_4/AGUGUC/
MCSYM-DB/2_4/AGUGUC/2_4-AGUGUC.mcs
MCSYM-DB/2_4/AGUGUU/
MCSYM-DB/2_4/AGUGUU/2_4-AGUGUU.mcs
MCSYM-DB/2_4/AGUGUU/ds-2_4-AGUGUU_x.pdb.gz
MCSYM-DB/2_4/AGUUAU/
MCSYM-DB/2_4/AGUUAU/2_4-AGUUAU.mcs
MCSYM-DB/2_4/AGUUAU/ds-2_4-AGUUAU_x.pdb.gz
MCSYM-DB/2_4/AGUUCA/
MCSYM-DB/2_4/AGUUCA/2_4-AGUUCA.mcs
MCSYM-DB/2_4/AGUUCC/
MCSYM-DB/2_4/AGUUCC/2_4-AGUUCC.mcs
MCSYM-DB/2_4/AGUUCC/ds-2_4-AGUUCC_x.pdb.gz
MCSYM-DB/2_4/AGUUCG/
MCSYM-DB/2_4/AGUUCG/2_4-AGUUCG.mcs
MCSYM-DB/2_4/AGUUCG/ds-2_4-AGUUCG_x.pdb.gz
MCSYM-DB/2_4/AGUUCU/
MCSYM-DB/2_4/AGUUCU/2_4-AGUUCU.mcs
MCSYM-DB/2_4/AGUUCU/ds-2_4-AGUUCU_x.pdb.gz
MCSYM-DB/2_4/AGUUGC/
MCSYM-DB/2_4/AGUUGC/2_4-AGUUGC.mcs
MCSYM-DB/2_4/AGUUGC/ds-2_4-AGUUGC_x.pdb.gz
MCSYM-DB/2_4/AGUUGU/
MCSYM-DB/2_4/AGUUGU/2_4-AGUUGU.mcs
MCSYM-DB/2_4/AGUUGU/ds-2_4-AGUUGU_x.pdb.gz
MCSYM-DB/2_4/AGUUUU/
MCSYM-DB/2_4/AGUUUU/2_4-AGUUUU.mcs
MCSYM-DB/2_4/AGUUUU/ds-2_4-AGUUUU_x.pdb.gz
MCSYM-DB/2_4/AUAAAA/
MCSYM-DB/2_4/AUAAAA/2_4-AUAAAA.mcs
MCSYM-DB/2_4/AUAAAC/
MCSYM-DB/2_4/AUAAAC/2_4-AUAAAC.mcs
MCSYM-DB/2_4/AUAAAG/
MCSYM-DB/2_4/AUAAAG/2_4-AUAAAG.mcs
MCSYM-DB/2_4/AUAAAU/
MCSYM-DB/2_4/AUAAAU/2_4-AUAAAU.mcs
MCSYM-DB/2_4/AUAAAU/ds-2_4-AUAAAU_x.pdb.gz
MCSYM-DB/2_4/AUAACA/
MCSYM-DB/2_4/AUAACA/2_4-AUAACA.mcs
MCSYM-DB/2_4/AUAACA/ds-2_4-AUAACA_x.pdb.gz
MCSYM-DB/2_4/AUAACC/
MCSYM-DB/2_4/AUAACC/2_4-AUAACC.mcs
MCSYM-DB/2_4/AUAACG/
MCSYM-DB/2_4/AUAACG/2_4-AUAACG.mcs
MCSYM-DB/2_4/AUAACG/ds-2_4-AUAACG_x.pdb.gz
MCSYM-DB/2_4/AUAACU/
MCSYM-DB/2_4/AUAACU/2_4-AUAACU.mcs
MCSYM-DB/2_4/AUAACU/ds-2_4-AUAACU_x.pdb.gz
MCSYM-DB/2_4/AUAAGA/
MCSYM-DB/2_4/AUAAGA/2_4-AUAAGA.mcs
MCSYM-DB/2_4/AUAAGA/ds-2_4-AUAAGA_x.pdb.gz
MCSYM-DB/2_4/AUAAGC/
MCSYM-DB/2_4/AUAAGC/2_4-AUAAGC.mcs
MCSYM-DB/2_4/AUAAGG/
MCSYM-DB/2_4/AUAAGG/2_4-AUAAGG.mcs
MCSYM-DB/2_4/AUAAGU/
MCSYM-DB/2_4/AUAAGU/2_4-AUAAGU.mcs
MCSYM-DB/2_4/AUAAGU/ds-2_4-AUAAGU_x.pdb.gz
MCSYM-DB/2_4/AUAAUC/
MCSYM-DB/2_4/AUAAUC/2_4-AUAAUC.mcs
MCSYM-DB/2_4/AUAAUG/
MCSYM-DB/2_4/AUAAUG/2_4-AUAAUG.mcs
MCSYM-DB/2_4/AUAAUG/ds-2_4-AUAAUG_x.pdb.gz
MCSYM-DB/2_4/AUAAUU/
MCSYM-DB/2_4/AUAAUU/2_4-AUAAUU.mcs
MCSYM-DB/2_4/AUAAUU/ds-2_4-AUAAUU_x.pdb.gz
MCSYM-DB/2_4/AUACAA/
MCSYM-DB/2_4/AUACAA/2_4-AUACAA.mcs
MCSYM-DB/2_4/AUACAA/ds-2_4-AUACAA_x.pdb.gz
MCSYM-DB/2_4/AUACAC/
MCSYM-DB/2_4/AUACAC/2_4-AUACAC.mcs
MCSYM-DB/2_4/AUACAC/ds-2_4-AUACAC_x.pdb.gz
MCSYM-DB/2_4/AUACAG/
MCSYM-DB/2_4/AUACAG/2_4-AUACAG.mcs
MCSYM-DB/2_4/AUACAG/ds-2_4-AUACAG_x.pdb.gz
MCSYM-DB/2_4/AUACCA/
MCSYM-DB/2_4/AUACCA/2_4-AUACCA.mcs
MCSYM-DB/2_4/AUACCC/
MCSYM-DB/2_4/AUACCC/2_4-AUACCC.mcs
MCSYM-DB/2_4/AUACCU/
MCSYM-DB/2_4/AUACCU/2_4-AUACCU.mcs
MCSYM-DB/2_4/AUACCU/ds-2_4-AUACCU_x.pdb.gz
MCSYM-DB/2_4/AUACGA/
MCSYM-DB/2_4/AUACGA/2_4-AUACGA.mcs
MCSYM-DB/2_4/AUACGA/ds-2_4-AUACGA_x.pdb.gz
MCSYM-DB/2_4/AUACGC/
MCSYM-DB/2_4/AUACGC/2_4-AUACGC.mcs
MCSYM-DB/2_4/AUACGU/
MCSYM-DB/2_4/AUACGU/2_4-AUACGU.mcs
MCSYM-DB/2_4/AUACGU/ds-2_4-AUACGU_x.pdb.gz
MCSYM-DB/2_4/AUACUA/
MCSYM-DB/2_4/AUACUA/2_4-AUACUA.mcs
MCSYM-DB/2_4/AUACUC/
MCSYM-DB/2_4/AUACUC/2_4-AUACUC.mcs
MCSYM-DB/2_4/AUACUG/
MCSYM-DB/2_4/AUACUG/2_4-AUACUG.mcs
MCSYM-DB/2_4/AUACUU/
MCSYM-DB/2_4/AUACUU/2_4-AUACUU.mcs
MCSYM-DB/2_4/AUACUU/ds-2_4-AUACUU_x.pdb.gz
MCSYM-DB/2_4/AUAGAA/
MCSYM-DB/2_4/AUAGAA/2_4-AUAGAA.mcs
MCSYM-DB/2_4/AUAGAU/
MCSYM-DB/2_4/AUAGAU/2_4-AUAGAU.mcs
MCSYM-DB/2_4/AUAGAU/ds-2_4-AUAGAU_x.pdb.gz
MCSYM-DB/2_4/AUAGCA/
MCSYM-DB/2_4/AUAGCA/2_4-AUAGCA.mcs
MCSYM-DB/2_4/AUAGCU/
MCSYM-DB/2_4/AUAGCU/2_4-AUAGCU.mcs
MCSYM-DB/2_4/AUAGCU/ds-2_4-AUAGCU_x.pdb.gz
MCSYM-DB/2_4/AUAGGC/
MCSYM-DB/2_4/AUAGGC/2_4-AUAGGC.mcs
MCSYM-DB/2_4/AUAGGG/
MCSYM-DB/2_4/AUAGGG/2_4-AUAGGG.mcs
MCSYM-DB/2_4/AUAGGG/ds-2_4-AUAGGG_x.pdb.gz
MCSYM-DB/2_4/AUAGGU/
MCSYM-DB/2_4/AUAGGU/2_4-AUAGGU.mcs
MCSYM-DB/2_4/AUAGUA/
MCSYM-DB/2_4/AUAGUA/2_4-AUAGUA.mcs
MCSYM-DB/2_4/AUAGUU/
MCSYM-DB/2_4/AUAGUU/2_4-AUAGUU.mcs
MCSYM-DB/2_4/AUAGUU/ds-2_4-AUAGUU_x.pdb.gz
MCSYM-DB/2_4/AUAUAC/
MCSYM-DB/2_4/AUAUAC/2_4-AUAUAC.mcs
MCSYM-DB/2_4/AUAUAG/
MCSYM-DB/2_4/AUAUAG/2_4-AUAUAG.mcs
MCSYM-DB/2_4/AUAUAU/
MCSYM-DB/2_4/AUAUAU/2_4-AUAUAU.mcs
MCSYM-DB/2_4/AUAUCA/
MCSYM-DB/2_4/AUAUCA/2_4-AUAUCA.mcs
MCSYM-DB/2_4/AUAUCC/
MCSYM-DB/2_4/AUAUCC/2_4-AUAUCC.mcs
MCSYM-DB/2_4/AUAUCU/
MCSYM-DB/2_4/AUAUCU/2_4-AUAUCU.mcs
MCSYM-DB/2_4/AUAUCU/ds-2_4-AUAUCU_x.pdb.gz
MCSYM-DB/2_4/AUAUGA/
MCSYM-DB/2_4/AUAUGA/2_4-AUAUGA.mcs
MCSYM-DB/2_4/AUAUGU/
MCSYM-DB/2_4/AUAUGU/2_4-AUAUGU.mcs
MCSYM-DB/2_4/AUAUGU/ds-2_4-AUAUGU_x.pdb.gz
MCSYM-DB/2_4/AUAUUA/
MCSYM-DB/2_4/AUAUUA/2_4-AUAUUA.mcs
MCSYM-DB/2_4/AUAUUC/
MCSYM-DB/2_4/AUAUUC/2_4-AUAUUC.mcs
MCSYM-DB/2_4/AUAUUG/
MCSYM-DB/2_4/AUAUUG/2_4-AUAUUG.mcs
MCSYM-DB/2_4/AUAUUU/
MCSYM-DB/2_4/AUAUUU/2_4-AUAUUU.mcs
MCSYM-DB/2_4/AUAUUU/ds-2_4-AUAUUU_x.pdb.gz
MCSYM-DB/2_4/AUCAAG/
MCSYM-DB/2_4/AUCAAG/2_4-AUCAAG.mcs
MCSYM-DB/2_4/AUCAAG/ds-2_4-AUCAAG_x.pdb.gz
MCSYM-DB/2_4/AUCAAU/
MCSYM-DB/2_4/AUCAAU/2_4-AUCAAU.mcs
MCSYM-DB/2_4/AUCACC/
MCSYM-DB/2_4/AUCACC/2_4-AUCACC.mcs
MCSYM-DB/2_4/AUCACU/
MCSYM-DB/2_4/AUCACU/2_4-AUCACU.mcs
MCSYM-DB/2_4/AUCAGU/
MCSYM-DB/2_4/AUCAGU/2_4-AUCAGU.mcs
MCSYM-DB/2_4/AUCAUC/
MCSYM-DB/2_4/AUCAUC/2_4-AUCAUC.mcs
MCSYM-DB/2_4/AUCAUU/
MCSYM-DB/2_4/AUCAUU/2_4-AUCAUU.mcs
MCSYM-DB/2_4/AUCCAC/
MCSYM-DB/2_4/AUCCAC/2_4-AUCCAC.mcs
MCSYM-DB/2_4/AUCCAG/
MCSYM-DB/2_4/AUCCAG/2_4-AUCCAG.mcs
MCSYM-DB/2_4/AUCCAG/ds-2_4-AUCCAG_x.pdb.gz
MCSYM-DB/2_4/AUCCCU/
MCSYM-DB/2_4/AUCCCU/2_4-AUCCCU.mcs
MCSYM-DB/2_4/AUCCCU/ds-2_4-AUCCCU_x.pdb.gz
MCSYM-DB/2_4/AUCCUA/
MCSYM-DB/2_4/AUCCUA/2_4-AUCCUA.mcs
MCSYM-DB/2_4/AUCCUA/ds-2_4-AUCCUA_x.pdb.gz
MCSYM-DB/2_4/AUCCUG/
MCSYM-DB/2_4/AUCCUG/2_4-AUCCUG.mcs
MCSYM-DB/2_4/AUCCUU/
MCSYM-DB/2_4/AUCCUU/2_4-AUCCUU.mcs
MCSYM-DB/2_4/AUCUAU/
MCSYM-DB/2_4/AUCUAU/2_4-AUCUAU.mcs
MCSYM-DB/2_4/AUCUCC/
MCSYM-DB/2_4/AUCUCC/2_4-AUCUCC.mcs
MCSYM-DB/2_4/AUCUCU/
MCSYM-DB/2_4/AUCUCU/2_4-AUCUCU.mcs
MCSYM-DB/2_4/AUCUGC/
MCSYM-DB/2_4/AUCUGC/2_4-AUCUGC.mcs
MCSYM-DB/2_4/AUCUGC/ds-2_4-AUCUGC_x.pdb.gz
MCSYM-DB/2_4/AUCUUU/
MCSYM-DB/2_4/AUCUUU/2_4-AUCUUU.mcs
MCSYM-DB/2_4/AUCUUU/ds-2_4-AUCUUU_x.pdb.gz
MCSYM-DB/2_4/AUGAAU/
MCSYM-DB/2_4/AUGAAU/2_4-AUGAAU.mcs
MCSYM-DB/2_4/AUGAAU/ds-2_4-AUGAAU_x.pdb.gz
MCSYM-DB/2_4/AUGACU/
MCSYM-DB/2_4/AUGACU/2_4-AUGACU.mcs
MCSYM-DB/2_4/AUGACU/ds-2_4-AUGACU_x.pdb.gz
MCSYM-DB/2_4/AUGAUU/
MCSYM-DB/2_4/AUGAUU/2_4-AUGAUU.mcs
MCSYM-DB/2_4/AUGAUU/ds-2_4-AUGAUU_x.pdb.gz
MCSYM-DB/2_4/AUGCAU/
MCSYM-DB/2_4/AUGCAU/2_4-AUGCAU.mcs
MCSYM-DB/2_4/AUGCCU/
MCSYM-DB/2_4/AUGCCU/2_4-AUGCCU.mcs
MCSYM-DB/2_4/AUGCCU/ds-2_4-AUGCCU_x.pdb.gz
MCSYM-DB/2_4/AUGCGG/
MCSYM-DB/2_4/AUGCGG/2_4-AUGCGG.mcs
MCSYM-DB/2_4/AUGCGG/ds-2_4-AUGCGG_x.pdb.gz
MCSYM-DB/2_4/AUGCUC/
MCSYM-DB/2_4/AUGCUC/2_4-AUGCUC.mcs
MCSYM-DB/2_4/AUGCUU/
MCSYM-DB/2_4/AUGCUU/2_4-AUGCUU.mcs
MCSYM-DB/2_4/AUGCUU/ds-2_4-AUGCUU_x.pdb.gz
MCSYM-DB/2_4/AUGGAU/
MCSYM-DB/2_4/AUGGAU/2_4-AUGGAU.mcs
MCSYM-DB/2_4/AUGGAU/ds-2_4-AUGGAU_x.pdb.gz
MCSYM-DB/2_4/AUGGCA/
MCSYM-DB/2_4/AUGGCA/2_4-AUGGCA.mcs
MCSYM-DB/2_4/AUGGCU/
MCSYM-DB/2_4/AUGGCU/2_4-AUGGCU.mcs
MCSYM-DB/2_4/AUGGCU/ds-2_4-AUGGCU_x.pdb.gz
MCSYM-DB/2_4/AUGGGA/
MCSYM-DB/2_4/AUGGGA/2_4-AUGGGA.mcs
MCSYM-DB/2_4/AUGGGA/ds-2_4-AUGGGA_x.pdb.gz
MCSYM-DB/2_4/AUGGGU/
MCSYM-DB/2_4/AUGGGU/2_4-AUGGGU.mcs
MCSYM-DB/2_4/AUGGUC/
MCSYM-DB/2_4/AUGGUC/2_4-AUGGUC.mcs
MCSYM-DB/2_4/AUGGUG/
MCSYM-DB/2_4/AUGGUG/2_4-AUGGUG.mcs
MCSYM-DB/2_4/AUGGUG/ds-2_4-AUGGUG_x.pdb.gz
MCSYM-DB/2_4/AUGGUU/
MCSYM-DB/2_4/AUGGUU/2_4-AUGGUU.mcs
MCSYM-DB/2_4/AUGGUU/ds-2_4-AUGGUU_x.pdb.gz
MCSYM-DB/2_4/AUGUAA/
MCSYM-DB/2_4/AUGUAA/2_4-AUGUAA.mcs
MCSYM-DB/2_4/AUGUAC/
MCSYM-DB/2_4/AUGUAC/2_4-AUGUAC.mcs
MCSYM-DB/2_4/AUGUAU/
MCSYM-DB/2_4/AUGUAU/2_4-AUGUAU.mcs
MCSYM-DB/2_4/AUGUCC/
MCSYM-DB/2_4/AUGUCC/2_4-AUGUCC.mcs
MCSYM-DB/2_4/AUGUCU/
MCSYM-DB/2_4/AUGUCU/2_4-AUGUCU.mcs
MCSYM-DB/2_4/AUGUCU/ds-2_4-AUGUCU_x.pdb.gz
MCSYM-DB/2_4/AUGUGC/
MCSYM-DB/2_4/AUGUGC/2_4-AUGUGC.mcs
MCSYM-DB/2_4/AUGUGU/
MCSYM-DB/2_4/AUGUGU/2_4-AUGUGU.mcs
MCSYM-DB/2_4/AUGUUU/
MCSYM-DB/2_4/AUGUUU/2_4-AUGUUU.mcs
MCSYM-DB/2_4/AUGUUU/ds-2_4-AUGUUU_x.pdb.gz
MCSYM-DB/2_4/AUUAAU/
MCSYM-DB/2_4/AUUAAU/2_4-AUUAAU.mcs
MCSYM-DB/2_4/AUUACU/
MCSYM-DB/2_4/AUUACU/2_4-AUUACU.mcs
MCSYM-DB/2_4/AUUAGC/
MCSYM-DB/2_4/AUUAGC/2_4-AUUAGC.mcs
MCSYM-DB/2_4/AUUAGU/
MCSYM-DB/2_4/AUUAGU/2_4-AUUAGU.mcs
MCSYM-DB/2_4/AUUAUU/
MCSYM-DB/2_4/AUUAUU/2_4-AUUAUU.mcs
MCSYM-DB/2_4/AUUAUU/ds-2_4-AUUAUU_x.pdb.gz
MCSYM-DB/2_4/AUUCAU/
MCSYM-DB/2_4/AUUCAU/2_4-AUUCAU.mcs
MCSYM-DB/2_4/AUUCAU/ds-2_4-AUUCAU_x.pdb.gz
MCSYM-DB/2_4/AUUCCU/
MCSYM-DB/2_4/AUUCCU/2_4-AUUCCU.mcs
MCSYM-DB/2_4/AUUCGU/
MCSYM-DB/2_4/AUUCGU/2_4-AUUCGU.mcs
MCSYM-DB/2_4/AUUCUA/
MCSYM-DB/2_4/AUUCUA/2_4-AUUCUA.mcs
MCSYM-DB/2_4/AUUCUU/
MCSYM-DB/2_4/AUUCUU/2_4-AUUCUU.mcs
MCSYM-DB/2_4/AUUCUU/ds-2_4-AUUCUU_x.pdb.gz
MCSYM-DB/2_4/AUUGAG/
MCSYM-DB/2_4/AUUGAG/2_4-AUUGAG.mcs
MCSYM-DB/2_4/AUUGAU/
MCSYM-DB/2_4/AUUGAU/2_4-AUUGAU.mcs
MCSYM-DB/2_4/AUUGCU/
MCSYM-DB/2_4/AUUGCU/2_4-AUUGCU.mcs
MCSYM-DB/2_4/AUUGCU/ds-2_4-AUUGCU_x.pdb.gz
MCSYM-DB/2_4/AUUGGU/
MCSYM-DB/2_4/AUUGGU/2_4-AUUGGU.mcs
MCSYM-DB/2_4/AUUGUA/
MCSYM-DB/2_4/AUUGUA/2_4-AUUGUA.mcs
MCSYM-DB/2_4/AUUGUG/
MCSYM-DB/2_4/AUUGUG/2_4-AUUGUG.mcs
MCSYM-DB/2_4/AUUGUU/
MCSYM-DB/2_4/AUUGUU/2_4-AUUGUU.mcs
MCSYM-DB/2_4/AUUGUU/ds-2_4-AUUGUU_x.pdb.gz
MCSYM-DB/2_4/AUUUAU/
MCSYM-DB/2_4/AUUUAU/2_4-AUUUAU.mcs
MCSYM-DB/2_4/AUUUCU/
MCSYM-DB/2_4/AUUUCU/2_4-AUUUCU.mcs
MCSYM-DB/2_4/AUUUCU/ds-2_4-AUUUCU_x.pdb.gz
MCSYM-DB/2_4/AUUUGG/
MCSYM-DB/2_4/AUUUGG/2_4-AUUUGG.mcs
MCSYM-DB/2_4/AUUUUG/
MCSYM-DB/2_4/AUUUUG/2_4-AUUUUG.mcs
MCSYM-DB/2_4/AUUUUU/
MCSYM-DB/2_4/AUUUUU/2_4-AUUUUU.mcs
MCSYM-DB/2_4/AUUUUU/ds-2_4-AUUUUU_x.pdb.gz
MCSYM-DB/2_4/CAAAAA/
MCSYM-DB/2_4/CAAAAA/2_4-CAAAAA.mcs
MCSYM-DB/2_4/CAAAAG/
MCSYM-DB/2_4/CAAAAG/2_4-CAAAAG.mcs
MCSYM-DB/2_4/CAAAAG/ds-2_4-CAAAAG_x.pdb.gz
MCSYM-DB/2_4/CAAAAU/
MCSYM-DB/2_4/CAAAAU/2_4-CAAAAU.mcs
MCSYM-DB/2_4/CAAACA/
MCSYM-DB/2_4/CAAACA/2_4-CAAACA.mcs
MCSYM-DB/2_4/CAAACA/ds-2_4-CAAACA_x.pdb.gz
MCSYM-DB/2_4/CAAACG/
MCSYM-DB/2_4/CAAACG/2_4-CAAACG.mcs
MCSYM-DB/2_4/CAAACG/ds-2_4-CAAACG_x.pdb.gz
MCSYM-DB/2_4/CAAAGG/
MCSYM-DB/2_4/CAAAGG/2_4-CAAAGG.mcs
MCSYM-DB/2_4/CAAAGG/ds-2_4-CAAAGG_x.pdb.gz
MCSYM-DB/2_4/CAACAC/
MCSYM-DB/2_4/CAACAC/2_4-CAACAC.mcs
MCSYM-DB/2_4/CAACAC/ds-2_4-CAACAC_x.pdb.gz
MCSYM-DB/2_4/CAACAG/
MCSYM-DB/2_4/CAACAG/2_4-CAACAG.mcs
MCSYM-DB/2_4/CAACAG/ds-2_4-CAACAG_x.pdb.gz
MCSYM-DB/2_4/CAACCA/
MCSYM-DB/2_4/CAACCA/2_4-CAACCA.mcs
MCSYM-DB/2_4/CAACCG/
MCSYM-DB/2_4/CAACCG/2_4-CAACCG.mcs
MCSYM-DB/2_4/CAACCG/ds-2_4-CAACCG_x.pdb.gz
MCSYM-DB/2_4/CAACGG/
MCSYM-DB/2_4/CAACGG/2_4-CAACGG.mcs
MCSYM-DB/2_4/CAACUG/
MCSYM-DB/2_4/CAACUG/2_4-CAACUG.mcs
MCSYM-DB/2_4/CAACUG/ds-2_4-CAACUG_x.pdb.gz
MCSYM-DB/2_4/CAAGAG/
MCSYM-DB/2_4/CAAGAG/2_4-CAAGAG.mcs
MCSYM-DB/2_4/CAAGAG/ds-2_4-CAAGAG_x.pdb.gz
MCSYM-DB/2_4/CAAGCA/
MCSYM-DB/2_4/CAAGCA/2_4-CAAGCA.mcs
MCSYM-DB/2_4/CAAGGU/
MCSYM-DB/2_4/CAAGGU/2_4-CAAGGU.mcs
MCSYM-DB/2_4/CAAGUC/
MCSYM-DB/2_4/CAAGUC/2_4-CAAGUC.mcs
MCSYM-DB/2_4/CAAUAG/
MCSYM-DB/2_4/CAAUAG/2_4-CAAUAG.mcs
MCSYM-DB/2_4/CAAUAU/
MCSYM-DB/2_4/CAAUAU/2_4-CAAUAU.mcs
MCSYM-DB/2_4/CAAUCC/
MCSYM-DB/2_4/CAAUCC/2_4-CAAUCC.mcs
MCSYM-DB/2_4/CAAUCC/ds-2_4-CAAUCC_x.pdb.gz
MCSYM-DB/2_4/CAAUGG/
MCSYM-DB/2_4/CAAUGG/2_4-CAAUGG.mcs
MCSYM-DB/2_4/CAAUGG/ds-2_4-CAAUGG_x.pdb.gz
MCSYM-DB/2_4/CAAUUG/
MCSYM-DB/2_4/CAAUUG/2_4-CAAUUG.mcs
MCSYM-DB/2_4/CACAAA/
MCSYM-DB/2_4/CACAAA/2_4-CACAAA.mcs
MCSYM-DB/2_4/CACAAG/
MCSYM-DB/2_4/CACAAG/2_4-CACAAG.mcs
MCSYM-DB/2_4/CACACA/
MCSYM-DB/2_4/CACACA/2_4-CACACA.mcs
MCSYM-DB/2_4/CACACA/ds-2_4-CACACA_x.pdb.gz
MCSYM-DB/2_4/CACACC/
MCSYM-DB/2_4/CACACC/2_4-CACACC.mcs
MCSYM-DB/2_4/CACACC/ds-2_4-CACACC_x.pdb.gz
MCSYM-DB/2_4/CACACG/
MCSYM-DB/2_4/CACACG/2_4-CACACG.mcs
MCSYM-DB/2_4/CACACG/ds-2_4-CACACG_x.pdb.gz
MCSYM-DB/2_4/CACAUG/
MCSYM-DB/2_4/CACAUG/2_4-CACAUG.mcs
MCSYM-DB/2_4/CACCAG/
MCSYM-DB/2_4/CACCAG/2_4-CACCAG.mcs
MCSYM-DB/2_4/CACCAG/ds-2_4-CACCAG_x.pdb.gz
MCSYM-DB/2_4/CACCCA/
MCSYM-DB/2_4/CACCCA/2_4-CACCCA.mcs
MCSYM-DB/2_4/CACCCA/ds-2_4-CACCCA_x.pdb.gz
MCSYM-DB/2_4/CACCCC/
MCSYM-DB/2_4/CACCCC/2_4-CACCCC.mcs
MCSYM-DB/2_4/CACCCC/ds-2_4-CACCCC_x.pdb.gz
MCSYM-DB/2_4/CACCCG/
MCSYM-DB/2_4/CACCCG/2_4-CACCCG.mcs
MCSYM-DB/2_4/CACCCG/ds-2_4-CACCCG_x.pdb.gz
MCSYM-DB/2_4/CACGGC/
MCSYM-DB/2_4/CACGGC/2_4-CACGGC.mcs
MCSYM-DB/2_4/CACGGC/ds-2_4-CACGGC_x.pdb.gz
MCSYM-DB/2_4/CACGGG/
MCSYM-DB/2_4/CACGGG/2_4-CACGGG.mcs
MCSYM-DB/2_4/CACGUG/
MCSYM-DB/2_4/CACGUG/2_4-CACGUG.mcs
MCSYM-DB/2_4/CACUAG/
MCSYM-DB/2_4/CACUAG/2_4-CACUAG.mcs
MCSYM-DB/2_4/CACUCG/
MCSYM-DB/2_4/CACUCG/2_4-CACUCG.mcs
MCSYM-DB/2_4/CACUGG/
MCSYM-DB/2_4/CACUGG/2_4-CACUGG.mcs
MCSYM-DB/2_4/CACUUG/
MCSYM-DB/2_4/CACUUG/2_4-CACUUG.mcs
MCSYM-DB/2_4/CAGAAA/
MCSYM-DB/2_4/CAGAAA/2_4-CAGAAA.mcs
MCSYM-DB/2_4/CAGAAA/ds-2_4-CAGAAA_x.pdb.gz
MCSYM-DB/2_4/CAGAAG/
MCSYM-DB/2_4/CAGAAG/2_4-CAGAAG.mcs
MCSYM-DB/2_4/CAGAAG/ds-2_4-CAGAAG_x.pdb.gz
MCSYM-DB/2_4/CAGACG/
MCSYM-DB/2_4/CAGACG/2_4-CAGACG.mcs
MCSYM-DB/2_4/CAGACG/ds-2_4-CAGACG_x.pdb.gz
MCSYM-DB/2_4/CAGAGG/
MCSYM-DB/2_4/CAGAGG/2_4-CAGAGG.mcs
MCSYM-DB/2_4/CAGAGG/ds-2_4-CAGAGG_x.pdb.gz
MCSYM-DB/2_4/CAGAGU/
MCSYM-DB/2_4/CAGAGU/2_4-CAGAGU.mcs
MCSYM-DB/2_4/CAGAGU/ds-2_4-CAGAGU_x.pdb.gz
MCSYM-DB/2_4/CAGAUG/
MCSYM-DB/2_4/CAGAUG/2_4-CAGAUG.mcs
MCSYM-DB/2_4/CAGCAG/
MCSYM-DB/2_4/CAGCAG/2_4-CAGCAG.mcs
MCSYM-DB/2_4/CAGCAG/ds-2_4-CAGCAG_x.pdb.gz
MCSYM-DB/2_4/CAGCCG/
MCSYM-DB/2_4/CAGCCG/2_4-CAGCCG.mcs
MCSYM-DB/2_4/CAGCCG/ds-2_4-CAGCCG_x.pdb.gz
MCSYM-DB/2_4/CAGCUC/
MCSYM-DB/2_4/CAGCUC/2_4-CAGCUC.mcs
MCSYM-DB/2_4/CAGCUC/ds-2_4-CAGCUC_x.pdb.gz
MCSYM-DB/2_4/CAGCUG/
MCSYM-DB/2_4/CAGCUG/2_4-CAGCUG.mcs
MCSYM-DB/2_4/CAGCUG/ds-2_4-CAGCUG_x.pdb.gz
MCSYM-DB/2_4/CAGGAG/
MCSYM-DB/2_4/CAGGAG/2_4-CAGGAG.mcs
MCSYM-DB/2_4/CAGGGC/
MCSYM-DB/2_4/CAGGGC/2_4-CAGGGC.mcs
MCSYM-DB/2_4/CAGGGC/ds-2_4-CAGGGC_x.pdb.gz
MCSYM-DB/2_4/CAGGGG/
MCSYM-DB/2_4/CAGGGG/2_4-CAGGGG.mcs
MCSYM-DB/2_4/CAGGGG/ds-2_4-CAGGGG_x.pdb.gz
MCSYM-DB/2_4/CAGUAG/
MCSYM-DB/2_4/CAGUAG/2_4-CAGUAG.mcs
MCSYM-DB/2_4/CAGUCC/
MCSYM-DB/2_4/CAGUCC/2_4-CAGUCC.mcs
MCSYM-DB/2_4/CAGUCC/ds-2_4-CAGUCC_x.pdb.gz
MCSYM-DB/2_4/CAGUCG/
MCSYM-DB/2_4/CAGUCG/2_4-CAGUCG.mcs
MCSYM-DB/2_4/CAGUCG/ds-2_4-CAGUCG_x.pdb.gz
MCSYM-DB/2_4/CAGUGG/
MCSYM-DB/2_4/CAGUGG/2_4-CAGUGG.mcs
MCSYM-DB/2_4/CAGUUG/
MCSYM-DB/2_4/CAGUUG/2_4-CAGUUG.mcs
MCSYM-DB/2_4/CAGUUG/ds-2_4-CAGUUG_x.pdb.gz
MCSYM-DB/2_4/CAGUUU/
MCSYM-DB/2_4/CAGUUU/2_4-CAGUUU.mcs
MCSYM-DB/2_4/CAGUUU/ds-2_4-CAGUUU_x.pdb.gz
MCSYM-DB/2_4/CAUAAA/
MCSYM-DB/2_4/CAUAAA/2_4-CAUAAA.mcs
MCSYM-DB/2_4/CAUAAC/
MCSYM-DB/2_4/CAUAAC/2_4-CAUAAC.mcs
MCSYM-DB/2_4/CAUAAC/ds-2_4-CAUAAC_x.pdb.gz
MCSYM-DB/2_4/CAUAAG/
MCSYM-DB/2_4/CAUAAG/2_4-CAUAAG.mcs
MCSYM-DB/2_4/CAUAAG/ds-2_4-CAUAAG_x.pdb.gz
MCSYM-DB/2_4/CAUAAU/
MCSYM-DB/2_4/CAUAAU/2_4-CAUAAU.mcs
MCSYM-DB/2_4/CAUACA/
MCSYM-DB/2_4/CAUACA/2_4-CAUACA.mcs
MCSYM-DB/2_4/CAUACC/
MCSYM-DB/2_4/CAUACC/2_4-CAUACC.mcs
MCSYM-DB/2_4/CAUACC/ds-2_4-CAUACC_x.pdb.gz
MCSYM-DB/2_4/CAUACG/
MCSYM-DB/2_4/CAUACG/2_4-CAUACG.mcs
MCSYM-DB/2_4/CAUACG/ds-2_4-CAUACG_x.pdb.gz
MCSYM-DB/2_4/CAUAGG/
MCSYM-DB/2_4/CAUAGG/2_4-CAUAGG.mcs
MCSYM-DB/2_4/CAUAGG/ds-2_4-CAUAGG_x.pdb.gz
MCSYM-DB/2_4/CAUAUA/
MCSYM-DB/2_4/CAUAUA/2_4-CAUAUA.mcs
MCSYM-DB/2_4/CAUAUA/ds-2_4-CAUAUA_x.pdb.gz
MCSYM-DB/2_4/CAUAUC/
MCSYM-DB/2_4/CAUAUC/2_4-CAUAUC.mcs
MCSYM-DB/2_4/CAUAUC/ds-2_4-CAUAUC_x.pdb.gz
MCSYM-DB/2_4/CAUAUG/
MCSYM-DB/2_4/CAUAUG/2_4-CAUAUG.mcs
MCSYM-DB/2_4/CAUAUG/ds-2_4-CAUAUG_x.pdb.gz
MCSYM-DB/2_4/CAUCAA/
MCSYM-DB/2_4/CAUCAA/2_4-CAUCAA.mcs
MCSYM-DB/2_4/CAUCAA/ds-2_4-CAUCAA_x.pdb.gz
MCSYM-DB/2_4/CAUCAC/
MCSYM-DB/2_4/CAUCAC/2_4-CAUCAC.mcs
MCSYM-DB/2_4/CAUCAG/
MCSYM-DB/2_4/CAUCAG/2_4-CAUCAG.mcs
MCSYM-DB/2_4/CAUCAG/ds-2_4-CAUCAG_x.pdb.gz
MCSYM-DB/2_4/CAUCCG/
MCSYM-DB/2_4/CAUCCG/2_4-CAUCCG.mcs
MCSYM-DB/2_4/CAUCCG/ds-2_4-CAUCCG_x.pdb.gz
MCSYM-DB/2_4/CAUCGG/
MCSYM-DB/2_4/CAUCGG/2_4-CAUCGG.mcs
MCSYM-DB/2_4/CAUCGG/ds-2_4-CAUCGG_x.pdb.gz
MCSYM-DB/2_4/CAUCUG/
MCSYM-DB/2_4/CAUCUG/2_4-CAUCUG.mcs
MCSYM-DB/2_4/CAUCUG/ds-2_4-CAUCUG_x.pdb.gz
MCSYM-DB/2_4/CAUGAC/
MCSYM-DB/2_4/CAUGAC/2_4-CAUGAC.mcs
MCSYM-DB/2_4/CAUGAG/
MCSYM-DB/2_4/CAUGAG/2_4-CAUGAG.mcs
MCSYM-DB/2_4/CAUGAG/ds-2_4-CAUGAG_x.pdb.gz
MCSYM-DB/2_4/CAUGCG/
MCSYM-DB/2_4/CAUGCG/2_4-CAUGCG.mcs
MCSYM-DB/2_4/CAUGCG/ds-2_4-CAUGCG_x.pdb.gz
MCSYM-DB/2_4/CAUGGG/
MCSYM-DB/2_4/CAUGGG/2_4-CAUGGG.mcs
MCSYM-DB/2_4/CAUGGG/ds-2_4-CAUGGG_x.pdb.gz
MCSYM-DB/2_4/CAUGUG/
MCSYM-DB/2_4/CAUGUG/2_4-CAUGUG.mcs
MCSYM-DB/2_4/CAUGUG/ds-2_4-CAUGUG_x.pdb.gz
MCSYM-DB/2_4/CAUUAA/
MCSYM-DB/2_4/CAUUAA/2_4-CAUUAA.mcs
MCSYM-DB/2_4/CAUUAC/
MCSYM-DB/2_4/CAUUAC/2_4-CAUUAC.mcs
MCSYM-DB/2_4/CAUUAC/ds-2_4-CAUUAC_x.pdb.gz
MCSYM-DB/2_4/CAUUAG/
MCSYM-DB/2_4/CAUUAG/2_4-CAUUAG.mcs
MCSYM-DB/2_4/CAUUAG/ds-2_4-CAUUAG_x.pdb.gz
MCSYM-DB/2_4/CAUUCA/
MCSYM-DB/2_4/CAUUCA/2_4-CAUUCA.mcs
MCSYM-DB/2_4/CAUUCA/ds-2_4-CAUUCA_x.pdb.gz
MCSYM-DB/2_4/CAUUCC/
MCSYM-DB/2_4/CAUUCC/2_4-CAUUCC.mcs
MCSYM-DB/2_4/CAUUCC/ds-2_4-CAUUCC_x.pdb.gz
MCSYM-DB/2_4/CAUUCG/
MCSYM-DB/2_4/CAUUCG/2_4-CAUUCG.mcs
MCSYM-DB/2_4/CAUUCG/ds-2_4-CAUUCG_x.pdb.gz
MCSYM-DB/2_4/CAUUCU/
MCSYM-DB/2_4/CAUUCU/2_4-CAUUCU.mcs
MCSYM-DB/2_4/CAUUGA/
MCSYM-DB/2_4/CAUUGA/2_4-CAUUGA.mcs
MCSYM-DB/2_4/CAUUGA/ds-2_4-CAUUGA_x.pdb.gz
MCSYM-DB/2_4/CAUUGG/
MCSYM-DB/2_4/CAUUGG/2_4-CAUUGG.mcs
MCSYM-DB/2_4/CAUUGG/ds-2_4-CAUUGG_x.pdb.gz
MCSYM-DB/2_4/CAUUUA/
MCSYM-DB/2_4/CAUUUA/2_4-CAUUUA.mcs
MCSYM-DB/2_4/CAUUUA/ds-2_4-CAUUUA_x.pdb.gz
MCSYM-DB/2_4/CAUUUC/
MCSYM-DB/2_4/CAUUUC/2_4-CAUUUC.mcs
MCSYM-DB/2_4/CAUUUG/
MCSYM-DB/2_4/CAUUUG/2_4-CAUUUG.mcs
MCSYM-DB/2_4/CAUUUG/ds-2_4-CAUUUG_x.pdb.gz
MCSYM-DB/2_4/CAUUUU/
MCSYM-DB/2_4/CAUUUU/2_4-CAUUUU.mcs
MCSYM-DB/2_4/CCAAAA/
MCSYM-DB/2_4/CCAAAA/2_4-CCAAAA.mcs
MCSYM-DB/2_4/CCAAAC/
MCSYM-DB/2_4/CCAAAC/2_4-CCAAAC.mcs
MCSYM-DB/2_4/CCAAAC/ds-2_4-CCAAAC_x.pdb.gz
MCSYM-DB/2_4/CCAAAG/
MCSYM-DB/2_4/CCAAAG/2_4-CCAAAG.mcs
MCSYM-DB/2_4/CCAAAG/ds-2_4-CCAAAG_x.pdb.gz
MCSYM-DB/2_4/CCAAGG/
MCSYM-DB/2_4/CCAAGG/2_4-CCAAGG.mcs
MCSYM-DB/2_4/CCAAUA/
MCSYM-DB/2_4/CCAAUA/2_4-CCAAUA.mcs
MCSYM-DB/2_4/CCAAUG/
MCSYM-DB/2_4/CCAAUG/2_4-CCAAUG.mcs
MCSYM-DB/2_4/CCAAUU/
MCSYM-DB/2_4/CCAAUU/2_4-CCAAUU.mcs
MCSYM-DB/2_4/CCACAG/
MCSYM-DB/2_4/CCACAG/2_4-CCACAG.mcs
MCSYM-DB/2_4/CCACAG/ds-2_4-CCACAG_x.pdb.gz
MCSYM-DB/2_4/CCACCG/
MCSYM-DB/2_4/CCACCG/2_4-CCACCG.mcs
MCSYM-DB/2_4/CCACCG/ds-2_4-CCACCG_x.pdb.gz
MCSYM-DB/2_4/CCACUA/
MCSYM-DB/2_4/CCACUA/2_4-CCACUA.mcs
MCSYM-DB/2_4/CCACUG/
MCSYM-DB/2_4/CCACUG/2_4-CCACUG.mcs
MCSYM-DB/2_4/CCACUG/ds-2_4-CCACUG_x.pdb.gz
MCSYM-DB/2_4/CCACUU/
MCSYM-DB/2_4/CCACUU/2_4-CCACUU.mcs
MCSYM-DB/2_4/CCAGCC/
MCSYM-DB/2_4/CCAGCC/2_4-CCAGCC.mcs
MCSYM-DB/2_4/CCAGCC/ds-2_4-CCAGCC_x.pdb.gz
MCSYM-DB/2_4/CCAGUG/
MCSYM-DB/2_4/CCAGUG/2_4-CCAGUG.mcs
MCSYM-DB/2_4/CCAUAG/
MCSYM-DB/2_4/CCAUAG/2_4-CCAUAG.mcs
MCSYM-DB/2_4/CCAUCA/
MCSYM-DB/2_4/CCAUCA/2_4-CCAUCA.mcs
MCSYM-DB/2_4/CCAUGG/
MCSYM-DB/2_4/CCAUGG/2_4-CCAUGG.mcs
MCSYM-DB/2_4/CCAUUA/
MCSYM-DB/2_4/CCAUUA/2_4-CCAUUA.mcs
MCSYM-DB/2_4/CCAUUG/
MCSYM-DB/2_4/CCAUUG/2_4-CCAUUG.mcs
MCSYM-DB/2_4/CCAUUG/ds-2_4-CCAUUG_x.pdb.gz
MCSYM-DB/2_4/CCCAAG/
MCSYM-DB/2_4/CCCAAG/2_4-CCCAAG.mcs
MCSYM-DB/2_4/CCCAAG/ds-2_4-CCCAAG_x.pdb.gz
MCSYM-DB/2_4/CCCAAU/
MCSYM-DB/2_4/CCCAAU/2_4-CCCAAU.mcs
MCSYM-DB/2_4/CCCACA/
MCSYM-DB/2_4/CCCACA/2_4-CCCACA.mcs
MCSYM-DB/2_4/CCCACA/ds-2_4-CCCACA_x.pdb.gz
MCSYM-DB/2_4/CCCACC/
MCSYM-DB/2_4/CCCACC/2_4-CCCACC.mcs
MCSYM-DB/2_4/CCCACC/ds-2_4-CCCACC_x.pdb.gz
MCSYM-DB/2_4/CCCACG/
MCSYM-DB/2_4/CCCACG/2_4-CCCACG.mcs
MCSYM-DB/2_4/CCCACG/ds-2_4-CCCACG_x.pdb.gz
MCSYM-DB/2_4/CCCAGC/
MCSYM-DB/2_4/CCCAGC/2_4-CCCAGC.mcs
MCSYM-DB/2_4/CCCAGC/ds-2_4-CCCAGC_x.pdb.gz
MCSYM-DB/2_4/CCCAGG/
MCSYM-DB/2_4/CCCAGG/2_4-CCCAGG.mcs
MCSYM-DB/2_4/CCCAUC/
MCSYM-DB/2_4/CCCAUC/2_4-CCCAUC.mcs
MCSYM-DB/2_4/CCCAUC/ds-2_4-CCCAUC_x.pdb.gz
MCSYM-DB/2_4/CCCAUG/
MCSYM-DB/2_4/CCCAUG/2_4-CCCAUG.mcs
MCSYM-DB/2_4/CCCAUG/ds-2_4-CCCAUG_x.pdb.gz
MCSYM-DB/2_4/CCCCAC/
MCSYM-DB/2_4/CCCCAC/2_4-CCCCAC.mcs
MCSYM-DB/2_4/CCCCAG/
MCSYM-DB/2_4/CCCCAG/2_4-CCCCAG.mcs
MCSYM-DB/2_4/CCCCAG/ds-2_4-CCCCAG_x.pdb.gz
MCSYM-DB/2_4/CCCCCC/
MCSYM-DB/2_4/CCCCCC/2_4-CCCCCC.mcs
MCSYM-DB/2_4/CCCCCC/ds-2_4-CCCCCC_x.pdb.gz
MCSYM-DB/2_4/CCCCCG/
MCSYM-DB/2_4/CCCCCG/2_4-CCCCCG.mcs
MCSYM-DB/2_4/CCCCCG/ds-2_4-CCCCCG_x.pdb.gz
MCSYM-DB/2_4/CCCCUC/
MCSYM-DB/2_4/CCCCUC/2_4-CCCCUC.mcs
MCSYM-DB/2_4/CCCCUC/ds-2_4-CCCCUC_x.pdb.gz
MCSYM-DB/2_4/CCCCUG/
MCSYM-DB/2_4/CCCCUG/2_4-CCCCUG.mcs
MCSYM-DB/2_4/CCCCUG/ds-2_4-CCCCUG_x.pdb.gz
MCSYM-DB/2_4/CCCCUU/
MCSYM-DB/2_4/CCCCUU/2_4-CCCCUU.mcs
MCSYM-DB/2_4/CCCGAG/
MCSYM-DB/2_4/CCCGAG/2_4-CCCGAG.mcs
MCSYM-DB/2_4/CCCUAC/
MCSYM-DB/2_4/CCCUAC/2_4-CCCUAC.mcs
MCSYM-DB/2_4/CCCUAC/ds-2_4-CCCUAC_x.pdb.gz
MCSYM-DB/2_4/CCCUAG/
MCSYM-DB/2_4/CCCUAG/2_4-CCCUAG.mcs
MCSYM-DB/2_4/CCCUAG/ds-2_4-CCCUAG_x.pdb.gz
MCSYM-DB/2_4/CCCUCG/
MCSYM-DB/2_4/CCCUCG/2_4-CCCUCG.mcs
MCSYM-DB/2_4/CCCUCG/ds-2_4-CCCUCG_x.pdb.gz
MCSYM-DB/2_4/CCCUUG/
MCSYM-DB/2_4/CCCUUG/2_4-CCCUUG.mcs
MCSYM-DB/2_4/CCCUUG/ds-2_4-CCCUUG_x.pdb.gz
MCSYM-DB/2_4/CCCUUU/
MCSYM-DB/2_4/CCCUUU/2_4-CCCUUU.mcs
MCSYM-DB/2_4/CCGAAA/
MCSYM-DB/2_4/CCGAAA/2_4-CCGAAA.mcs
MCSYM-DB/2_4/CCGAAA/ds-2_4-CCGAAA_x.pdb.gz
MCSYM-DB/2_4/CCGAAC/
MCSYM-DB/2_4/CCGAAC/2_4-CCGAAC.mcs
MCSYM-DB/2_4/CCGAAC/ds-2_4-CCGAAC_x.pdb.gz
MCSYM-DB/2_4/CCGAAG/
MCSYM-DB/2_4/CCGAAG/1JUR_model_1.pdb.gz
MCSYM-DB/2_4/CCGAAG/1MJI_model_1.pdb.gz
MCSYM-DB/2_4/CCGAAG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/CCGAAG/2_4-CCGAAG.mcs
MCSYM-DB/2_4/CCGAAG/ds-2_4-CCGAAG_x.pdb.gz
MCSYM-DB/2_4/CCGAAU/
MCSYM-DB/2_4/CCGAAU/2_4-CCGAAU.mcs
MCSYM-DB/2_4/CCGACA/
MCSYM-DB/2_4/CCGACA/2_4-CCGACA.mcs
MCSYM-DB/2_4/CCGACC/
MCSYM-DB/2_4/CCGACC/2_4-CCGACC.mcs
MCSYM-DB/2_4/CCGACC/ds-2_4-CCGACC_x.pdb.gz
MCSYM-DB/2_4/CCGACG/
MCSYM-DB/2_4/CCGACG/2_4-CCGACG.mcs
MCSYM-DB/2_4/CCGACG/ds-2_4-CCGACG_x.pdb.gz
MCSYM-DB/2_4/CCGACU/
MCSYM-DB/2_4/CCGACU/2_4-CCGACU.mcs
MCSYM-DB/2_4/CCGAGG/
MCSYM-DB/2_4/CCGAGG/2_4-CCGAGG.mcs
MCSYM-DB/2_4/CCGAGG/ds-2_4-CCGAGG_x.pdb.gz
MCSYM-DB/2_4/CCGAGU/
MCSYM-DB/2_4/CCGAGU/2_4-CCGAGU.mcs
MCSYM-DB/2_4/CCGAUC/
MCSYM-DB/2_4/CCGAUC/2_4-CCGAUC.mcs
MCSYM-DB/2_4/CCGAUC/ds-2_4-CCGAUC_x.pdb.gz
MCSYM-DB/2_4/CCGAUG/
MCSYM-DB/2_4/CCGAUG/2_4-CCGAUG.mcs
MCSYM-DB/2_4/CCGAUG/ds-2_4-CCGAUG_x.pdb.gz
MCSYM-DB/2_4/CCGAUU/
MCSYM-DB/2_4/CCGAUU/2_4-CCGAUU.mcs
MCSYM-DB/2_4/CCGCAC/
MCSYM-DB/2_4/CCGCAC/2_4-CCGCAC.mcs
MCSYM-DB/2_4/CCGCAC/ds-2_4-CCGCAC_x.pdb.gz
MCSYM-DB/2_4/CCGCAG/
MCSYM-DB/2_4/CCGCAG/2_4-CCGCAG.mcs
MCSYM-DB/2_4/CCGCAG/ds-2_4-CCGCAG_x.pdb.gz
MCSYM-DB/2_4/CCGCAU/
MCSYM-DB/2_4/CCGCAU/2_4-CCGCAU.mcs
MCSYM-DB/2_4/CCGCCC/
MCSYM-DB/2_4/CCGCCC/2_4-CCGCCC.mcs
MCSYM-DB/2_4/CCGCCC/ds-2_4-CCGCCC_x.pdb.gz
MCSYM-DB/2_4/CCGCCG/
MCSYM-DB/2_4/CCGCCG/2_4-CCGCCG.mcs
MCSYM-DB/2_4/CCGCCG/ds-2_4-CCGCCG_x.pdb.gz
MCSYM-DB/2_4/CCGCCU/
MCSYM-DB/2_4/CCGCCU/2_4-CCGCCU.mcs
MCSYM-DB/2_4/CCGCGG/
MCSYM-DB/2_4/CCGCGG/2_4-CCGCGG.mcs
MCSYM-DB/2_4/CCGCGG/ds-2_4-CCGCGG_x.pdb.gz
MCSYM-DB/2_4/CCGCUC/
MCSYM-DB/2_4/CCGCUC/2_4-CCGCUC.mcs
MCSYM-DB/2_4/CCGCUC/ds-2_4-CCGCUC_x.pdb.gz
MCSYM-DB/2_4/CCGCUG/
MCSYM-DB/2_4/CCGCUG/2_4-CCGCUG.mcs
MCSYM-DB/2_4/CCGCUG/ds-2_4-CCGCUG_x.pdb.gz
MCSYM-DB/2_4/CCGCUU/
MCSYM-DB/2_4/CCGCUU/2_4-CCGCUU.mcs
MCSYM-DB/2_4/CCGGAG/
MCSYM-DB/2_4/CCGGAG/2_4-CCGGAG.mcs
MCSYM-DB/2_4/CCGGAG/ds-2_4-CCGGAG_x.pdb.gz
MCSYM-DB/2_4/CCGGAU/
MCSYM-DB/2_4/CCGGAU/2_4-CCGGAU.mcs
MCSYM-DB/2_4/CCGGCC/
MCSYM-DB/2_4/CCGGCC/2_4-CCGGCC.mcs
MCSYM-DB/2_4/CCGGCC/ds-2_4-CCGGCC_x.pdb.gz
MCSYM-DB/2_4/CCGGCG/
MCSYM-DB/2_4/CCGGCG/2_4-CCGGCG.mcs
MCSYM-DB/2_4/CCGGCG/ds-2_4-CCGGCG_x.pdb.gz
MCSYM-DB/2_4/CCGGGC/
MCSYM-DB/2_4/CCGGGC/2_4-CCGGGC.mcs
MCSYM-DB/2_4/CCGGGC/ds-2_4-CCGGGC_x.pdb.gz
MCSYM-DB/2_4/CCGGGG/
MCSYM-DB/2_4/CCGGGG/2_4-CCGGGG.mcs
MCSYM-DB/2_4/CCGGUC/
MCSYM-DB/2_4/CCGGUC/2_4-CCGGUC.mcs
MCSYM-DB/2_4/CCGGUG/
MCSYM-DB/2_4/CCGGUG/2_4-CCGGUG.mcs
MCSYM-DB/2_4/CCGGUG/ds-2_4-CCGGUG_x.pdb.gz
MCSYM-DB/2_4/CCGGUU/
MCSYM-DB/2_4/CCGGUU/2_4-CCGGUU.mcs
MCSYM-DB/2_4/CCGUAC/
MCSYM-DB/2_4/CCGUAC/2_4-CCGUAC.mcs
MCSYM-DB/2_4/CCGUAC/ds-2_4-CCGUAC_x.pdb.gz
MCSYM-DB/2_4/CCGUAG/
MCSYM-DB/2_4/CCGUAG/2_4-CCGUAG.mcs
MCSYM-DB/2_4/CCGUAG/ds-2_4-CCGUAG_x.pdb.gz
MCSYM-DB/2_4/CCGUCA/
MCSYM-DB/2_4/CCGUCA/2_4-CCGUCA.mcs
MCSYM-DB/2_4/CCGUCA/ds-2_4-CCGUCA_x.pdb.gz
MCSYM-DB/2_4/CCGUCC/
MCSYM-DB/2_4/CCGUCC/2_4-CCGUCC.mcs
MCSYM-DB/2_4/CCGUCC/ds-2_4-CCGUCC_x.pdb.gz
MCSYM-DB/2_4/CCGUCG/
MCSYM-DB/2_4/CCGUCG/1FG0_model_1.pdb.gz
MCSYM-DB/2_4/CCGUCG/1NBK_model_1.pdb.gz
MCSYM-DB/2_4/CCGUCG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/CCGUCG/2_4-CCGUCG.mcs
MCSYM-DB/2_4/CCGUCG/ds-2_4-CCGUCG_x.pdb.gz
MCSYM-DB/2_4/CCGUCU/
MCSYM-DB/2_4/CCGUCU/2_4-CCGUCU.mcs
MCSYM-DB/2_4/CCGUCU/ds-2_4-CCGUCU_x.pdb.gz
MCSYM-DB/2_4/CCGUGA/
MCSYM-DB/2_4/CCGUGA/2_4-CCGUGA.mcs
MCSYM-DB/2_4/CCGUGG/
MCSYM-DB/2_4/CCGUGG/2_4-CCGUGG.mcs
MCSYM-DB/2_4/CCGUGG/ds-2_4-CCGUGG_x.pdb.gz
MCSYM-DB/2_4/CCGUUA/
MCSYM-DB/2_4/CCGUUA/2_4-CCGUUA.mcs
MCSYM-DB/2_4/CCGUUA/ds-2_4-CCGUUA_x.pdb.gz
MCSYM-DB/2_4/CCGUUC/
MCSYM-DB/2_4/CCGUUC/2_4-CCGUUC.mcs
MCSYM-DB/2_4/CCGUUC/ds-2_4-CCGUUC_x.pdb.gz
MCSYM-DB/2_4/CCGUUG/
MCSYM-DB/2_4/CCGUUG/2_4-CCGUUG.mcs
MCSYM-DB/2_4/CCGUUG/ds-2_4-CCGUUG_x.pdb.gz
MCSYM-DB/2_4/CCGUUU/
MCSYM-DB/2_4/CCGUUU/2_4-CCGUUU.mcs
MCSYM-DB/2_4/CCUAAG/
MCSYM-DB/2_4/CCUAAG/2_4-CCUAAG.mcs
MCSYM-DB/2_4/CCUACC/
MCSYM-DB/2_4/CCUACC/2_4-CCUACC.mcs
MCSYM-DB/2_4/CCUACC/ds-2_4-CCUACC_x.pdb.gz
MCSYM-DB/2_4/CCUACG/
MCSYM-DB/2_4/CCUACG/2_4-CCUACG.mcs
MCSYM-DB/2_4/CCUAUG/
MCSYM-DB/2_4/CCUAUG/2_4-CCUAUG.mcs
MCSYM-DB/2_4/CCUCCA/
MCSYM-DB/2_4/CCUCCA/2_4-CCUCCA.mcs
MCSYM-DB/2_4/CCUCCA/ds-2_4-CCUCCA_x.pdb.gz
MCSYM-DB/2_4/CCUCCC/
MCSYM-DB/2_4/CCUCCC/2_4-CCUCCC.mcs
MCSYM-DB/2_4/CCUCUG/
MCSYM-DB/2_4/CCUCUG/2_4-CCUCUG.mcs
MCSYM-DB/2_4/CCUGAC/
MCSYM-DB/2_4/CCUGAC/2_4-CCUGAC.mcs
MCSYM-DB/2_4/CCUGUG/
MCSYM-DB/2_4/CCUGUG/2_4-CCUGUG.mcs
MCSYM-DB/2_4/CCUGUG/ds-2_4-CCUGUG_x.pdb.gz
MCSYM-DB/2_4/CCUUAG/
MCSYM-DB/2_4/CCUUAG/2_4-CCUUAG.mcs
MCSYM-DB/2_4/CCUUCA/
MCSYM-DB/2_4/CCUUCA/2_4-CCUUCA.mcs
MCSYM-DB/2_4/CCUUCC/
MCSYM-DB/2_4/CCUUCC/2_4-CCUUCC.mcs
MCSYM-DB/2_4/CCUUCC/ds-2_4-CCUUCC_x.pdb.gz
MCSYM-DB/2_4/CCUUCG/
MCSYM-DB/2_4/CCUUCG/2_4-CCUUCG.mcs
MCSYM-DB/2_4/CCUUCG/ds-2_4-CCUUCG_x.pdb.gz
MCSYM-DB/2_4/CCUUCU/
MCSYM-DB/2_4/CCUUCU/2_4-CCUUCU.mcs
MCSYM-DB/2_4/CCUUGG/
MCSYM-DB/2_4/CCUUGG/2_4-CCUUGG.mcs
MCSYM-DB/2_4/CCUUUG/
MCSYM-DB/2_4/CCUUUG/2_4-CCUUUG.mcs
MCSYM-DB/2_4/CGAAAG/
MCSYM-DB/2_4/CGAAAG/2_4-CGAAAG.mcs
MCSYM-DB/2_4/CGAAAG/ds-2_4-CGAAAG_x.pdb.gz
MCSYM-DB/2_4/CGAAGA/
MCSYM-DB/2_4/CGAAGA/2_4-CGAAGA.mcs
MCSYM-DB/2_4/CGAAGA/ds-2_4-CGAAGA_x.pdb.gz
MCSYM-DB/2_4/CGAAGC/
MCSYM-DB/2_4/CGAAGC/2_4-CGAAGC.mcs
MCSYM-DB/2_4/CGAAGC/ds-2_4-CGAAGC_x.pdb.gz
MCSYM-DB/2_4/CGAAGG/
MCSYM-DB/2_4/CGAAGG/2_4-CGAAGG.mcs
MCSYM-DB/2_4/CGAAGG/ds-2_4-CGAAGG_x.pdb.gz
MCSYM-DB/2_4/CGAAUG/
MCSYM-DB/2_4/CGAAUG/2_4-CGAAUG.mcs
MCSYM-DB/2_4/CGAAUG/ds-2_4-CGAAUG_x.pdb.gz
MCSYM-DB/2_4/CGAGCC/
MCSYM-DB/2_4/CGAGCC/2_4-CGAGCC.mcs
MCSYM-DB/2_4/CGAGCC/ds-2_4-CGAGCC_x.pdb.gz
MCSYM-DB/2_4/CGAGCG/
MCSYM-DB/2_4/CGAGCG/2_4-CGAGCG.mcs
MCSYM-DB/2_4/CGAGCG/ds-2_4-CGAGCG_x.pdb.gz
MCSYM-DB/2_4/CGAGGG/
MCSYM-DB/2_4/CGAGGG/2_4-CGAGGG.mcs
MCSYM-DB/2_4/CGAGGG/ds-2_4-CGAGGG_x.pdb.gz
MCSYM-DB/2_4/CGAUAG/
MCSYM-DB/2_4/CGAUAG/2_4-CGAUAG.mcs
MCSYM-DB/2_4/CGAUCC/
MCSYM-DB/2_4/CGAUCC/2_4-CGAUCC.mcs
MCSYM-DB/2_4/CGAUCC/ds-2_4-CGAUCC_x.pdb.gz
MCSYM-DB/2_4/CGAUCG/
MCSYM-DB/2_4/CGAUCG/2_4-CGAUCG.mcs
MCSYM-DB/2_4/CGAUGG/
MCSYM-DB/2_4/CGAUGG/2_4-CGAUGG.mcs
MCSYM-DB/2_4/CGAUGG/ds-2_4-CGAUGG_x.pdb.gz
MCSYM-DB/2_4/CGAUUA/
MCSYM-DB/2_4/CGAUUA/2_4-CGAUUA.mcs
MCSYM-DB/2_4/CGAUUA/ds-2_4-CGAUUA_x.pdb.gz
MCSYM-DB/2_4/CGAUUG/
MCSYM-DB/2_4/CGAUUG/2_4-CGAUUG.mcs
MCSYM-DB/2_4/CGAUUG/ds-2_4-CGAUUG_x.pdb.gz
MCSYM-DB/2_4/CGCAAA/
MCSYM-DB/2_4/CGCAAA/2_4-CGCAAA.mcs
MCSYM-DB/2_4/CGCAAA/ds-2_4-CGCAAA_x.pdb.gz
MCSYM-DB/2_4/CGCAAC/
MCSYM-DB/2_4/CGCAAC/2_4-CGCAAC.mcs
MCSYM-DB/2_4/CGCAAC/ds-2_4-CGCAAC_x.pdb.gz
MCSYM-DB/2_4/CGCAAG/
MCSYM-DB/2_4/CGCAAG/1U9S_model_1.pdb.gz
MCSYM-DB/2_4/CGCAAG/2_4-CGCAAG.mcs
MCSYM-DB/2_4/CGCAAG/ds-2_4-CGCAAG_x.pdb.gz
MCSYM-DB/2_4/CGCACA/
MCSYM-DB/2_4/CGCACA/2_4-CGCACA.mcs
MCSYM-DB/2_4/CGCACG/
MCSYM-DB/2_4/CGCACG/2_4-CGCACG.mcs
MCSYM-DB/2_4/CGCACG/ds-2_4-CGCACG_x.pdb.gz
MCSYM-DB/2_4/CGCAGA/
MCSYM-DB/2_4/CGCAGA/2_4-CGCAGA.mcs
MCSYM-DB/2_4/CGCAGG/
MCSYM-DB/2_4/CGCAGG/2_4-CGCAGG.mcs
MCSYM-DB/2_4/CGCAGG/ds-2_4-CGCAGG_x.pdb.gz
MCSYM-DB/2_4/CGCAUC/
MCSYM-DB/2_4/CGCAUC/2_4-CGCAUC.mcs
MCSYM-DB/2_4/CGCAUG/
MCSYM-DB/2_4/CGCAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/CGCAUG/2_4-CGCAUG.mcs
MCSYM-DB/2_4/CGCAUG/ds-2_4-CGCAUG_x.pdb.gz
MCSYM-DB/2_4/CGCAUU/
MCSYM-DB/2_4/CGCAUU/2_4-CGCAUU.mcs
MCSYM-DB/2_4/CGCCAA/
MCSYM-DB/2_4/CGCCAA/2_4-CGCCAA.mcs
MCSYM-DB/2_4/CGCCAG/
MCSYM-DB/2_4/CGCCAG/2_4-CGCCAG.mcs
MCSYM-DB/2_4/CGCCAG/ds-2_4-CGCCAG_x.pdb.gz
MCSYM-DB/2_4/CGCCCA/
MCSYM-DB/2_4/CGCCCA/2_4-CGCCCA.mcs
MCSYM-DB/2_4/CGCCCC/
MCSYM-DB/2_4/CGCCCC/2_4-CGCCCC.mcs
MCSYM-DB/2_4/CGCCCC/ds-2_4-CGCCCC_x.pdb.gz
MCSYM-DB/2_4/CGCCCG/
MCSYM-DB/2_4/CGCCCG/2_4-CGCCCG.mcs
MCSYM-DB/2_4/CGCCCG/ds-2_4-CGCCCG_x.pdb.gz
MCSYM-DB/2_4/CGCCGA/
MCSYM-DB/2_4/CGCCGA/2_4-CGCCGA.mcs
MCSYM-DB/2_4/CGCCGC/
MCSYM-DB/2_4/CGCCGC/2_4-CGCCGC.mcs
MCSYM-DB/2_4/CGCCGC/ds-2_4-CGCCGC_x.pdb.gz
MCSYM-DB/2_4/CGCCGG/
MCSYM-DB/2_4/CGCCGG/2_4-CGCCGG.mcs
MCSYM-DB/2_4/CGCCGG/ds-2_4-CGCCGG_x.pdb.gz
MCSYM-DB/2_4/CGCCUC/
MCSYM-DB/2_4/CGCCUC/2_4-CGCCUC.mcs
MCSYM-DB/2_4/CGCCUC/ds-2_4-CGCCUC_x.pdb.gz
MCSYM-DB/2_4/CGCCUG/
MCSYM-DB/2_4/CGCCUG/2_4-CGCCUG.mcs
MCSYM-DB/2_4/CGCCUG/ds-2_4-CGCCUG_x.pdb.gz
MCSYM-DB/2_4/CGCGAG/
MCSYM-DB/2_4/CGCGAG/2_4-CGCGAG.mcs
MCSYM-DB/2_4/CGCGAG/ds-2_4-CGCGAG_x.pdb.gz
MCSYM-DB/2_4/CGCGCG/
MCSYM-DB/2_4/CGCGCG/2_4-CGCGCG.mcs
MCSYM-DB/2_4/CGCGCG/ds-2_4-CGCGCG_x.pdb.gz
MCSYM-DB/2_4/CGCGGG/
MCSYM-DB/2_4/CGCGGG/2_4-CGCGGG.mcs
MCSYM-DB/2_4/CGCGGG/ds-2_4-CGCGGG_x.pdb.gz
MCSYM-DB/2_4/CGCGUG/
MCSYM-DB/2_4/CGCGUG/2_4-CGCGUG.mcs
MCSYM-DB/2_4/CGCGUG/ds-2_4-CGCGUG_x.pdb.gz
MCSYM-DB/2_4/CGCUAG/
MCSYM-DB/2_4/CGCUAG/2_4-CGCUAG.mcs
MCSYM-DB/2_4/CGCUAG/ds-2_4-CGCUAG_x.pdb.gz
MCSYM-DB/2_4/CGCUCC/
MCSYM-DB/2_4/CGCUCC/2_4-CGCUCC.mcs
MCSYM-DB/2_4/CGCUCC/ds-2_4-CGCUCC_x.pdb.gz
MCSYM-DB/2_4/CGCUCG/
MCSYM-DB/2_4/CGCUCG/2_4-CGCUCG.mcs
MCSYM-DB/2_4/CGCUCG/ds-2_4-CGCUCG_x.pdb.gz
MCSYM-DB/2_4/CGCUGG/
MCSYM-DB/2_4/CGCUGG/2_4-CGCUGG.mcs
MCSYM-DB/2_4/CGCUGG/ds-2_4-CGCUGG_x.pdb.gz
MCSYM-DB/2_4/CGCUUC/
MCSYM-DB/2_4/CGCUUC/2_4-CGCUUC.mcs
MCSYM-DB/2_4/CGCUUC/ds-2_4-CGCUUC_x.pdb.gz
MCSYM-DB/2_4/CGCUUG/
MCSYM-DB/2_4/CGCUUG/1NBK_model_1.pdb.gz
MCSYM-DB/2_4/CGCUUG/2_4-CGCUUG.mcs
MCSYM-DB/2_4/CGCUUG/ds-2_4-CGCUUG_x.pdb.gz
MCSYM-DB/2_4/CGGAAG/
MCSYM-DB/2_4/CGGAAG/2_4-CGGAAG.mcs
MCSYM-DB/2_4/CGGAGG/
MCSYM-DB/2_4/CGGAGG/2_4-CGGAGG.mcs
MCSYM-DB/2_4/CGGAGG/ds-2_4-CGGAGG_x.pdb.gz
MCSYM-DB/2_4/CGGAUC/
MCSYM-DB/2_4/CGGAUC/2_4-CGGAUC.mcs
MCSYM-DB/2_4/CGGAUC/ds-2_4-CGGAUC_x.pdb.gz
MCSYM-DB/2_4/CGGCCC/
MCSYM-DB/2_4/CGGCCC/2_4-CGGCCC.mcs
MCSYM-DB/2_4/CGGCCC/ds-2_4-CGGCCC_x.pdb.gz
MCSYM-DB/2_4/CGGCCG/
MCSYM-DB/2_4/CGGCCG/2_4-CGGCCG.mcs
MCSYM-DB/2_4/CGGCCG/ds-2_4-CGGCCG_x.pdb.gz
MCSYM-DB/2_4/CGGCCU/
MCSYM-DB/2_4/CGGCCU/2_4-CGGCCU.mcs
MCSYM-DB/2_4/CGGCCU/ds-2_4-CGGCCU_x.pdb.gz
MCSYM-DB/2_4/CGGGAC/
MCSYM-DB/2_4/CGGGAC/2_4-CGGGAC.mcs
MCSYM-DB/2_4/CGGGAC/ds-2_4-CGGGAC_x.pdb.gz
MCSYM-DB/2_4/CGGGAG/
MCSYM-DB/2_4/CGGGAG/2_4-CGGGAG.mcs
MCSYM-DB/2_4/CGGGAG/ds-2_4-CGGGAG_x.pdb.gz
MCSYM-DB/2_4/CGGGCG/
MCSYM-DB/2_4/CGGGCG/2_4-CGGGCG.mcs
MCSYM-DB/2_4/CGGGCG/ds-2_4-CGGGCG_x.pdb.gz
MCSYM-DB/2_4/CGGGCU/
MCSYM-DB/2_4/CGGGCU/2_4-CGGGCU.mcs
MCSYM-DB/2_4/CGGGCU/ds-2_4-CGGGCU_x.pdb.gz
MCSYM-DB/2_4/CGGGGG/
MCSYM-DB/2_4/CGGGGG/2_4-CGGGGG.mcs
MCSYM-DB/2_4/CGGGGG/ds-2_4-CGGGGG_x.pdb.gz
MCSYM-DB/2_4/CGGGUG/
MCSYM-DB/2_4/CGGGUG/2_4-CGGGUG.mcs
MCSYM-DB/2_4/CGGUCG/
MCSYM-DB/2_4/CGGUCG/2_4-CGGUCG.mcs
MCSYM-DB/2_4/CGGUCG/ds-2_4-CGGUCG_x.pdb.gz
MCSYM-DB/2_4/CGGUGC/
MCSYM-DB/2_4/CGGUGC/2_4-CGGUGC.mcs
MCSYM-DB/2_4/CGGUGC/ds-2_4-CGGUGC_x.pdb.gz
MCSYM-DB/2_4/CGGUGG/
MCSYM-DB/2_4/CGGUGG/2_4-CGGUGG.mcs
MCSYM-DB/2_4/CGUAAG/
MCSYM-DB/2_4/CGUAAG/2_4-CGUAAG.mcs
MCSYM-DB/2_4/CGUAAG/ds-2_4-CGUAAG_x.pdb.gz
MCSYM-DB/2_4/CGUAAU/
MCSYM-DB/2_4/CGUAAU/2_4-CGUAAU.mcs
MCSYM-DB/2_4/CGUAAU/ds-2_4-CGUAAU_x.pdb.gz
MCSYM-DB/2_4/CGUAGG/
MCSYM-DB/2_4/CGUAGG/2_4-CGUAGG.mcs
MCSYM-DB/2_4/CGUAGG/ds-2_4-CGUAGG_x.pdb.gz
MCSYM-DB/2_4/CGUAUG/
MCSYM-DB/2_4/CGUAUG/2_4-CGUAUG.mcs
MCSYM-DB/2_4/CGUAUG/ds-2_4-CGUAUG_x.pdb.gz
MCSYM-DB/2_4/CGUAUU/
MCSYM-DB/2_4/CGUAUU/2_4-CGUAUU.mcs
MCSYM-DB/2_4/CGUAUU/ds-2_4-CGUAUU_x.pdb.gz
MCSYM-DB/2_4/CGUCAC/
MCSYM-DB/2_4/CGUCAC/2_4-CGUCAC.mcs
MCSYM-DB/2_4/CGUCAC/ds-2_4-CGUCAC_x.pdb.gz
MCSYM-DB/2_4/CGUCAG/
MCSYM-DB/2_4/CGUCAG/2_4-CGUCAG.mcs
MCSYM-DB/2_4/CGUCAG/ds-2_4-CGUCAG_x.pdb.gz
MCSYM-DB/2_4/CGUCUG/
MCSYM-DB/2_4/CGUCUG/2_4-CGUCUG.mcs
MCSYM-DB/2_4/CGUCUG/ds-2_4-CGUCUG_x.pdb.gz
MCSYM-DB/2_4/CGUGAA/
MCSYM-DB/2_4/CGUGAA/2_4-CGUGAA.mcs
MCSYM-DB/2_4/CGUGAA/ds-2_4-CGUGAA_x.pdb.gz
MCSYM-DB/2_4/CGUGAG/
MCSYM-DB/2_4/CGUGAG/2_4-CGUGAG.mcs
MCSYM-DB/2_4/CGUGAG/ds-2_4-CGUGAG_x.pdb.gz
MCSYM-DB/2_4/CGUGCC/
MCSYM-DB/2_4/CGUGCC/2_4-CGUGCC.mcs
MCSYM-DB/2_4/CGUGCC/ds-2_4-CGUGCC_x.pdb.gz
MCSYM-DB/2_4/CGUGCG/
MCSYM-DB/2_4/CGUGCG/2_4-CGUGCG.mcs
MCSYM-DB/2_4/CGUGGG/
MCSYM-DB/2_4/CGUGGG/2_4-CGUGGG.mcs
MCSYM-DB/2_4/CGUGGG/ds-2_4-CGUGGG_x.pdb.gz
MCSYM-DB/2_4/CGUGUG/
MCSYM-DB/2_4/CGUGUG/2_4-CGUGUG.mcs
MCSYM-DB/2_4/CGUGUG/ds-2_4-CGUGUG_x.pdb.gz
MCSYM-DB/2_4/CGUUAG/
MCSYM-DB/2_4/CGUUAG/2_4-CGUUAG.mcs
MCSYM-DB/2_4/CGUUAG/ds-2_4-CGUUAG_x.pdb.gz
MCSYM-DB/2_4/CGUUCG/
MCSYM-DB/2_4/CGUUCG/2_4-CGUUCG.mcs
MCSYM-DB/2_4/CGUUCG/ds-2_4-CGUUCG_x.pdb.gz
MCSYM-DB/2_4/CGUUUG/
MCSYM-DB/2_4/CGUUUG/2_4-CGUUUG.mcs
MCSYM-DB/2_4/CGUUUG/ds-2_4-CGUUUG_x.pdb.gz
MCSYM-DB/2_4/CUAAAA/
MCSYM-DB/2_4/CUAAAA/2_4-CUAAAA.mcs
MCSYM-DB/2_4/CUAAAC/
MCSYM-DB/2_4/CUAAAC/2_4-CUAAAC.mcs
MCSYM-DB/2_4/CUAAAC/ds-2_4-CUAAAC_x.pdb.gz
MCSYM-DB/2_4/CUAAAG/
MCSYM-DB/2_4/CUAAAG/2_4-CUAAAG.mcs
MCSYM-DB/2_4/CUAAAU/
MCSYM-DB/2_4/CUAAAU/2_4-CUAAAU.mcs
MCSYM-DB/2_4/CUAACA/
MCSYM-DB/2_4/CUAACA/2_4-CUAACA.mcs
MCSYM-DB/2_4/CUAACC/
MCSYM-DB/2_4/CUAACC/2_4-CUAACC.mcs
MCSYM-DB/2_4/CUAACC/ds-2_4-CUAACC_x.pdb.gz
MCSYM-DB/2_4/CUAACG/
MCSYM-DB/2_4/CUAACG/2_4-CUAACG.mcs
MCSYM-DB/2_4/CUAACG/ds-2_4-CUAACG_x.pdb.gz
MCSYM-DB/2_4/CUAACU/
MCSYM-DB/2_4/CUAACU/2_4-CUAACU.mcs
MCSYM-DB/2_4/CUAAGG/
MCSYM-DB/2_4/CUAAGG/2_4-CUAAGG.mcs
MCSYM-DB/2_4/CUAAGG/ds-2_4-CUAAGG_x.pdb.gz
MCSYM-DB/2_4/CUAAGU/
MCSYM-DB/2_4/CUAAGU/2_4-CUAAGU.mcs
MCSYM-DB/2_4/CUAAUA/
MCSYM-DB/2_4/CUAAUA/2_4-CUAAUA.mcs
MCSYM-DB/2_4/CUAAUC/
MCSYM-DB/2_4/CUAAUC/2_4-CUAAUC.mcs
MCSYM-DB/2_4/CUAAUG/
MCSYM-DB/2_4/CUAAUG/2_4-CUAAUG.mcs
MCSYM-DB/2_4/CUAAUG/ds-2_4-CUAAUG_x.pdb.gz
MCSYM-DB/2_4/CUAAUU/
MCSYM-DB/2_4/CUAAUU/2_4-CUAAUU.mcs
MCSYM-DB/2_4/CUACAG/
MCSYM-DB/2_4/CUACAG/2_4-CUACAG.mcs
MCSYM-DB/2_4/CUACAG/ds-2_4-CUACAG_x.pdb.gz
MCSYM-DB/2_4/CUACAU/
MCSYM-DB/2_4/CUACAU/2_4-CUACAU.mcs
MCSYM-DB/2_4/CUACCA/
MCSYM-DB/2_4/CUACCA/2_4-CUACCA.mcs
MCSYM-DB/2_4/CUACCA/ds-2_4-CUACCA_x.pdb.gz
MCSYM-DB/2_4/CUACCC/
MCSYM-DB/2_4/CUACCC/2_4-CUACCC.mcs
MCSYM-DB/2_4/CUACCC/ds-2_4-CUACCC_x.pdb.gz
MCSYM-DB/2_4/CUACCG/
MCSYM-DB/2_4/CUACCG/2_4-CUACCG.mcs
MCSYM-DB/2_4/CUACCG/ds-2_4-CUACCG_x.pdb.gz
MCSYM-DB/2_4/CUACCU/
MCSYM-DB/2_4/CUACCU/2_4-CUACCU.mcs
MCSYM-DB/2_4/CUACGA/
MCSYM-DB/2_4/CUACGA/2_4-CUACGA.mcs
MCSYM-DB/2_4/CUACUC/
MCSYM-DB/2_4/CUACUC/2_4-CUACUC.mcs
MCSYM-DB/2_4/CUACUC/ds-2_4-CUACUC_x.pdb.gz
MCSYM-DB/2_4/CUACUG/
MCSYM-DB/2_4/CUACUG/2_4-CUACUG.mcs
MCSYM-DB/2_4/CUACUG/ds-2_4-CUACUG_x.pdb.gz
MCSYM-DB/2_4/CUACUU/
MCSYM-DB/2_4/CUACUU/2_4-CUACUU.mcs
MCSYM-DB/2_4/CUAGAG/
MCSYM-DB/2_4/CUAGAG/2_4-CUAGAG.mcs
MCSYM-DB/2_4/CUAGAG/ds-2_4-CUAGAG_x.pdb.gz
MCSYM-DB/2_4/CUAGCA/
MCSYM-DB/2_4/CUAGCA/2_4-CUAGCA.mcs
MCSYM-DB/2_4/CUAGCG/
MCSYM-DB/2_4/CUAGCG/2_4-CUAGCG.mcs
MCSYM-DB/2_4/CUAGCU/
MCSYM-DB/2_4/CUAGCU/2_4-CUAGCU.mcs
MCSYM-DB/2_4/CUAGGA/
MCSYM-DB/2_4/CUAGGA/2_4-CUAGGA.mcs
MCSYM-DB/2_4/CUAGGG/
MCSYM-DB/2_4/CUAGGG/2_4-CUAGGG.mcs
MCSYM-DB/2_4/CUAGGG/ds-2_4-CUAGGG_x.pdb.gz
MCSYM-DB/2_4/CUAGGU/
MCSYM-DB/2_4/CUAGGU/2_4-CUAGGU.mcs
MCSYM-DB/2_4/CUAGUA/
MCSYM-DB/2_4/CUAGUA/2_4-CUAGUA.mcs
MCSYM-DB/2_4/CUAGUG/
MCSYM-DB/2_4/CUAGUG/2_4-CUAGUG.mcs
MCSYM-DB/2_4/CUAGUG/ds-2_4-CUAGUG_x.pdb.gz
MCSYM-DB/2_4/CUAGUU/
MCSYM-DB/2_4/CUAGUU/2_4-CUAGUU.mcs
MCSYM-DB/2_4/CUAUAA/
MCSYM-DB/2_4/CUAUAA/2_4-CUAUAA.mcs
MCSYM-DB/2_4/CUAUAA/ds-2_4-CUAUAA_x.pdb.gz
MCSYM-DB/2_4/CUAUAC/
MCSYM-DB/2_4/CUAUAC/2_4-CUAUAC.mcs
MCSYM-DB/2_4/CUAUAG/
MCSYM-DB/2_4/CUAUAG/2_4-CUAUAG.mcs
MCSYM-DB/2_4/CUAUCA/
MCSYM-DB/2_4/CUAUCA/2_4-CUAUCA.mcs
MCSYM-DB/2_4/CUAUCC/
MCSYM-DB/2_4/CUAUCC/2_4-CUAUCC.mcs
MCSYM-DB/2_4/CUAUCC/ds-2_4-CUAUCC_x.pdb.gz
MCSYM-DB/2_4/CUAUCG/
MCSYM-DB/2_4/CUAUCG/2_4-CUAUCG.mcs
MCSYM-DB/2_4/CUAUCG/ds-2_4-CUAUCG_x.pdb.gz
MCSYM-DB/2_4/CUAUCU/
MCSYM-DB/2_4/CUAUCU/2_4-CUAUCU.mcs
MCSYM-DB/2_4/CUAUGC/
MCSYM-DB/2_4/CUAUGC/2_4-CUAUGC.mcs
MCSYM-DB/2_4/CUAUGG/
MCSYM-DB/2_4/CUAUGG/2_4-CUAUGG.mcs
MCSYM-DB/2_4/CUAUGG/ds-2_4-CUAUGG_x.pdb.gz
MCSYM-DB/2_4/CUAUUC/
MCSYM-DB/2_4/CUAUUC/2_4-CUAUUC.mcs
MCSYM-DB/2_4/CUAUUC/ds-2_4-CUAUUC_x.pdb.gz
MCSYM-DB/2_4/CUAUUG/
MCSYM-DB/2_4/CUAUUG/2_4-CUAUUG.mcs
MCSYM-DB/2_4/CUAUUG/ds-2_4-CUAUUG_x.pdb.gz
MCSYM-DB/2_4/CUAUUU/
MCSYM-DB/2_4/CUAUUU/2_4-CUAUUU.mcs
MCSYM-DB/2_4/CUCAAG/
MCSYM-DB/2_4/CUCAAG/2_4-CUCAAG.mcs
MCSYM-DB/2_4/CUCACC/
MCSYM-DB/2_4/CUCACC/2_4-CUCACC.mcs
MCSYM-DB/2_4/CUCAGU/
MCSYM-DB/2_4/CUCAGU/2_4-CUCAGU.mcs
MCSYM-DB/2_4/CUCAUG/
MCSYM-DB/2_4/CUCAUG/2_4-CUCAUG.mcs
MCSYM-DB/2_4/CUCCAG/
MCSYM-DB/2_4/CUCCAG/2_4-CUCCAG.mcs
MCSYM-DB/2_4/CUCCAG/ds-2_4-CUCCAG_x.pdb.gz
MCSYM-DB/2_4/CUCCCC/
MCSYM-DB/2_4/CUCCCC/2_4-CUCCCC.mcs
MCSYM-DB/2_4/CUCCCC/ds-2_4-CUCCCC_x.pdb.gz
MCSYM-DB/2_4/CUCCCU/
MCSYM-DB/2_4/CUCCCU/2_4-CUCCCU.mcs
MCSYM-DB/2_4/CUCCCU/ds-2_4-CUCCCU_x.pdb.gz
MCSYM-DB/2_4/CUCCGC/
MCSYM-DB/2_4/CUCCGC/2_4-CUCCGC.mcs
MCSYM-DB/2_4/CUCCGC/ds-2_4-CUCCGC_x.pdb.gz
MCSYM-DB/2_4/CUCCUG/
MCSYM-DB/2_4/CUCCUG/2_4-CUCCUG.mcs
MCSYM-DB/2_4/CUCCUG/ds-2_4-CUCCUG_x.pdb.gz
MCSYM-DB/2_4/CUCGAC/
MCSYM-DB/2_4/CUCGAC/2_4-CUCGAC.mcs
MCSYM-DB/2_4/CUCGUG/
MCSYM-DB/2_4/CUCGUG/2_4-CUCGUG.mcs
MCSYM-DB/2_4/CUCUAC/
MCSYM-DB/2_4/CUCUAC/2_4-CUCUAC.mcs
MCSYM-DB/2_4/CUCUAU/
MCSYM-DB/2_4/CUCUAU/2_4-CUCUAU.mcs
MCSYM-DB/2_4/CUCUCA/
MCSYM-DB/2_4/CUCUCA/2_4-CUCUCA.mcs
MCSYM-DB/2_4/CUCUCA/ds-2_4-CUCUCA_x.pdb.gz
MCSYM-DB/2_4/CUCUCC/
MCSYM-DB/2_4/CUCUCC/2_4-CUCUCC.mcs
MCSYM-DB/2_4/CUCUCC/ds-2_4-CUCUCC_x.pdb.gz
MCSYM-DB/2_4/CUCUCG/
MCSYM-DB/2_4/CUCUCG/2_4-CUCUCG.mcs
MCSYM-DB/2_4/CUCUCG/ds-2_4-CUCUCG_x.pdb.gz
MCSYM-DB/2_4/CUCUGA/
MCSYM-DB/2_4/CUCUGA/2_4-CUCUGA.mcs
MCSYM-DB/2_4/CUCUGG/
MCSYM-DB/2_4/CUCUGG/2_4-CUCUGG.mcs
MCSYM-DB/2_4/CUCUUC/
MCSYM-DB/2_4/CUCUUC/2_4-CUCUUC.mcs
MCSYM-DB/2_4/CUCUUC/ds-2_4-CUCUUC_x.pdb.gz
MCSYM-DB/2_4/CUCUUG/
MCSYM-DB/2_4/CUCUUG/2_4-CUCUUG.mcs
MCSYM-DB/2_4/CUCUUG/ds-2_4-CUCUUG_x.pdb.gz
MCSYM-DB/2_4/CUCUUU/
MCSYM-DB/2_4/CUCUUU/2_4-CUCUUU.mcs
MCSYM-DB/2_4/CUGAAA/
MCSYM-DB/2_4/CUGAAA/2_4-CUGAAA.mcs
MCSYM-DB/2_4/CUGAAG/
MCSYM-DB/2_4/CUGAAG/2_4-CUGAAG.mcs
MCSYM-DB/2_4/CUGAAG/ds-2_4-CUGAAG_x.pdb.gz
MCSYM-DB/2_4/CUGAAU/
MCSYM-DB/2_4/CUGAAU/2_4-CUGAAU.mcs
MCSYM-DB/2_4/CUGACA/
MCSYM-DB/2_4/CUGACA/2_4-CUGACA.mcs
MCSYM-DB/2_4/CUGACG/
MCSYM-DB/2_4/CUGACG/2_4-CUGACG.mcs
MCSYM-DB/2_4/CUGACG/ds-2_4-CUGACG_x.pdb.gz
MCSYM-DB/2_4/CUGACU/
MCSYM-DB/2_4/CUGACU/2_4-CUGACU.mcs
MCSYM-DB/2_4/CUGAGG/
MCSYM-DB/2_4/CUGAGG/2_4-CUGAGG.mcs
MCSYM-DB/2_4/CUGAGG/ds-2_4-CUGAGG_x.pdb.gz
MCSYM-DB/2_4/CUGAUC/
MCSYM-DB/2_4/CUGAUC/2_4-CUGAUC.mcs
MCSYM-DB/2_4/CUGAUG/
MCSYM-DB/2_4/CUGAUG/2_4-CUGAUG.mcs
MCSYM-DB/2_4/CUGAUG/ds-2_4-CUGAUG_x.pdb.gz
MCSYM-DB/2_4/CUGAUU/
MCSYM-DB/2_4/CUGAUU/2_4-CUGAUU.mcs
MCSYM-DB/2_4/CUGCAA/
MCSYM-DB/2_4/CUGCAA/2_4-CUGCAA.mcs
MCSYM-DB/2_4/CUGCAG/
MCSYM-DB/2_4/CUGCAG/2_4-CUGCAG.mcs
MCSYM-DB/2_4/CUGCCA/
MCSYM-DB/2_4/CUGCCA/2_4-CUGCCA.mcs
MCSYM-DB/2_4/CUGCCG/
MCSYM-DB/2_4/CUGCCG/2_4-CUGCCG.mcs
MCSYM-DB/2_4/CUGCCG/ds-2_4-CUGCCG_x.pdb.gz
MCSYM-DB/2_4/CUGCUC/
MCSYM-DB/2_4/CUGCUC/2_4-CUGCUC.mcs
MCSYM-DB/2_4/CUGCUC/ds-2_4-CUGCUC_x.pdb.gz
MCSYM-DB/2_4/CUGCUG/
MCSYM-DB/2_4/CUGCUG/2_4-CUGCUG.mcs
MCSYM-DB/2_4/CUGCUG/ds-2_4-CUGCUG_x.pdb.gz
MCSYM-DB/2_4/CUGGAG/
MCSYM-DB/2_4/CUGGAG/2_4-CUGGAG.mcs
MCSYM-DB/2_4/CUGGCU/
MCSYM-DB/2_4/CUGGCU/2_4-CUGGCU.mcs
MCSYM-DB/2_4/CUGGCU/ds-2_4-CUGGCU_x.pdb.gz
MCSYM-DB/2_4/CUGGGU/
MCSYM-DB/2_4/CUGGGU/2_4-CUGGGU.mcs
MCSYM-DB/2_4/CUGGUC/
MCSYM-DB/2_4/CUGGUC/2_4-CUGGUC.mcs
MCSYM-DB/2_4/CUGGUC/ds-2_4-CUGGUC_x.pdb.gz
MCSYM-DB/2_4/CUGGUG/
MCSYM-DB/2_4/CUGGUG/2_4-CUGGUG.mcs
MCSYM-DB/2_4/CUGUAG/
MCSYM-DB/2_4/CUGUAG/2_4-CUGUAG.mcs
MCSYM-DB/2_4/CUGUCA/
MCSYM-DB/2_4/CUGUCA/2_4-CUGUCA.mcs
MCSYM-DB/2_4/CUGUCC/
MCSYM-DB/2_4/CUGUCC/2_4-CUGUCC.mcs
MCSYM-DB/2_4/CUGUCG/
MCSYM-DB/2_4/CUGUCG/2_4-CUGUCG.mcs
MCSYM-DB/2_4/CUGUCG/ds-2_4-CUGUCG_x.pdb.gz
MCSYM-DB/2_4/CUGUGG/
MCSYM-DB/2_4/CUGUGG/2_4-CUGUGG.mcs
MCSYM-DB/2_4/CUGUUC/
MCSYM-DB/2_4/CUGUUC/2_4-CUGUUC.mcs
MCSYM-DB/2_4/CUGUUG/
MCSYM-DB/2_4/CUGUUG/2_4-CUGUUG.mcs
MCSYM-DB/2_4/CUGUUG/ds-2_4-CUGUUG_x.pdb.gz
MCSYM-DB/2_4/CUUAAG/
MCSYM-DB/2_4/CUUAAG/2_4-CUUAAG.mcs
MCSYM-DB/2_4/CUUAAU/
MCSYM-DB/2_4/CUUAAU/2_4-CUUAAU.mcs
MCSYM-DB/2_4/CUUACG/
MCSYM-DB/2_4/CUUACG/2_4-CUUACG.mcs
MCSYM-DB/2_4/CUUACG/ds-2_4-CUUACG_x.pdb.gz
MCSYM-DB/2_4/CUUAGG/
MCSYM-DB/2_4/CUUAGG/2_4-CUUAGG.mcs
MCSYM-DB/2_4/CUUAUG/
MCSYM-DB/2_4/CUUAUG/2_4-CUUAUG.mcs
MCSYM-DB/2_4/CUUAUG/ds-2_4-CUUAUG_x.pdb.gz
MCSYM-DB/2_4/CUUCAC/
MCSYM-DB/2_4/CUUCAC/2_4-CUUCAC.mcs
MCSYM-DB/2_4/CUUCAG/
MCSYM-DB/2_4/CUUCAG/2_4-CUUCAG.mcs
MCSYM-DB/2_4/CUUCCC/
MCSYM-DB/2_4/CUUCCC/2_4-CUUCCC.mcs
MCSYM-DB/2_4/CUUCCC/ds-2_4-CUUCCC_x.pdb.gz
MCSYM-DB/2_4/CUUCCG/
MCSYM-DB/2_4/CUUCCG/2_4-CUUCCG.mcs
MCSYM-DB/2_4/CUUCCG/ds-2_4-CUUCCG_x.pdb.gz
MCSYM-DB/2_4/CUUCCU/
MCSYM-DB/2_4/CUUCCU/2_4-CUUCCU.mcs
MCSYM-DB/2_4/CUUCUG/
MCSYM-DB/2_4/CUUCUG/2_4-CUUCUG.mcs
MCSYM-DB/2_4/CUUCUG/ds-2_4-CUUCUG_x.pdb.gz
MCSYM-DB/2_4/CUUGAA/
MCSYM-DB/2_4/CUUGAA/2_4-CUUGAA.mcs
MCSYM-DB/2_4/CUUGAC/
MCSYM-DB/2_4/CUUGAC/2_4-CUUGAC.mcs
MCSYM-DB/2_4/CUUGAG/
MCSYM-DB/2_4/CUUGAG/2_4-CUUGAG.mcs
MCSYM-DB/2_4/CUUGCC/
MCSYM-DB/2_4/CUUGCC/2_4-CUUGCC.mcs
MCSYM-DB/2_4/CUUGCC/ds-2_4-CUUGCC_x.pdb.gz
MCSYM-DB/2_4/CUUGCG/
MCSYM-DB/2_4/CUUGCG/2_4-CUUGCG.mcs
MCSYM-DB/2_4/CUUGCG/ds-2_4-CUUGCG_x.pdb.gz
MCSYM-DB/2_4/CUUGGA/
MCSYM-DB/2_4/CUUGGA/2_4-CUUGGA.mcs
MCSYM-DB/2_4/CUUGGA/ds-2_4-CUUGGA_x.pdb.gz
MCSYM-DB/2_4/CUUGGG/
MCSYM-DB/2_4/CUUGGG/2_4-CUUGGG.mcs
MCSYM-DB/2_4/CUUGGG/ds-2_4-CUUGGG_x.pdb.gz
MCSYM-DB/2_4/CUUGUG/
MCSYM-DB/2_4/CUUGUG/2_4-CUUGUG.mcs
MCSYM-DB/2_4/CUUGUG/ds-2_4-CUUGUG_x.pdb.gz
MCSYM-DB/2_4/CUUUAG/
MCSYM-DB/2_4/CUUUAG/2_4-CUUUAG.mcs
MCSYM-DB/2_4/CUUUCC/
MCSYM-DB/2_4/CUUUCC/2_4-CUUUCC.mcs
MCSYM-DB/2_4/CUUUCC/ds-2_4-CUUUCC_x.pdb.gz
MCSYM-DB/2_4/CUUUCG/
MCSYM-DB/2_4/CUUUCG/2_4-CUUUCG.mcs
MCSYM-DB/2_4/CUUUCG/ds-2_4-CUUUCG_x.pdb.gz
MCSYM-DB/2_4/CUUUGG/
MCSYM-DB/2_4/CUUUGG/2_4-CUUUGG.mcs
MCSYM-DB/2_4/CUUUUG/
MCSYM-DB/2_4/CUUUUG/2_4-CUUUUG.mcs
MCSYM-DB/2_4/CUUUUG/ds-2_4-CUUUUG_x.pdb.gz
MCSYM-DB/2_4/CUUUUU/
MCSYM-DB/2_4/CUUUUU/2_4-CUUUUU.mcs
MCSYM-DB/2_4/CUUUUU/ds-2_4-CUUUUU_x.pdb.gz
MCSYM-DB/2_4/GAAAAA/
MCSYM-DB/2_4/GAAAAA/2_4-GAAAAA.mcs
MCSYM-DB/2_4/GAAAAA/ds-2_4-GAAAAA_x.pdb.gz
MCSYM-DB/2_4/GAAAAC/
MCSYM-DB/2_4/GAAAAC/2_4-GAAAAC.mcs
MCSYM-DB/2_4/GAAAAU/
MCSYM-DB/2_4/GAAAAU/2_4-GAAAAU.mcs
MCSYM-DB/2_4/GAAAAU/ds-2_4-GAAAAU_x.pdb.gz
MCSYM-DB/2_4/GAAACC/
MCSYM-DB/2_4/GAAACC/2_4-GAAACC.mcs
MCSYM-DB/2_4/GAAACC/ds-2_4-GAAACC_x.pdb.gz
MCSYM-DB/2_4/GAAAGC/
MCSYM-DB/2_4/GAAAGC/2_4-GAAAGC.mcs
MCSYM-DB/2_4/GAAAGG/
MCSYM-DB/2_4/GAAAGG/2_4-GAAAGG.mcs
MCSYM-DB/2_4/GAAAGU/
MCSYM-DB/2_4/GAAAGU/2_4-GAAAGU.mcs
MCSYM-DB/2_4/GAAAGU/ds-2_4-GAAAGU_x.pdb.gz
MCSYM-DB/2_4/GAAAUA/
MCSYM-DB/2_4/GAAAUA/2_4-GAAAUA.mcs
MCSYM-DB/2_4/GAAAUC/
MCSYM-DB/2_4/GAAAUC/2_4-GAAAUC.mcs
MCSYM-DB/2_4/GAAAUC/ds-2_4-GAAAUC_x.pdb.gz
MCSYM-DB/2_4/GAAAUG/
MCSYM-DB/2_4/GAAAUG/2_4-GAAAUG.mcs
MCSYM-DB/2_4/GAACAC/
MCSYM-DB/2_4/GAACAC/2_4-GAACAC.mcs
MCSYM-DB/2_4/GAACCC/
MCSYM-DB/2_4/GAACCC/2_4-GAACCC.mcs
MCSYM-DB/2_4/GAACCC/ds-2_4-GAACCC_x.pdb.gz
MCSYM-DB/2_4/GAACUU/
MCSYM-DB/2_4/GAACUU/2_4-GAACUU.mcs
MCSYM-DB/2_4/GAACUU/ds-2_4-GAACUU_x.pdb.gz
MCSYM-DB/2_4/GAAGAA/
MCSYM-DB/2_4/GAAGAA/2_4-GAAGAA.mcs
MCSYM-DB/2_4/GAAGAC/
MCSYM-DB/2_4/GAAGAC/2_4-GAAGAC.mcs
MCSYM-DB/2_4/GAAGAC/ds-2_4-GAAGAC_x.pdb.gz
MCSYM-DB/2_4/GAAGAU/
MCSYM-DB/2_4/GAAGAU/2_4-GAAGAU.mcs
MCSYM-DB/2_4/GAAGCA/
MCSYM-DB/2_4/GAAGCA/2_4-GAAGCA.mcs
MCSYM-DB/2_4/GAAGCC/
MCSYM-DB/2_4/GAAGCC/2_4-GAAGCC.mcs
MCSYM-DB/2_4/GAAGCC/ds-2_4-GAAGCC_x.pdb.gz
MCSYM-DB/2_4/GAAGGA/
MCSYM-DB/2_4/GAAGGA/2_4-GAAGGA.mcs
MCSYM-DB/2_4/GAAGGA/ds-2_4-GAAGGA_x.pdb.gz
MCSYM-DB/2_4/GAAGGC/
MCSYM-DB/2_4/GAAGGC/2_4-GAAGGC.mcs
MCSYM-DB/2_4/GAAGGU/
MCSYM-DB/2_4/GAAGGU/2_4-GAAGGU.mcs
MCSYM-DB/2_4/GAAGUC/
MCSYM-DB/2_4/GAAGUC/2_4-GAAGUC.mcs
MCSYM-DB/2_4/GAAGUU/
MCSYM-DB/2_4/GAAGUU/2_4-GAAGUU.mcs
MCSYM-DB/2_4/GAAUAA/
MCSYM-DB/2_4/GAAUAA/2_4-GAAUAA.mcs
MCSYM-DB/2_4/GAAUAA/ds-2_4-GAAUAA_x.pdb.gz
MCSYM-DB/2_4/GAAUAC/
MCSYM-DB/2_4/GAAUAC/2_4-GAAUAC.mcs
MCSYM-DB/2_4/GAAUCA/
MCSYM-DB/2_4/GAAUCA/2_4-GAAUCA.mcs
MCSYM-DB/2_4/GAAUGC/
MCSYM-DB/2_4/GAAUGC/2_4-GAAUGC.mcs
MCSYM-DB/2_4/GAAUGC/ds-2_4-GAAUGC_x.pdb.gz
MCSYM-DB/2_4/GAAUUC/
MCSYM-DB/2_4/GAAUUC/2_4-GAAUUC.mcs
MCSYM-DB/2_4/GAAUUU/
MCSYM-DB/2_4/GAAUUU/2_4-GAAUUU.mcs
MCSYM-DB/2_4/GAAUUU/ds-2_4-GAAUUU_x.pdb.gz
MCSYM-DB/2_4/GACAAA/
MCSYM-DB/2_4/GACAAA/2_4-GACAAA.mcs
MCSYM-DB/2_4/GACAAC/
MCSYM-DB/2_4/GACAAC/2_4-GACAAC.mcs
MCSYM-DB/2_4/GACAAU/
MCSYM-DB/2_4/GACAAU/2_4-GACAAU.mcs
MCSYM-DB/2_4/GACACC/
MCSYM-DB/2_4/GACACC/2_4-GACACC.mcs
MCSYM-DB/2_4/GACACC/ds-2_4-GACACC_x.pdb.gz
MCSYM-DB/2_4/GACAGC/
MCSYM-DB/2_4/GACAGC/2_4-GACAGC.mcs
MCSYM-DB/2_4/GACAUC/
MCSYM-DB/2_4/GACAUC/2_4-GACAUC.mcs
MCSYM-DB/2_4/GACCAU/
MCSYM-DB/2_4/GACCAU/2_4-GACCAU.mcs
MCSYM-DB/2_4/GACCCC/
MCSYM-DB/2_4/GACCCC/2_4-GACCCC.mcs
MCSYM-DB/2_4/GACCUA/
MCSYM-DB/2_4/GACCUA/2_4-GACCUA.mcs
MCSYM-DB/2_4/GACCUC/
MCSYM-DB/2_4/GACCUC/2_4-GACCUC.mcs
MCSYM-DB/2_4/GACCUG/
MCSYM-DB/2_4/GACCUG/2_4-GACCUG.mcs
MCSYM-DB/2_4/GACCUG/ds-2_4-GACCUG_x.pdb.gz
MCSYM-DB/2_4/GACCUU/
MCSYM-DB/2_4/GACCUU/2_4-GACCUU.mcs
MCSYM-DB/2_4/GACGAU/
MCSYM-DB/2_4/GACGAU/2_4-GACGAU.mcs
MCSYM-DB/2_4/GACGAU/ds-2_4-GACGAU_x.pdb.gz
MCSYM-DB/2_4/GACGUU/
MCSYM-DB/2_4/GACGUU/2_4-GACGUU.mcs
MCSYM-DB/2_4/GACUAC/
MCSYM-DB/2_4/GACUAC/2_4-GACUAC.mcs
MCSYM-DB/2_4/GACUCC/
MCSYM-DB/2_4/GACUCC/2_4-GACUCC.mcs
MCSYM-DB/2_4/GACUGC/
MCSYM-DB/2_4/GACUGC/2_4-GACUGC.mcs
MCSYM-DB/2_4/GACUGC/ds-2_4-GACUGC_x.pdb.gz
MCSYM-DB/2_4/GACUGG/
MCSYM-DB/2_4/GACUGG/2_4-GACUGG.mcs
MCSYM-DB/2_4/GACUGG/ds-2_4-GACUGG_x.pdb.gz
MCSYM-DB/2_4/GACUGU/
MCSYM-DB/2_4/GACUGU/2_4-GACUGU.mcs
MCSYM-DB/2_4/GAGAAA/
MCSYM-DB/2_4/GAGAAA/2_4-GAGAAA.mcs
MCSYM-DB/2_4/GAGAAA/ds-2_4-GAGAAA_x.pdb.gz
MCSYM-DB/2_4/GAGAAC/
MCSYM-DB/2_4/GAGAAC/2_4-GAGAAC.mcs
MCSYM-DB/2_4/GAGAAC/ds-2_4-GAGAAC_x.pdb.gz
MCSYM-DB/2_4/GAGAAU/
MCSYM-DB/2_4/GAGAAU/2_4-GAGAAU.mcs
MCSYM-DB/2_4/GAGAAU/ds-2_4-GAGAAU_x.pdb.gz
MCSYM-DB/2_4/GAGACA/
MCSYM-DB/2_4/GAGACA/2_4-GAGACA.mcs
MCSYM-DB/2_4/GAGACC/
MCSYM-DB/2_4/GAGACC/2_4-GAGACC.mcs
MCSYM-DB/2_4/GAGAGA/
MCSYM-DB/2_4/GAGAGA/2_4-GAGAGA.mcs
MCSYM-DB/2_4/GAGAGC/
MCSYM-DB/2_4/GAGAGC/2_4-GAGAGC.mcs
MCSYM-DB/2_4/GAGAGG/
MCSYM-DB/2_4/GAGAGG/2_4-GAGAGG.mcs
MCSYM-DB/2_4/GAGAGG/ds-2_4-GAGAGG_x.pdb.gz
MCSYM-DB/2_4/GAGAGU/
MCSYM-DB/2_4/GAGAGU/2_4-GAGAGU.mcs
MCSYM-DB/2_4/GAGAUC/
MCSYM-DB/2_4/GAGAUC/2_4-GAGAUC.mcs
MCSYM-DB/2_4/GAGAUU/
MCSYM-DB/2_4/GAGAUU/2_4-GAGAUU.mcs
MCSYM-DB/2_4/GAGCAC/
MCSYM-DB/2_4/GAGCAC/2_4-GAGCAC.mcs
MCSYM-DB/2_4/GAGCUC/
MCSYM-DB/2_4/GAGCUC/2_4-GAGCUC.mcs
MCSYM-DB/2_4/GAGGAA/
MCSYM-DB/2_4/GAGGAA/2_4-GAGGAA.mcs
MCSYM-DB/2_4/GAGGAC/
MCSYM-DB/2_4/GAGGAC/2_4-GAGGAC.mcs
MCSYM-DB/2_4/GAGGAC/ds-2_4-GAGGAC_x.pdb.gz
MCSYM-DB/2_4/GAGGCC/
MCSYM-DB/2_4/GAGGCC/2_4-GAGGCC.mcs
MCSYM-DB/2_4/GAGGGA/
MCSYM-DB/2_4/GAGGGA/2_4-GAGGGA.mcs
MCSYM-DB/2_4/GAGGGC/
MCSYM-DB/2_4/GAGGGC/2_4-GAGGGC.mcs
MCSYM-DB/2_4/GAGGGG/
MCSYM-DB/2_4/GAGGGG/2_4-GAGGGG.mcs
MCSYM-DB/2_4/GAGGGG/ds-2_4-GAGGGG_x.pdb.gz
MCSYM-DB/2_4/GAGGGU/
MCSYM-DB/2_4/GAGGGU/2_4-GAGGGU.mcs
MCSYM-DB/2_4/GAGGUA/
MCSYM-DB/2_4/GAGGUA/2_4-GAGGUA.mcs
MCSYM-DB/2_4/GAGGUC/
MCSYM-DB/2_4/GAGGUC/2_4-GAGGUC.mcs
MCSYM-DB/2_4/GAGGUG/
MCSYM-DB/2_4/GAGGUG/2_4-GAGGUG.mcs
MCSYM-DB/2_4/GAGGUG/ds-2_4-GAGGUG_x.pdb.gz
MCSYM-DB/2_4/GAGUAC/
MCSYM-DB/2_4/GAGUAC/2_4-GAGUAC.mcs
MCSYM-DB/2_4/GAGUCC/
MCSYM-DB/2_4/GAGUCC/2_4-GAGUCC.mcs
MCSYM-DB/2_4/GAGUCU/
MCSYM-DB/2_4/GAGUCU/2_4-GAGUCU.mcs
MCSYM-DB/2_4/GAGUCU/ds-2_4-GAGUCU_x.pdb.gz
MCSYM-DB/2_4/GAGUGA/
MCSYM-DB/2_4/GAGUGA/2_4-GAGUGA.mcs
MCSYM-DB/2_4/GAGUGC/
MCSYM-DB/2_4/GAGUGC/2_4-GAGUGC.mcs
MCSYM-DB/2_4/GAGUUC/
MCSYM-DB/2_4/GAGUUC/2_4-GAGUUC.mcs
MCSYM-DB/2_4/GAUAAA/
MCSYM-DB/2_4/GAUAAA/2_4-GAUAAA.mcs
MCSYM-DB/2_4/GAUAAA/ds-2_4-GAUAAA_x.pdb.gz
MCSYM-DB/2_4/GAUAAC/
MCSYM-DB/2_4/GAUAAC/2_4-GAUAAC.mcs
MCSYM-DB/2_4/GAUAAC/ds-2_4-GAUAAC_x.pdb.gz
MCSYM-DB/2_4/GAUAAU/
MCSYM-DB/2_4/GAUAAU/2_4-GAUAAU.mcs
MCSYM-DB/2_4/GAUAAU/ds-2_4-GAUAAU_x.pdb.gz
MCSYM-DB/2_4/GAUACA/
MCSYM-DB/2_4/GAUACA/2_4-GAUACA.mcs
MCSYM-DB/2_4/GAUACC/
MCSYM-DB/2_4/GAUACC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/GAUACC/2_4-GAUACC.mcs
MCSYM-DB/2_4/GAUACC/ds-2_4-GAUACC_x.pdb.gz
MCSYM-DB/2_4/GAUAGA/
MCSYM-DB/2_4/GAUAGA/2_4-GAUAGA.mcs
MCSYM-DB/2_4/GAUAGA/ds-2_4-GAUAGA_x.pdb.gz
MCSYM-DB/2_4/GAUAGC/
MCSYM-DB/2_4/GAUAGC/2_4-GAUAGC.mcs
MCSYM-DB/2_4/GAUAGC/ds-2_4-GAUAGC_x.pdb.gz
MCSYM-DB/2_4/GAUAGG/
MCSYM-DB/2_4/GAUAGG/2_4-GAUAGG.mcs
MCSYM-DB/2_4/GAUAUC/
MCSYM-DB/2_4/GAUAUC/2_4-GAUAUC.mcs
MCSYM-DB/2_4/GAUAUC/ds-2_4-GAUAUC_x.pdb.gz
MCSYM-DB/2_4/GAUAUU/
MCSYM-DB/2_4/GAUAUU/2_4-GAUAUU.mcs
MCSYM-DB/2_4/GAUCAA/
MCSYM-DB/2_4/GAUCAA/2_4-GAUCAA.mcs
MCSYM-DB/2_4/GAUCAA/ds-2_4-GAUCAA_x.pdb.gz
MCSYM-DB/2_4/GAUCAC/
MCSYM-DB/2_4/GAUCAC/2_4-GAUCAC.mcs
MCSYM-DB/2_4/GAUCAC/ds-2_4-GAUCAC_x.pdb.gz
MCSYM-DB/2_4/GAUCAG/
MCSYM-DB/2_4/GAUCAG/2_4-GAUCAG.mcs
MCSYM-DB/2_4/GAUCAU/
MCSYM-DB/2_4/GAUCAU/2_4-GAUCAU.mcs
MCSYM-DB/2_4/GAUCAU/ds-2_4-GAUCAU_x.pdb.gz
MCSYM-DB/2_4/GAUCCA/
MCSYM-DB/2_4/GAUCCA/2_4-GAUCCA.mcs
MCSYM-DB/2_4/GAUCCA/ds-2_4-GAUCCA_x.pdb.gz
MCSYM-DB/2_4/GAUCCC/
MCSYM-DB/2_4/GAUCCC/2_4-GAUCCC.mcs
MCSYM-DB/2_4/GAUCCC/ds-2_4-GAUCCC_x.pdb.gz
MCSYM-DB/2_4/GAUCCU/
MCSYM-DB/2_4/GAUCCU/2_4-GAUCCU.mcs
MCSYM-DB/2_4/GAUCUC/
MCSYM-DB/2_4/GAUCUC/2_4-GAUCUC.mcs
MCSYM-DB/2_4/GAUCUC/ds-2_4-GAUCUC_x.pdb.gz
MCSYM-DB/2_4/GAUGAA/
MCSYM-DB/2_4/GAUGAA/2_4-GAUGAA.mcs
MCSYM-DB/2_4/GAUGAA/ds-2_4-GAUGAA_x.pdb.gz
MCSYM-DB/2_4/GAUGAC/
MCSYM-DB/2_4/GAUGAC/1G1X_model_1.pdb.gz
MCSYM-DB/2_4/GAUGAC/1KUQ_model_1.pdb.gz
MCSYM-DB/2_4/GAUGAC/1XMQ_model_1.pdb.gz
MCSYM-DB/2_4/GAUGAC/2_4-GAUGAC.mcs
MCSYM-DB/2_4/GAUGAC/ds-2_4-GAUGAC_x.pdb.gz
MCSYM-DB/2_4/GAUGAG/
MCSYM-DB/2_4/GAUGAG/2_4-GAUGAG.mcs
MCSYM-DB/2_4/GAUGAG/ds-2_4-GAUGAG_x.pdb.gz
MCSYM-DB/2_4/GAUGAU/
MCSYM-DB/2_4/GAUGAU/2_4-GAUGAU.mcs
MCSYM-DB/2_4/GAUGAU/ds-2_4-GAUGAU_x.pdb.gz
MCSYM-DB/2_4/GAUGCA/
MCSYM-DB/2_4/GAUGCA/2_4-GAUGCA.mcs
MCSYM-DB/2_4/GAUGCA/ds-2_4-GAUGCA_x.pdb.gz
MCSYM-DB/2_4/GAUGCC/
MCSYM-DB/2_4/GAUGCC/2_4-GAUGCC.mcs
MCSYM-DB/2_4/GAUGCC/ds-2_4-GAUGCC_x.pdb.gz
MCSYM-DB/2_4/GAUGCU/
MCSYM-DB/2_4/GAUGCU/2_4-GAUGCU.mcs
MCSYM-DB/2_4/GAUGGA/
MCSYM-DB/2_4/GAUGGA/2_4-GAUGGA.mcs
MCSYM-DB/2_4/GAUGGA/ds-2_4-GAUGGA_x.pdb.gz
MCSYM-DB/2_4/GAUGGC/
MCSYM-DB/2_4/GAUGGC/2_4-GAUGGC.mcs
MCSYM-DB/2_4/GAUGGC/ds-2_4-GAUGGC_x.pdb.gz
MCSYM-DB/2_4/GAUGGG/
MCSYM-DB/2_4/GAUGGG/2_4-GAUGGG.mcs
MCSYM-DB/2_4/GAUGGU/
MCSYM-DB/2_4/GAUGGU/2_4-GAUGGU.mcs
MCSYM-DB/2_4/GAUGGU/ds-2_4-GAUGGU_x.pdb.gz
MCSYM-DB/2_4/GAUGUC/
MCSYM-DB/2_4/GAUGUC/2_4-GAUGUC.mcs
MCSYM-DB/2_4/GAUGUG/
MCSYM-DB/2_4/GAUGUG/2_4-GAUGUG.mcs
MCSYM-DB/2_4/GAUGUG/ds-2_4-GAUGUG_x.pdb.gz
MCSYM-DB/2_4/GAUGUU/
MCSYM-DB/2_4/GAUGUU/2_4-GAUGUU.mcs
MCSYM-DB/2_4/GAUGUU/ds-2_4-GAUGUU_x.pdb.gz
MCSYM-DB/2_4/GAUUAC/
MCSYM-DB/2_4/GAUUAC/2_4-GAUUAC.mcs
MCSYM-DB/2_4/GAUUAC/ds-2_4-GAUUAC_x.pdb.gz
MCSYM-DB/2_4/GAUUAG/
MCSYM-DB/2_4/GAUUAG/2_4-GAUUAG.mcs
MCSYM-DB/2_4/GAUUCC/
MCSYM-DB/2_4/GAUUCC/2_4-GAUUCC.mcs
MCSYM-DB/2_4/GAUUCC/ds-2_4-GAUUCC_x.pdb.gz
MCSYM-DB/2_4/GAUUGA/
MCSYM-DB/2_4/GAUUGA/2_4-GAUUGA.mcs
MCSYM-DB/2_4/GAUUGC/
MCSYM-DB/2_4/GAUUGC/2_4-GAUUGC.mcs
MCSYM-DB/2_4/GAUUGC/ds-2_4-GAUUGC_x.pdb.gz
MCSYM-DB/2_4/GAUUGG/
MCSYM-DB/2_4/GAUUGG/2_4-GAUUGG.mcs
MCSYM-DB/2_4/GAUUGG/ds-2_4-GAUUGG_x.pdb.gz
MCSYM-DB/2_4/GAUUGU/
MCSYM-DB/2_4/GAUUGU/2_4-GAUUGU.mcs
MCSYM-DB/2_4/GAUUUC/
MCSYM-DB/2_4/GAUUUC/2_4-GAUUUC.mcs
MCSYM-DB/2_4/GAUUUC/ds-2_4-GAUUUC_x.pdb.gz
MCSYM-DB/2_4/GAUUUG/
MCSYM-DB/2_4/GAUUUG/2_4-GAUUUG.mcs
MCSYM-DB/2_4/GAUUUG/ds-2_4-GAUUUG_x.pdb.gz
MCSYM-DB/2_4/GAUUUU/
MCSYM-DB/2_4/GAUUUU/2_4-GAUUUU.mcs
MCSYM-DB/2_4/GCAAAU/
MCSYM-DB/2_4/GCAAAU/2_4-GCAAAU.mcs
MCSYM-DB/2_4/GCAACC/
MCSYM-DB/2_4/GCAACC/2_4-GCAACC.mcs
MCSYM-DB/2_4/GCAACC/ds-2_4-GCAACC_x.pdb.gz
MCSYM-DB/2_4/GCAAGC/
MCSYM-DB/2_4/GCAAGC/2_4-GCAAGC.mcs
MCSYM-DB/2_4/GCAAUA/
MCSYM-DB/2_4/GCAAUA/2_4-GCAAUA.mcs
MCSYM-DB/2_4/GCAAUC/
MCSYM-DB/2_4/GCAAUC/2_4-GCAAUC.mcs
MCSYM-DB/2_4/GCAAUC/ds-2_4-GCAAUC_x.pdb.gz
MCSYM-DB/2_4/GCAAUU/
MCSYM-DB/2_4/GCAAUU/2_4-GCAAUU.mcs
MCSYM-DB/2_4/GCACAC/
MCSYM-DB/2_4/GCACAC/2_4-GCACAC.mcs
MCSYM-DB/2_4/GCACCA/
MCSYM-DB/2_4/GCACCA/2_4-GCACCA.mcs
MCSYM-DB/2_4/GCACCC/
MCSYM-DB/2_4/GCACCC/2_4-GCACCC.mcs
MCSYM-DB/2_4/GCACUC/
MCSYM-DB/2_4/GCACUC/2_4-GCACUC.mcs
MCSYM-DB/2_4/GCACUC/ds-2_4-GCACUC_x.pdb.gz
MCSYM-DB/2_4/GCAGAA/
MCSYM-DB/2_4/GCAGAA/2_4-GCAGAA.mcs
MCSYM-DB/2_4/GCAGAC/
MCSYM-DB/2_4/GCAGAC/2_4-GCAGAC.mcs
MCSYM-DB/2_4/GCAGCC/
MCSYM-DB/2_4/GCAGCC/2_4-GCAGCC.mcs
MCSYM-DB/2_4/GCAGGC/
MCSYM-DB/2_4/GCAGGC/2_4-GCAGGC.mcs
MCSYM-DB/2_4/GCAGGC/ds-2_4-GCAGGC_x.pdb.gz
MCSYM-DB/2_4/GCAGUC/
MCSYM-DB/2_4/GCAGUC/2_4-GCAGUC.mcs
MCSYM-DB/2_4/GCAGUG/
MCSYM-DB/2_4/GCAGUG/2_4-GCAGUG.mcs
MCSYM-DB/2_4/GCAGUG/ds-2_4-GCAGUG_x.pdb.gz
MCSYM-DB/2_4/GCAUGC/
MCSYM-DB/2_4/GCAUGC/2_4-GCAUGC.mcs
MCSYM-DB/2_4/GCAUUA/
MCSYM-DB/2_4/GCAUUA/2_4-GCAUUA.mcs
MCSYM-DB/2_4/GCAUUC/
MCSYM-DB/2_4/GCAUUC/2_4-GCAUUC.mcs
MCSYM-DB/2_4/GCAUUC/ds-2_4-GCAUUC_x.pdb.gz
MCSYM-DB/2_4/GCCAAA/
MCSYM-DB/2_4/GCCAAA/2_4-GCCAAA.mcs
MCSYM-DB/2_4/GCCAAA/ds-2_4-GCCAAA_x.pdb.gz
MCSYM-DB/2_4/GCCAAC/
MCSYM-DB/2_4/GCCAAC/2_4-GCCAAC.mcs
MCSYM-DB/2_4/GCCAAC/ds-2_4-GCCAAC_x.pdb.gz
MCSYM-DB/2_4/GCCACA/
MCSYM-DB/2_4/GCCACA/2_4-GCCACA.mcs
MCSYM-DB/2_4/GCCACC/
MCSYM-DB/2_4/GCCACC/2_4-GCCACC.mcs
MCSYM-DB/2_4/GCCACC/ds-2_4-GCCACC_x.pdb.gz
MCSYM-DB/2_4/GCCACU/
MCSYM-DB/2_4/GCCACU/2_4-GCCACU.mcs
MCSYM-DB/2_4/GCCACU/ds-2_4-GCCACU_x.pdb.gz
MCSYM-DB/2_4/GCCAUC/
MCSYM-DB/2_4/GCCAUC/2_4-GCCAUC.mcs
MCSYM-DB/2_4/GCCAUC/ds-2_4-GCCAUC_x.pdb.gz
MCSYM-DB/2_4/GCCCAC/
MCSYM-DB/2_4/GCCCAC/2_4-GCCCAC.mcs
MCSYM-DB/2_4/GCCCAC/ds-2_4-GCCCAC_x.pdb.gz
MCSYM-DB/2_4/GCCCAG/
MCSYM-DB/2_4/GCCCAG/2_4-GCCCAG.mcs
MCSYM-DB/2_4/GCCCAG/ds-2_4-GCCCAG_x.pdb.gz
MCSYM-DB/2_4/GCCCCC/
MCSYM-DB/2_4/GCCCCC/2_4-GCCCCC.mcs
MCSYM-DB/2_4/GCCCCC/ds-2_4-GCCCCC_x.pdb.gz
MCSYM-DB/2_4/GCCCCU/
MCSYM-DB/2_4/GCCCCU/2_4-GCCCCU.mcs
MCSYM-DB/2_4/GCCCUC/
MCSYM-DB/2_4/GCCCUC/2_4-GCCCUC.mcs
MCSYM-DB/2_4/GCCCUC/ds-2_4-GCCCUC_x.pdb.gz
MCSYM-DB/2_4/GCCGCC/
MCSYM-DB/2_4/GCCGCC/2_4-GCCGCC.mcs
MCSYM-DB/2_4/GCCGCC/ds-2_4-GCCGCC_x.pdb.gz
MCSYM-DB/2_4/GCCGGA/
MCSYM-DB/2_4/GCCGGA/2_4-GCCGGA.mcs
MCSYM-DB/2_4/GCCGGC/
MCSYM-DB/2_4/GCCGGC/2_4-GCCGGC.mcs
MCSYM-DB/2_4/GCCGGC/ds-2_4-GCCGGC_x.pdb.gz
MCSYM-DB/2_4/GCCGUA/
MCSYM-DB/2_4/GCCGUA/2_4-GCCGUA.mcs
MCSYM-DB/2_4/GCCGUA/ds-2_4-GCCGUA_x.pdb.gz
MCSYM-DB/2_4/GCCUAC/
MCSYM-DB/2_4/GCCUAC/2_4-GCCUAC.mcs
MCSYM-DB/2_4/GCCUCA/
MCSYM-DB/2_4/GCCUCA/2_4-GCCUCA.mcs
MCSYM-DB/2_4/GCCUCC/
MCSYM-DB/2_4/GCCUCC/2_4-GCCUCC.mcs
MCSYM-DB/2_4/GCCUCC/ds-2_4-GCCUCC_x.pdb.gz
MCSYM-DB/2_4/GCCUCU/
MCSYM-DB/2_4/GCCUCU/2_4-GCCUCU.mcs
MCSYM-DB/2_4/GCCUCU/ds-2_4-GCCUCU_x.pdb.gz
MCSYM-DB/2_4/GCCUGC/
MCSYM-DB/2_4/GCCUGC/2_4-GCCUGC.mcs
MCSYM-DB/2_4/GCCUGG/
MCSYM-DB/2_4/GCCUGG/2_4-GCCUGG.mcs
MCSYM-DB/2_4/GCCUUA/
MCSYM-DB/2_4/GCCUUA/2_4-GCCUUA.mcs
MCSYM-DB/2_4/GCCUUC/
MCSYM-DB/2_4/GCCUUC/2_4-GCCUUC.mcs
MCSYM-DB/2_4/GCCUUC/ds-2_4-GCCUUC_x.pdb.gz
MCSYM-DB/2_4/GCCUUU/
MCSYM-DB/2_4/GCCUUU/2_4-GCCUUU.mcs
MCSYM-DB/2_4/GCCUUU/ds-2_4-GCCUUU_x.pdb.gz
MCSYM-DB/2_4/GCGAAA/
MCSYM-DB/2_4/GCGAAA/2_4-GCGAAA.mcs
MCSYM-DB/2_4/GCGAAA/ds-2_4-GCGAAA_x.pdb.gz
MCSYM-DB/2_4/GCGAAC/
MCSYM-DB/2_4/GCGAAC/2_4-GCGAAC.mcs
MCSYM-DB/2_4/GCGAAC/ds-2_4-GCGAAC_x.pdb.gz
MCSYM-DB/2_4/GCGAAG/
MCSYM-DB/2_4/GCGAAG/2_4-GCGAAG.mcs
MCSYM-DB/2_4/GCGAAU/
MCSYM-DB/2_4/GCGAAU/2_4-GCGAAU.mcs
MCSYM-DB/2_4/GCGAAU/ds-2_4-GCGAAU_x.pdb.gz
MCSYM-DB/2_4/GCGACA/
MCSYM-DB/2_4/GCGACA/2_4-GCGACA.mcs
MCSYM-DB/2_4/GCGACC/
MCSYM-DB/2_4/GCGACC/2_4-GCGACC.mcs
MCSYM-DB/2_4/GCGACC/ds-2_4-GCGACC_x.pdb.gz
MCSYM-DB/2_4/GCGACU/
MCSYM-DB/2_4/GCGACU/2_4-GCGACU.mcs
MCSYM-DB/2_4/GCGAGA/
MCSYM-DB/2_4/GCGAGA/2_4-GCGAGA.mcs
MCSYM-DB/2_4/GCGAGC/
MCSYM-DB/2_4/GCGAGC/2_4-GCGAGC.mcs
MCSYM-DB/2_4/GCGAGC/ds-2_4-GCGAGC_x.pdb.gz
MCSYM-DB/2_4/GCGAGG/
MCSYM-DB/2_4/GCGAGG/2_4-GCGAGG.mcs
MCSYM-DB/2_4/GCGAGG/ds-2_4-GCGAGG_x.pdb.gz
MCSYM-DB/2_4/GCGAGU/
MCSYM-DB/2_4/GCGAGU/2_4-GCGAGU.mcs
MCSYM-DB/2_4/GCGAGU/ds-2_4-GCGAGU_x.pdb.gz
MCSYM-DB/2_4/GCGAUA/
MCSYM-DB/2_4/GCGAUA/2_4-GCGAUA.mcs
MCSYM-DB/2_4/GCGAUA/ds-2_4-GCGAUA_x.pdb.gz
MCSYM-DB/2_4/GCGAUC/
MCSYM-DB/2_4/GCGAUC/1XJR_model_1.pdb.gz
MCSYM-DB/2_4/GCGAUC/2_4-GCGAUC.mcs
MCSYM-DB/2_4/GCGAUC/ds-2_4-GCGAUC_x.pdb.gz
MCSYM-DB/2_4/GCGAUU/
MCSYM-DB/2_4/GCGAUU/2_4-GCGAUU.mcs
MCSYM-DB/2_4/GCGAUU/ds-2_4-GCGAUU_x.pdb.gz
MCSYM-DB/2_4/GCGCAA/
MCSYM-DB/2_4/GCGCAA/2_4-GCGCAA.mcs
MCSYM-DB/2_4/GCGCAC/
MCSYM-DB/2_4/GCGCAC/2_4-GCGCAC.mcs
MCSYM-DB/2_4/GCGCAC/ds-2_4-GCGCAC_x.pdb.gz
MCSYM-DB/2_4/GCGCAG/
MCSYM-DB/2_4/GCGCAG/2_4-GCGCAG.mcs
MCSYM-DB/2_4/GCGCCA/
MCSYM-DB/2_4/GCGCCA/2_4-GCGCCA.mcs
MCSYM-DB/2_4/GCGCCA/ds-2_4-GCGCCA_x.pdb.gz
MCSYM-DB/2_4/GCGCCC/
MCSYM-DB/2_4/GCGCCC/2_4-GCGCCC.mcs
MCSYM-DB/2_4/GCGCCC/ds-2_4-GCGCCC_x.pdb.gz
MCSYM-DB/2_4/GCGCCU/
MCSYM-DB/2_4/GCGCCU/2_4-GCGCCU.mcs
MCSYM-DB/2_4/GCGCGA/
MCSYM-DB/2_4/GCGCGA/2_4-GCGCGA.mcs
MCSYM-DB/2_4/GCGCGA/ds-2_4-GCGCGA_x.pdb.gz
MCSYM-DB/2_4/GCGCGC/
MCSYM-DB/2_4/GCGCGC/2_4-GCGCGC.mcs
MCSYM-DB/2_4/GCGCGC/ds-2_4-GCGCGC_x.pdb.gz
MCSYM-DB/2_4/GCGCUC/
MCSYM-DB/2_4/GCGCUC/2_4-GCGCUC.mcs
MCSYM-DB/2_4/GCGCUC/ds-2_4-GCGCUC_x.pdb.gz
MCSYM-DB/2_4/GCGCUG/
MCSYM-DB/2_4/GCGCUG/2_4-GCGCUG.mcs
MCSYM-DB/2_4/GCGGAA/
MCSYM-DB/2_4/GCGGAA/2_4-GCGGAA.mcs
MCSYM-DB/2_4/GCGGAA/ds-2_4-GCGGAA_x.pdb.gz
MCSYM-DB/2_4/GCGGAC/
MCSYM-DB/2_4/GCGGAC/2_4-GCGGAC.mcs
MCSYM-DB/2_4/GCGGAC/ds-2_4-GCGGAC_x.pdb.gz
MCSYM-DB/2_4/GCGGAG/
MCSYM-DB/2_4/GCGGAG/2_4-GCGGAG.mcs
MCSYM-DB/2_4/GCGGAG/ds-2_4-GCGGAG_x.pdb.gz
MCSYM-DB/2_4/GCGGAU/
MCSYM-DB/2_4/GCGGAU/2_4-GCGGAU.mcs
MCSYM-DB/2_4/GCGGAU/ds-2_4-GCGGAU_x.pdb.gz
MCSYM-DB/2_4/GCGGCC/
MCSYM-DB/2_4/GCGGCC/2_4-GCGGCC.mcs
MCSYM-DB/2_4/GCGGCC/ds-2_4-GCGGCC_x.pdb.gz
MCSYM-DB/2_4/GCGGCG/
MCSYM-DB/2_4/GCGGCG/2_4-GCGGCG.mcs
MCSYM-DB/2_4/GCGGCG/ds-2_4-GCGGCG_x.pdb.gz
MCSYM-DB/2_4/GCGGCU/
MCSYM-DB/2_4/GCGGCU/2_4-GCGGCU.mcs
MCSYM-DB/2_4/GCGGCU/ds-2_4-GCGGCU_x.pdb.gz
MCSYM-DB/2_4/GCGGGA/
MCSYM-DB/2_4/GCGGGA/1M5L_model_1.pdb.gz
MCSYM-DB/2_4/GCGGGA/2_4-GCGGGA.mcs
MCSYM-DB/2_4/GCGGGA/ds-2_4-GCGGGA_x.pdb.gz
MCSYM-DB/2_4/GCGGGC/
MCSYM-DB/2_4/GCGGGC/2_4-GCGGGC.mcs
MCSYM-DB/2_4/GCGGGC/ds-2_4-GCGGGC_x.pdb.gz
MCSYM-DB/2_4/GCGGGG/
MCSYM-DB/2_4/GCGGGG/2_4-GCGGGG.mcs
MCSYM-DB/2_4/GCGGGG/ds-2_4-GCGGGG_x.pdb.gz
MCSYM-DB/2_4/GCGGGU/
MCSYM-DB/2_4/GCGGGU/2_4-GCGGGU.mcs
MCSYM-DB/2_4/GCGGGU/ds-2_4-GCGGGU_x.pdb.gz
MCSYM-DB/2_4/GCGGUA/
MCSYM-DB/2_4/GCGGUA/2_4-GCGGUA.mcs
MCSYM-DB/2_4/GCGGUC/
MCSYM-DB/2_4/GCGGUC/2_4-GCGGUC.mcs
MCSYM-DB/2_4/GCGGUC/ds-2_4-GCGGUC_x.pdb.gz
MCSYM-DB/2_4/GCGGUG/
MCSYM-DB/2_4/GCGGUG/2_4-GCGGUG.mcs
MCSYM-DB/2_4/GCGGUU/
MCSYM-DB/2_4/GCGGUU/2_4-GCGGUU.mcs
MCSYM-DB/2_4/GCGGUU/ds-2_4-GCGGUU_x.pdb.gz
MCSYM-DB/2_4/GCGUAA/
MCSYM-DB/2_4/GCGUAA/2_4-GCGUAA.mcs
MCSYM-DB/2_4/GCGUAC/
MCSYM-DB/2_4/GCGUAC/2_4-GCGUAC.mcs
MCSYM-DB/2_4/GCGUAC/ds-2_4-GCGUAC_x.pdb.gz
MCSYM-DB/2_4/GCGUAU/
MCSYM-DB/2_4/GCGUAU/2_4-GCGUAU.mcs
MCSYM-DB/2_4/GCGUCA/
MCSYM-DB/2_4/GCGUCA/2_4-GCGUCA.mcs
MCSYM-DB/2_4/GCGUCC/
MCSYM-DB/2_4/GCGUCC/2_4-GCGUCC.mcs
MCSYM-DB/2_4/GCGUCC/ds-2_4-GCGUCC_x.pdb.gz
MCSYM-DB/2_4/GCGUCU/
MCSYM-DB/2_4/GCGUCU/2_4-GCGUCU.mcs
MCSYM-DB/2_4/GCGUGA/
MCSYM-DB/2_4/GCGUGA/2_4-GCGUGA.mcs
MCSYM-DB/2_4/GCGUGC/
MCSYM-DB/2_4/GCGUGC/2_4-GCGUGC.mcs
MCSYM-DB/2_4/GCGUGC/ds-2_4-GCGUGC_x.pdb.gz
MCSYM-DB/2_4/GCGUGG/
MCSYM-DB/2_4/GCGUGG/2_4-GCGUGG.mcs
MCSYM-DB/2_4/GCGUGU/
MCSYM-DB/2_4/GCGUGU/2_4-GCGUGU.mcs
MCSYM-DB/2_4/GCGUUA/
MCSYM-DB/2_4/GCGUUA/2_4-GCGUUA.mcs
MCSYM-DB/2_4/GCGUUA/ds-2_4-GCGUUA_x.pdb.gz
MCSYM-DB/2_4/GCGUUC/
MCSYM-DB/2_4/GCGUUC/2_4-GCGUUC.mcs
MCSYM-DB/2_4/GCGUUC/ds-2_4-GCGUUC_x.pdb.gz
MCSYM-DB/2_4/GCGUUG/
MCSYM-DB/2_4/GCGUUG/2_4-GCGUUG.mcs
MCSYM-DB/2_4/GCGUUG/ds-2_4-GCGUUG_x.pdb.gz
MCSYM-DB/2_4/GCGUUU/
MCSYM-DB/2_4/GCGUUU/2_4-GCGUUU.mcs
MCSYM-DB/2_4/GCUAAA/
MCSYM-DB/2_4/GCUAAA/2_4-GCUAAA.mcs
MCSYM-DB/2_4/GCUAAA/ds-2_4-GCUAAA_x.pdb.gz
MCSYM-DB/2_4/GCUAAC/
MCSYM-DB/2_4/GCUAAC/2_4-GCUAAC.mcs
MCSYM-DB/2_4/GCUAAC/ds-2_4-GCUAAC_x.pdb.gz
MCSYM-DB/2_4/GCUAAU/
MCSYM-DB/2_4/GCUAAU/2_4-GCUAAU.mcs
MCSYM-DB/2_4/GCUAAU/ds-2_4-GCUAAU_x.pdb.gz
MCSYM-DB/2_4/GCUACC/
MCSYM-DB/2_4/GCUACC/2_4-GCUACC.mcs
MCSYM-DB/2_4/GCUACC/ds-2_4-GCUACC_x.pdb.gz
MCSYM-DB/2_4/GCUAGC/
MCSYM-DB/2_4/GCUAGC/2_4-GCUAGC.mcs
MCSYM-DB/2_4/GCUAUC/
MCSYM-DB/2_4/GCUAUC/2_4-GCUAUC.mcs
MCSYM-DB/2_4/GCUAUC/ds-2_4-GCUAUC_x.pdb.gz
MCSYM-DB/2_4/GCUCAC/
MCSYM-DB/2_4/GCUCAC/2_4-GCUCAC.mcs
MCSYM-DB/2_4/GCUCCC/
MCSYM-DB/2_4/GCUCCC/2_4-GCUCCC.mcs
MCSYM-DB/2_4/GCUCCC/ds-2_4-GCUCCC_x.pdb.gz
MCSYM-DB/2_4/GCUCCU/
MCSYM-DB/2_4/GCUCCU/2_4-GCUCCU.mcs
MCSYM-DB/2_4/GCUCUC/
MCSYM-DB/2_4/GCUCUC/2_4-GCUCUC.mcs
MCSYM-DB/2_4/GCUGAC/
MCSYM-DB/2_4/GCUGAC/2_4-GCUGAC.mcs
MCSYM-DB/2_4/GCUGGA/
MCSYM-DB/2_4/GCUGGA/2_4-GCUGGA.mcs
MCSYM-DB/2_4/GCUGGA/ds-2_4-GCUGGA_x.pdb.gz
MCSYM-DB/2_4/GCUGGC/
MCSYM-DB/2_4/GCUGGC/2_4-GCUGGC.mcs
MCSYM-DB/2_4/GCUGGG/
MCSYM-DB/2_4/GCUGGG/2_4-GCUGGG.mcs
MCSYM-DB/2_4/GCUGGG/ds-2_4-GCUGGG_x.pdb.gz
MCSYM-DB/2_4/GCUGGU/
MCSYM-DB/2_4/GCUGGU/2_4-GCUGGU.mcs
MCSYM-DB/2_4/GCUGUU/
MCSYM-DB/2_4/GCUGUU/2_4-GCUGUU.mcs
MCSYM-DB/2_4/GCUGUU/ds-2_4-GCUGUU_x.pdb.gz
MCSYM-DB/2_4/GCUUAU/
MCSYM-DB/2_4/GCUUAU/2_4-GCUUAU.mcs
MCSYM-DB/2_4/GCUUCC/
MCSYM-DB/2_4/GCUUCC/2_4-GCUUCC.mcs
MCSYM-DB/2_4/GGAAAU/
MCSYM-DB/2_4/GGAAAU/2_4-GGAAAU.mcs
MCSYM-DB/2_4/GGAAAU/ds-2_4-GGAAAU_x.pdb.gz
MCSYM-DB/2_4/GGAACC/
MCSYM-DB/2_4/GGAACC/2_4-GGAACC.mcs
MCSYM-DB/2_4/GGAAGA/
MCSYM-DB/2_4/GGAAGA/2_4-GGAAGA.mcs
MCSYM-DB/2_4/GGAAGA/ds-2_4-GGAAGA_x.pdb.gz
MCSYM-DB/2_4/GGAAGC/
MCSYM-DB/2_4/GGAAGC/2_4-GGAAGC.mcs
MCSYM-DB/2_4/GGAAGC/ds-2_4-GGAAGC_x.pdb.gz
MCSYM-DB/2_4/GGAAGG/
MCSYM-DB/2_4/GGAAGG/2_4-GGAAGG.mcs
MCSYM-DB/2_4/GGAAGG/ds-2_4-GGAAGG_x.pdb.gz
MCSYM-DB/2_4/GGAAUC/
MCSYM-DB/2_4/GGAAUC/2_4-GGAAUC.mcs
MCSYM-DB/2_4/GGAAUC/ds-2_4-GGAAUC_x.pdb.gz
MCSYM-DB/2_4/GGAAUG/
MCSYM-DB/2_4/GGAAUG/2_4-GGAAUG.mcs
MCSYM-DB/2_4/GGAAUG/ds-2_4-GGAAUG_x.pdb.gz
MCSYM-DB/2_4/GGAAUU/
MCSYM-DB/2_4/GGAAUU/2_4-GGAAUU.mcs
MCSYM-DB/2_4/GGAAUU/ds-2_4-GGAAUU_x.pdb.gz
MCSYM-DB/2_4/GGACAC/
MCSYM-DB/2_4/GGACAC/2_4-GGACAC.mcs
MCSYM-DB/2_4/GGACGC/
MCSYM-DB/2_4/GGACGC/2_4-GGACGC.mcs
MCSYM-DB/2_4/GGACGC/ds-2_4-GGACGC_x.pdb.gz
MCSYM-DB/2_4/GGACGU/
MCSYM-DB/2_4/GGACGU/2_4-GGACGU.mcs
MCSYM-DB/2_4/GGACUG/
MCSYM-DB/2_4/GGACUG/2_4-GGACUG.mcs
MCSYM-DB/2_4/GGAGAA/
MCSYM-DB/2_4/GGAGAA/2_4-GGAGAA.mcs
MCSYM-DB/2_4/GGAGAC/
MCSYM-DB/2_4/GGAGAC/2_4-GGAGAC.mcs
MCSYM-DB/2_4/GGAGAC/ds-2_4-GGAGAC_x.pdb.gz
MCSYM-DB/2_4/GGAGAU/
MCSYM-DB/2_4/GGAGAU/2_4-GGAGAU.mcs
MCSYM-DB/2_4/GGAGCC/
MCSYM-DB/2_4/GGAGCC/2_4-GGAGCC.mcs
MCSYM-DB/2_4/GGAGGA/
MCSYM-DB/2_4/GGAGGA/2_4-GGAGGA.mcs
MCSYM-DB/2_4/GGAGGA/ds-2_4-GGAGGA_x.pdb.gz
MCSYM-DB/2_4/GGAGGC/
MCSYM-DB/2_4/GGAGGC/1N8X_model_1.pdb.gz
MCSYM-DB/2_4/GGAGGC/1OSW_model_1.pdb.gz
MCSYM-DB/2_4/GGAGGC/2D17_model_1.pdb.gz
MCSYM-DB/2_4/GGAGGC/2D1A_model_1.pdb.gz
MCSYM-DB/2_4/GGAGGC/2GM0_model_1.pdb.gz
MCSYM-DB/2_4/GGAGGC/2_4-GGAGGC.mcs
MCSYM-DB/2_4/GGAGGC/ds-2_4-GGAGGC_x.pdb.gz
MCSYM-DB/2_4/GGAGGU/
MCSYM-DB/2_4/GGAGGU/2_4-GGAGGU.mcs
MCSYM-DB/2_4/GGAGGU/ds-2_4-GGAGGU_x.pdb.gz
MCSYM-DB/2_4/GGAGUC/
MCSYM-DB/2_4/GGAGUC/2_4-GGAGUC.mcs
MCSYM-DB/2_4/GGAGUC/ds-2_4-GGAGUC_x.pdb.gz
MCSYM-DB/2_4/GGAGUU/
MCSYM-DB/2_4/GGAGUU/2_4-GGAGUU.mcs
MCSYM-DB/2_4/GGAGUU/ds-2_4-GGAGUU_x.pdb.gz
MCSYM-DB/2_4/GGAUAC/
MCSYM-DB/2_4/GGAUAC/2_4-GGAUAC.mcs
MCSYM-DB/2_4/GGAUAG/
MCSYM-DB/2_4/GGAUAG/2_4-GGAUAG.mcs
MCSYM-DB/2_4/GGAUCA/
MCSYM-DB/2_4/GGAUCA/2_4-GGAUCA.mcs
MCSYM-DB/2_4/GGAUCA/ds-2_4-GGAUCA_x.pdb.gz
MCSYM-DB/2_4/GGAUGC/
MCSYM-DB/2_4/GGAUGC/2_4-GGAUGC.mcs
MCSYM-DB/2_4/GGAUUC/
MCSYM-DB/2_4/GGAUUC/2_4-GGAUUC.mcs
MCSYM-DB/2_4/GGAUUU/
MCSYM-DB/2_4/GGAUUU/2_4-GGAUUU.mcs
MCSYM-DB/2_4/GGCAAA/
MCSYM-DB/2_4/GGCAAA/2_4-GGCAAA.mcs
MCSYM-DB/2_4/GGCAAA/ds-2_4-GGCAAA_x.pdb.gz
MCSYM-DB/2_4/GGCAAC/
MCSYM-DB/2_4/GGCAAC/2_4-GGCAAC.mcs
MCSYM-DB/2_4/GGCAAC/ds-2_4-GGCAAC_x.pdb.gz
MCSYM-DB/2_4/GGCAAG/
MCSYM-DB/2_4/GGCAAG/2_4-GGCAAG.mcs
MCSYM-DB/2_4/GGCACA/
MCSYM-DB/2_4/GGCACA/2_4-GGCACA.mcs
MCSYM-DB/2_4/GGCACC/
MCSYM-DB/2_4/GGCACC/2_4-GGCACC.mcs
MCSYM-DB/2_4/GGCACC/ds-2_4-GGCACC_x.pdb.gz
MCSYM-DB/2_4/GGCACU/
MCSYM-DB/2_4/GGCACU/2_4-GGCACU.mcs
MCSYM-DB/2_4/GGCACU/ds-2_4-GGCACU_x.pdb.gz
MCSYM-DB/2_4/GGCAGA/
MCSYM-DB/2_4/GGCAGA/2_4-GGCAGA.mcs
MCSYM-DB/2_4/GGCAGA/ds-2_4-GGCAGA_x.pdb.gz
MCSYM-DB/2_4/GGCAGC/
MCSYM-DB/2_4/GGCAGC/1U9S_model_1.pdb.gz
MCSYM-DB/2_4/GGCAGC/2_4-GGCAGC.mcs
MCSYM-DB/2_4/GGCAGC/ds-2_4-GGCAGC_x.pdb.gz
MCSYM-DB/2_4/GGCAGU/
MCSYM-DB/2_4/GGCAGU/2_4-GGCAGU.mcs
MCSYM-DB/2_4/GGCAGU/ds-2_4-GGCAGU_x.pdb.gz
MCSYM-DB/2_4/GGCAUA/
MCSYM-DB/2_4/GGCAUA/2_4-GGCAUA.mcs
MCSYM-DB/2_4/GGCAUA/ds-2_4-GGCAUA_x.pdb.gz
MCSYM-DB/2_4/GGCAUC/
MCSYM-DB/2_4/GGCAUC/2_4-GGCAUC.mcs
MCSYM-DB/2_4/GGCAUC/ds-2_4-GGCAUC_x.pdb.gz
MCSYM-DB/2_4/GGCAUG/
MCSYM-DB/2_4/GGCAUG/2_4-GGCAUG.mcs
MCSYM-DB/2_4/GGCAUU/
MCSYM-DB/2_4/GGCAUU/2_4-GGCAUU.mcs
MCSYM-DB/2_4/GGCCAA/
MCSYM-DB/2_4/GGCCAA/2_4-GGCCAA.mcs
MCSYM-DB/2_4/GGCCAA/ds-2_4-GGCCAA_x.pdb.gz
MCSYM-DB/2_4/GGCCAC/
MCSYM-DB/2_4/GGCCAC/2_4-GGCCAC.mcs
MCSYM-DB/2_4/GGCCAC/ds-2_4-GGCCAC_x.pdb.gz
MCSYM-DB/2_4/GGCCAG/
MCSYM-DB/2_4/GGCCAG/2_4-GGCCAG.mcs
MCSYM-DB/2_4/GGCCCC/
MCSYM-DB/2_4/GGCCCC/2_4-GGCCCC.mcs
MCSYM-DB/2_4/GGCCCC/ds-2_4-GGCCCC_x.pdb.gz
MCSYM-DB/2_4/GGCCCU/
MCSYM-DB/2_4/GGCCCU/2_4-GGCCCU.mcs
MCSYM-DB/2_4/GGCCGC/
MCSYM-DB/2_4/GGCCGC/2_4-GGCCGC.mcs
MCSYM-DB/2_4/GGCCGC/ds-2_4-GGCCGC_x.pdb.gz
MCSYM-DB/2_4/GGCCGG/
MCSYM-DB/2_4/GGCCGG/2_4-GGCCGG.mcs
MCSYM-DB/2_4/GGCCGG/ds-2_4-GGCCGG_x.pdb.gz
MCSYM-DB/2_4/GGCCGU/
MCSYM-DB/2_4/GGCCGU/2_4-GGCCGU.mcs
MCSYM-DB/2_4/GGCCGU/ds-2_4-GGCCGU_x.pdb.gz
MCSYM-DB/2_4/GGCCUA/
MCSYM-DB/2_4/GGCCUA/2_4-GGCCUA.mcs
MCSYM-DB/2_4/GGCCUC/
MCSYM-DB/2_4/GGCCUC/2_4-GGCCUC.mcs
MCSYM-DB/2_4/GGCCUC/ds-2_4-GGCCUC_x.pdb.gz
MCSYM-DB/2_4/GGCCUU/
MCSYM-DB/2_4/GGCCUU/2_4-GGCCUU.mcs
MCSYM-DB/2_4/GGCGAA/
MCSYM-DB/2_4/GGCGAA/2_4-GGCGAA.mcs
MCSYM-DB/2_4/GGCGAA/ds-2_4-GGCGAA_x.pdb.gz
MCSYM-DB/2_4/GGCGAC/
MCSYM-DB/2_4/GGCGAC/2_4-GGCGAC.mcs
MCSYM-DB/2_4/GGCGAC/ds-2_4-GGCGAC_x.pdb.gz
MCSYM-DB/2_4/GGCGAU/
MCSYM-DB/2_4/GGCGAU/2_4-GGCGAU.mcs
MCSYM-DB/2_4/GGCGAU/ds-2_4-GGCGAU_x.pdb.gz
MCSYM-DB/2_4/GGCGCA/
MCSYM-DB/2_4/GGCGCA/2_4-GGCGCA.mcs
MCSYM-DB/2_4/GGCGCC/
MCSYM-DB/2_4/GGCGCC/2_4-GGCGCC.mcs
MCSYM-DB/2_4/GGCGCC/ds-2_4-GGCGCC_x.pdb.gz
MCSYM-DB/2_4/GGCGCU/
MCSYM-DB/2_4/GGCGCU/2_4-GGCGCU.mcs
MCSYM-DB/2_4/GGCGCU/ds-2_4-GGCGCU_x.pdb.gz
MCSYM-DB/2_4/GGCGGA/
MCSYM-DB/2_4/GGCGGA/2_4-GGCGGA.mcs
MCSYM-DB/2_4/GGCGGA/ds-2_4-GGCGGA_x.pdb.gz
MCSYM-DB/2_4/GGCGGC/
MCSYM-DB/2_4/GGCGGC/2_4-GGCGGC.mcs
MCSYM-DB/2_4/GGCGGC/ds-2_4-GGCGGC_x.pdb.gz
MCSYM-DB/2_4/GGCGGG/
MCSYM-DB/2_4/GGCGGG/2_4-GGCGGG.mcs
MCSYM-DB/2_4/GGCGGG/ds-2_4-GGCGGG_x.pdb.gz
MCSYM-DB/2_4/GGCGGU/
MCSYM-DB/2_4/GGCGGU/2_4-GGCGGU.mcs
MCSYM-DB/2_4/GGCGGU/ds-2_4-GGCGGU_x.pdb.gz
MCSYM-DB/2_4/GGCGUA/
MCSYM-DB/2_4/GGCGUA/2_4-GGCGUA.mcs
MCSYM-DB/2_4/GGCGUA/ds-2_4-GGCGUA_x.pdb.gz
MCSYM-DB/2_4/GGCGUC/
MCSYM-DB/2_4/GGCGUC/2_4-GGCGUC.mcs
MCSYM-DB/2_4/GGCGUC/ds-2_4-GGCGUC_x.pdb.gz
MCSYM-DB/2_4/GGCGUU/
MCSYM-DB/2_4/GGCGUU/2_4-GGCGUU.mcs
MCSYM-DB/2_4/GGCGUU/ds-2_4-GGCGUU_x.pdb.gz
MCSYM-DB/2_4/GGCUAA/
MCSYM-DB/2_4/GGCUAA/2_4-GGCUAA.mcs
MCSYM-DB/2_4/GGCUAC/
MCSYM-DB/2_4/GGCUAC/2_4-GGCUAC.mcs
MCSYM-DB/2_4/GGCUAC/ds-2_4-GGCUAC_x.pdb.gz
MCSYM-DB/2_4/GGCUAU/
MCSYM-DB/2_4/GGCUAU/2_4-GGCUAU.mcs
MCSYM-DB/2_4/GGCUAU/ds-2_4-GGCUAU_x.pdb.gz
MCSYM-DB/2_4/GGCUCA/
MCSYM-DB/2_4/GGCUCA/2_4-GGCUCA.mcs
MCSYM-DB/2_4/GGCUCC/
MCSYM-DB/2_4/GGCUCC/2_4-GGCUCC.mcs
MCSYM-DB/2_4/GGCUCC/ds-2_4-GGCUCC_x.pdb.gz
MCSYM-DB/2_4/GGCUCG/
MCSYM-DB/2_4/GGCUCG/2_4-GGCUCG.mcs
MCSYM-DB/2_4/GGCUCG/ds-2_4-GGCUCG_x.pdb.gz
MCSYM-DB/2_4/GGCUCU/
MCSYM-DB/2_4/GGCUCU/2_4-GGCUCU.mcs
MCSYM-DB/2_4/GGCUGA/
MCSYM-DB/2_4/GGCUGA/2_4-GGCUGA.mcs
MCSYM-DB/2_4/GGCUGC/
MCSYM-DB/2_4/GGCUGC/2_4-GGCUGC.mcs
MCSYM-DB/2_4/GGCUGC/ds-2_4-GGCUGC_x.pdb.gz
MCSYM-DB/2_4/GGCUGG/
MCSYM-DB/2_4/GGCUGG/2_4-GGCUGG.mcs
MCSYM-DB/2_4/GGCUGU/
MCSYM-DB/2_4/GGCUGU/2_4-GGCUGU.mcs
MCSYM-DB/2_4/GGCUGU/ds-2_4-GGCUGU_x.pdb.gz
MCSYM-DB/2_4/GGCUUA/
MCSYM-DB/2_4/GGCUUA/2_4-GGCUUA.mcs
MCSYM-DB/2_4/GGCUUC/
MCSYM-DB/2_4/GGCUUC/2_4-GGCUUC.mcs
MCSYM-DB/2_4/GGCUUC/ds-2_4-GGCUUC_x.pdb.gz
MCSYM-DB/2_4/GGCUUU/
MCSYM-DB/2_4/GGCUUU/2_4-GGCUUU.mcs
MCSYM-DB/2_4/GGGAAU/
MCSYM-DB/2_4/GGGAAU/2_4-GGGAAU.mcs
MCSYM-DB/2_4/GGGAAU/ds-2_4-GGGAAU_x.pdb.gz
MCSYM-DB/2_4/GGGAGA/
MCSYM-DB/2_4/GGGAGA/2_4-GGGAGA.mcs
MCSYM-DB/2_4/GGGAGA/ds-2_4-GGGAGA_x.pdb.gz
MCSYM-DB/2_4/GGGAGC/
MCSYM-DB/2_4/GGGAGC/2_4-GGGAGC.mcs
MCSYM-DB/2_4/GGGAUC/
MCSYM-DB/2_4/GGGAUC/2_4-GGGAUC.mcs
MCSYM-DB/2_4/GGGCAC/
MCSYM-DB/2_4/GGGCAC/2_4-GGGCAC.mcs
MCSYM-DB/2_4/GGGCAC/ds-2_4-GGGCAC_x.pdb.gz
MCSYM-DB/2_4/GGGCAG/
MCSYM-DB/2_4/GGGCAG/2_4-GGGCAG.mcs
MCSYM-DB/2_4/GGGCAG/ds-2_4-GGGCAG_x.pdb.gz
MCSYM-DB/2_4/GGGCGC/
MCSYM-DB/2_4/GGGCGC/2_4-GGGCGC.mcs
MCSYM-DB/2_4/GGGCUC/
MCSYM-DB/2_4/GGGCUC/2_4-GGGCUC.mcs
MCSYM-DB/2_4/GGGGAA/
MCSYM-DB/2_4/GGGGAA/2_4-GGGGAA.mcs
MCSYM-DB/2_4/GGGGAC/
MCSYM-DB/2_4/GGGGAC/2_4-GGGGAC.mcs
MCSYM-DB/2_4/GGGGAG/
MCSYM-DB/2_4/GGGGAG/2_4-GGGGAG.mcs
MCSYM-DB/2_4/GGGGAG/ds-2_4-GGGGAG_x.pdb.gz
MCSYM-DB/2_4/GGGGCC/
MCSYM-DB/2_4/GGGGCC/2_4-GGGGCC.mcs
MCSYM-DB/2_4/GGGGCC/ds-2_4-GGGGCC_x.pdb.gz
MCSYM-DB/2_4/GGGGCG/
MCSYM-DB/2_4/GGGGCG/2_4-GGGGCG.mcs
MCSYM-DB/2_4/GGGGCG/ds-2_4-GGGGCG_x.pdb.gz
MCSYM-DB/2_4/GGGGCU/
MCSYM-DB/2_4/GGGGCU/2_4-GGGGCU.mcs
MCSYM-DB/2_4/GGGGCU/ds-2_4-GGGGCU_x.pdb.gz
MCSYM-DB/2_4/GGGGGC/
MCSYM-DB/2_4/GGGGGC/2_4-GGGGGC.mcs
MCSYM-DB/2_4/GGGGGC/ds-2_4-GGGGGC_x.pdb.gz
MCSYM-DB/2_4/GGGGGG/
MCSYM-DB/2_4/GGGGGG/2_4-GGGGGG.mcs
MCSYM-DB/2_4/GGGGGG/ds-2_4-GGGGGG_x.pdb.gz
MCSYM-DB/2_4/GGGGUC/
MCSYM-DB/2_4/GGGGUC/2_4-GGGGUC.mcs
MCSYM-DB/2_4/GGGGUG/
MCSYM-DB/2_4/GGGGUG/2_4-GGGGUG.mcs
MCSYM-DB/2_4/GGGGUG/ds-2_4-GGGGUG_x.pdb.gz
MCSYM-DB/2_4/GGGGUU/
MCSYM-DB/2_4/GGGGUU/2_4-GGGGUU.mcs
MCSYM-DB/2_4/GGGGUU/ds-2_4-GGGGUU_x.pdb.gz
MCSYM-DB/2_4/GGGUGA/
MCSYM-DB/2_4/GGGUGA/2_4-GGGUGA.mcs
MCSYM-DB/2_4/GGGUGA/ds-2_4-GGGUGA_x.pdb.gz
MCSYM-DB/2_4/GGGUGC/
MCSYM-DB/2_4/GGGUGC/2_4-GGGUGC.mcs
MCSYM-DB/2_4/GGGUGU/
MCSYM-DB/2_4/GGGUGU/2_4-GGGUGU.mcs
MCSYM-DB/2_4/GGGUGU/ds-2_4-GGGUGU_x.pdb.gz
MCSYM-DB/2_4/GGGUUC/
MCSYM-DB/2_4/GGGUUC/2_4-GGGUUC.mcs
MCSYM-DB/2_4/GGGUUC/ds-2_4-GGGUUC_x.pdb.gz
MCSYM-DB/2_4/GGUAAC/
MCSYM-DB/2_4/GGUAAC/2_4-GGUAAC.mcs
MCSYM-DB/2_4/GGUAAC/ds-2_4-GGUAAC_x.pdb.gz
MCSYM-DB/2_4/GGUAAU/
MCSYM-DB/2_4/GGUAAU/2_4-GGUAAU.mcs
MCSYM-DB/2_4/GGUAAU/ds-2_4-GGUAAU_x.pdb.gz
MCSYM-DB/2_4/GGUACC/
MCSYM-DB/2_4/GGUACC/2_4-GGUACC.mcs
MCSYM-DB/2_4/GGUACU/
MCSYM-DB/2_4/GGUACU/2_4-GGUACU.mcs
MCSYM-DB/2_4/GGUAGA/
MCSYM-DB/2_4/GGUAGA/2_4-GGUAGA.mcs
MCSYM-DB/2_4/GGUAGA/ds-2_4-GGUAGA_x.pdb.gz
MCSYM-DB/2_4/GGUAGC/
MCSYM-DB/2_4/GGUAGC/2_4-GGUAGC.mcs
MCSYM-DB/2_4/GGUAGC/ds-2_4-GGUAGC_x.pdb.gz
MCSYM-DB/2_4/GGUAGU/
MCSYM-DB/2_4/GGUAGU/2_4-GGUAGU.mcs
MCSYM-DB/2_4/GGUAUC/
MCSYM-DB/2_4/GGUAUC/2_4-GGUAUC.mcs
MCSYM-DB/2_4/GGUAUU/
MCSYM-DB/2_4/GGUAUU/2_4-GGUAUU.mcs
MCSYM-DB/2_4/GGUAUU/ds-2_4-GGUAUU_x.pdb.gz
MCSYM-DB/2_4/GGUCAA/
MCSYM-DB/2_4/GGUCAA/2_4-GGUCAA.mcs
MCSYM-DB/2_4/GGUCAA/ds-2_4-GGUCAA_x.pdb.gz
MCSYM-DB/2_4/GGUCAC/
MCSYM-DB/2_4/GGUCAC/2_4-GGUCAC.mcs
MCSYM-DB/2_4/GGUCAU/
MCSYM-DB/2_4/GGUCAU/2_4-GGUCAU.mcs
MCSYM-DB/2_4/GGUCCA/
MCSYM-DB/2_4/GGUCCA/2_4-GGUCCA.mcs
MCSYM-DB/2_4/GGUCGC/
MCSYM-DB/2_4/GGUCGC/2_4-GGUCGC.mcs
MCSYM-DB/2_4/GGUCGC/ds-2_4-GGUCGC_x.pdb.gz
MCSYM-DB/2_4/GGUCUC/
MCSYM-DB/2_4/GGUCUC/2_4-GGUCUC.mcs
MCSYM-DB/2_4/GGUGAC/
MCSYM-DB/2_4/GGUGAC/2_4-GGUGAC.mcs
MCSYM-DB/2_4/GGUGAC/ds-2_4-GGUGAC_x.pdb.gz
MCSYM-DB/2_4/GGUGAG/
MCSYM-DB/2_4/GGUGAG/2_4-GGUGAG.mcs
MCSYM-DB/2_4/GGUGAG/ds-2_4-GGUGAG_x.pdb.gz
MCSYM-DB/2_4/GGUGCC/
MCSYM-DB/2_4/GGUGCC/2_4-GGUGCC.mcs
MCSYM-DB/2_4/GGUGGA/
MCSYM-DB/2_4/GGUGGA/2_4-GGUGGA.mcs
MCSYM-DB/2_4/GGUGGA/ds-2_4-GGUGGA_x.pdb.gz
MCSYM-DB/2_4/GGUGGC/
MCSYM-DB/2_4/GGUGGC/2_4-GGUGGC.mcs
MCSYM-DB/2_4/GGUGGC/ds-2_4-GGUGGC_x.pdb.gz
MCSYM-DB/2_4/GGUGGG/
MCSYM-DB/2_4/GGUGGG/2_4-GGUGGG.mcs
MCSYM-DB/2_4/GGUGGU/
MCSYM-DB/2_4/GGUGGU/2_4-GGUGGU.mcs
MCSYM-DB/2_4/GGUGGU/ds-2_4-GGUGGU_x.pdb.gz
MCSYM-DB/2_4/GGUGUC/
MCSYM-DB/2_4/GGUGUC/2_4-GGUGUC.mcs
MCSYM-DB/2_4/GGUGUC/ds-2_4-GGUGUC_x.pdb.gz
MCSYM-DB/2_4/GGUGUG/
MCSYM-DB/2_4/GGUGUG/2_4-GGUGUG.mcs
MCSYM-DB/2_4/GGUUAC/
MCSYM-DB/2_4/GGUUAC/1L1C_model_1.pdb.gz
MCSYM-DB/2_4/GGUUAC/2_4-GGUUAC.mcs
MCSYM-DB/2_4/GGUUAC/ds-2_4-GGUUAC_x.pdb.gz
MCSYM-DB/2_4/GGUUAG/
MCSYM-DB/2_4/GGUUAG/2_4-GGUUAG.mcs
MCSYM-DB/2_4/GGUUCC/
MCSYM-DB/2_4/GGUUCC/2_4-GGUUCC.mcs
MCSYM-DB/2_4/GGUUCU/
MCSYM-DB/2_4/GGUUCU/2_4-GGUUCU.mcs
MCSYM-DB/2_4/GGUUGA/
MCSYM-DB/2_4/GGUUGA/2_4-GGUUGA.mcs
MCSYM-DB/2_4/GGUUGA/ds-2_4-GGUUGA_x.pdb.gz
MCSYM-DB/2_4/GGUUGC/
MCSYM-DB/2_4/GGUUGC/2_4-GGUUGC.mcs
MCSYM-DB/2_4/GGUUGC/ds-2_4-GGUUGC_x.pdb.gz
MCSYM-DB/2_4/GGUUGG/
MCSYM-DB/2_4/GGUUGG/2_4-GGUUGG.mcs
MCSYM-DB/2_4/GGUUGU/
MCSYM-DB/2_4/GGUUGU/2_4-GGUUGU.mcs
MCSYM-DB/2_4/GGUUUA/
MCSYM-DB/2_4/GGUUUA/2_4-GGUUUA.mcs
MCSYM-DB/2_4/GGUUUA/ds-2_4-GGUUUA_x.pdb.gz
MCSYM-DB/2_4/GGUUUC/
MCSYM-DB/2_4/GGUUUC/2_4-GGUUUC.mcs
MCSYM-DB/2_4/GGUUUC/ds-2_4-GGUUUC_x.pdb.gz
MCSYM-DB/2_4/GGUUUU/
MCSYM-DB/2_4/GGUUUU/2_4-GGUUUU.mcs
MCSYM-DB/2_4/GGUUUU/ds-2_4-GGUUUU_x.pdb.gz
MCSYM-DB/2_4/GUAAAA/
MCSYM-DB/2_4/GUAAAA/2_4-GUAAAA.mcs
MCSYM-DB/2_4/GUAAAC/
MCSYM-DB/2_4/GUAAAC/2_4-GUAAAC.mcs
MCSYM-DB/2_4/GUAAAG/
MCSYM-DB/2_4/GUAAAG/2_4-GUAAAG.mcs
MCSYM-DB/2_4/GUAAAU/
MCSYM-DB/2_4/GUAAAU/2_4-GUAAAU.mcs
MCSYM-DB/2_4/GUAACA/
MCSYM-DB/2_4/GUAACA/2_4-GUAACA.mcs
MCSYM-DB/2_4/GUAACC/
MCSYM-DB/2_4/GUAACC/2_4-GUAACC.mcs
MCSYM-DB/2_4/GUAACC/ds-2_4-GUAACC_x.pdb.gz
MCSYM-DB/2_4/GUAACU/
MCSYM-DB/2_4/GUAACU/2_4-GUAACU.mcs
MCSYM-DB/2_4/GUAACU/ds-2_4-GUAACU_x.pdb.gz
MCSYM-DB/2_4/GUAAGA/
MCSYM-DB/2_4/GUAAGA/2_4-GUAAGA.mcs
MCSYM-DB/2_4/GUAAGA/ds-2_4-GUAAGA_x.pdb.gz
MCSYM-DB/2_4/GUAAGC/
MCSYM-DB/2_4/GUAAGC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/GUAAGC/2_4-GUAAGC.mcs
MCSYM-DB/2_4/GUAAGC/ds-2_4-GUAAGC_x.pdb.gz
MCSYM-DB/2_4/GUAAGG/
MCSYM-DB/2_4/GUAAGG/2_4-GUAAGG.mcs
MCSYM-DB/2_4/GUAAGU/
MCSYM-DB/2_4/GUAAGU/2_4-GUAAGU.mcs
MCSYM-DB/2_4/GUAAUA/
MCSYM-DB/2_4/GUAAUA/2_4-GUAAUA.mcs
MCSYM-DB/2_4/GUAAUA/ds-2_4-GUAAUA_x.pdb.gz
MCSYM-DB/2_4/GUAAUC/
MCSYM-DB/2_4/GUAAUC/1EUY_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/1EXD_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/1J1U_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/1ZE2_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/1ZJW_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/2AB4_model_1.pdb.gz
MCSYM-DB/2_4/GUAAUC/2_4-GUAAUC.mcs
MCSYM-DB/2_4/GUAAUC/ds-2_4-GUAAUC_x.pdb.gz
MCSYM-DB/2_4/GUAAUU/
MCSYM-DB/2_4/GUAAUU/2_4-GUAAUU.mcs
MCSYM-DB/2_4/GUAAUU/ds-2_4-GUAAUU_x.pdb.gz
MCSYM-DB/2_4/GUACAA/
MCSYM-DB/2_4/GUACAA/2_4-GUACAA.mcs
MCSYM-DB/2_4/GUACAC/
MCSYM-DB/2_4/GUACAC/2_4-GUACAC.mcs
MCSYM-DB/2_4/GUACAC/ds-2_4-GUACAC_x.pdb.gz
MCSYM-DB/2_4/GUACAG/
MCSYM-DB/2_4/GUACAG/2_4-GUACAG.mcs
MCSYM-DB/2_4/GUACAU/
MCSYM-DB/2_4/GUACAU/2_4-GUACAU.mcs
MCSYM-DB/2_4/GUACCA/
MCSYM-DB/2_4/GUACCA/2_4-GUACCA.mcs
MCSYM-DB/2_4/GUACCC/
MCSYM-DB/2_4/GUACCC/2_4-GUACCC.mcs
MCSYM-DB/2_4/GUACCC/ds-2_4-GUACCC_x.pdb.gz
MCSYM-DB/2_4/GUACCU/
MCSYM-DB/2_4/GUACCU/2_4-GUACCU.mcs
MCSYM-DB/2_4/GUACCU/ds-2_4-GUACCU_x.pdb.gz
MCSYM-DB/2_4/GUACGC/
MCSYM-DB/2_4/GUACGC/2_4-GUACGC.mcs
MCSYM-DB/2_4/GUACGC/ds-2_4-GUACGC_x.pdb.gz
MCSYM-DB/2_4/GUACGU/
MCSYM-DB/2_4/GUACGU/2_4-GUACGU.mcs
MCSYM-DB/2_4/GUACUC/
MCSYM-DB/2_4/GUACUC/1U0B_model_1.pdb.gz
MCSYM-DB/2_4/GUACUC/2_4-GUACUC.mcs
MCSYM-DB/2_4/GUACUC/ds-2_4-GUACUC_x.pdb.gz
MCSYM-DB/2_4/GUACUG/
MCSYM-DB/2_4/GUACUG/2_4-GUACUG.mcs
MCSYM-DB/2_4/GUACUG/ds-2_4-GUACUG_x.pdb.gz
MCSYM-DB/2_4/GUACUU/
MCSYM-DB/2_4/GUACUU/2_4-GUACUU.mcs
MCSYM-DB/2_4/GUACUU/ds-2_4-GUACUU_x.pdb.gz
MCSYM-DB/2_4/GUAGAA/
MCSYM-DB/2_4/GUAGAA/2_4-GUAGAA.mcs
MCSYM-DB/2_4/GUAGAC/
MCSYM-DB/2_4/GUAGAC/2_4-GUAGAC.mcs
MCSYM-DB/2_4/GUAGAC/ds-2_4-GUAGAC_x.pdb.gz
MCSYM-DB/2_4/GUAGAG/
MCSYM-DB/2_4/GUAGAG/2_4-GUAGAG.mcs
MCSYM-DB/2_4/GUAGAG/ds-2_4-GUAGAG_x.pdb.gz
MCSYM-DB/2_4/GUAGAU/
MCSYM-DB/2_4/GUAGAU/2_4-GUAGAU.mcs
MCSYM-DB/2_4/GUAGAU/ds-2_4-GUAGAU_x.pdb.gz
MCSYM-DB/2_4/GUAGCA/
MCSYM-DB/2_4/GUAGCA/2_4-GUAGCA.mcs
MCSYM-DB/2_4/GUAGCA/ds-2_4-GUAGCA_x.pdb.gz
MCSYM-DB/2_4/GUAGCC/
MCSYM-DB/2_4/GUAGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/GUAGCC/2FK6_model_1.pdb.gz
MCSYM-DB/2_4/GUAGCC/2_4-GUAGCC.mcs
MCSYM-DB/2_4/GUAGCC/ds-2_4-GUAGCC_x.pdb.gz
MCSYM-DB/2_4/GUAGCU/
MCSYM-DB/2_4/GUAGCU/2_4-GUAGCU.mcs
MCSYM-DB/2_4/GUAGCU/ds-2_4-GUAGCU_x.pdb.gz
MCSYM-DB/2_4/GUAGGA/
MCSYM-DB/2_4/GUAGGA/2_4-GUAGGA.mcs
MCSYM-DB/2_4/GUAGGA/ds-2_4-GUAGGA_x.pdb.gz
MCSYM-DB/2_4/GUAGGC/
MCSYM-DB/2_4/GUAGGC/2_4-GUAGGC.mcs
MCSYM-DB/2_4/GUAGGC/ds-2_4-GUAGGC_x.pdb.gz
MCSYM-DB/2_4/GUAGGU/
MCSYM-DB/2_4/GUAGGU/2_4-GUAGGU.mcs
MCSYM-DB/2_4/GUAGUA/
MCSYM-DB/2_4/GUAGUA/2_4-GUAGUA.mcs
MCSYM-DB/2_4/GUAGUC/
MCSYM-DB/2_4/GUAGUC/1FG0_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/1IVS_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/1QU2_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/2BTE_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/2CSX_model_1.pdb.gz
MCSYM-DB/2_4/GUAGUC/2_4-GUAGUC.mcs
MCSYM-DB/2_4/GUAGUC/ds-2_4-GUAGUC_x.pdb.gz
MCSYM-DB/2_4/GUAGUG/
MCSYM-DB/2_4/GUAGUG/2_4-GUAGUG.mcs
MCSYM-DB/2_4/GUAGUU/
MCSYM-DB/2_4/GUAGUU/2_4-GUAGUU.mcs
MCSYM-DB/2_4/GUAGUU/ds-2_4-GUAGUU_x.pdb.gz
MCSYM-DB/2_4/GUAUAA/
MCSYM-DB/2_4/GUAUAA/2_4-GUAUAA.mcs
MCSYM-DB/2_4/GUAUAC/
MCSYM-DB/2_4/GUAUAC/2_4-GUAUAC.mcs
MCSYM-DB/2_4/GUAUAC/ds-2_4-GUAUAC_x.pdb.gz
MCSYM-DB/2_4/GUAUAU/
MCSYM-DB/2_4/GUAUAU/2_4-GUAUAU.mcs
MCSYM-DB/2_4/GUAUCA/
MCSYM-DB/2_4/GUAUCA/2_4-GUAUCA.mcs
MCSYM-DB/2_4/GUAUCC/
MCSYM-DB/2_4/GUAUCC/1R3E_model_1.pdb.gz
MCSYM-DB/2_4/GUAUCC/1ZL3_model_1.pdb.gz
MCSYM-DB/2_4/GUAUCC/2_4-GUAUCC.mcs
MCSYM-DB/2_4/GUAUCC/ds-2_4-GUAUCC_x.pdb.gz
MCSYM-DB/2_4/GUAUCU/
MCSYM-DB/2_4/GUAUCU/2_4-GUAUCU.mcs
MCSYM-DB/2_4/GUAUCU/ds-2_4-GUAUCU_x.pdb.gz
MCSYM-DB/2_4/GUAUGA/
MCSYM-DB/2_4/GUAUGA/2_4-GUAUGA.mcs
MCSYM-DB/2_4/GUAUGC/
MCSYM-DB/2_4/GUAUGC/2_4-GUAUGC.mcs
MCSYM-DB/2_4/GUAUGC/ds-2_4-GUAUGC_x.pdb.gz
MCSYM-DB/2_4/GUAUGG/
MCSYM-DB/2_4/GUAUGG/2_4-GUAUGG.mcs
MCSYM-DB/2_4/GUAUGU/
MCSYM-DB/2_4/GUAUGU/2_4-GUAUGU.mcs
MCSYM-DB/2_4/GUAUUA/
MCSYM-DB/2_4/GUAUUA/2_4-GUAUUA.mcs
MCSYM-DB/2_4/GUAUUA/ds-2_4-GUAUUA_x.pdb.gz
MCSYM-DB/2_4/GUAUUC/
MCSYM-DB/2_4/GUAUUC/2_4-GUAUUC.mcs
MCSYM-DB/2_4/GUAUUC/ds-2_4-GUAUUC_x.pdb.gz
MCSYM-DB/2_4/GUAUUG/
MCSYM-DB/2_4/GUAUUG/2_4-GUAUUG.mcs
MCSYM-DB/2_4/GUAUUU/
MCSYM-DB/2_4/GUAUUU/2_4-GUAUUU.mcs
MCSYM-DB/2_4/GUAUUU/ds-2_4-GUAUUU_x.pdb.gz
MCSYM-DB/2_4/GUCAAC/
MCSYM-DB/2_4/GUCAAC/2_4-GUCAAC.mcs
MCSYM-DB/2_4/GUCACA/
MCSYM-DB/2_4/GUCACA/2_4-GUCACA.mcs
MCSYM-DB/2_4/GUCACU/
MCSYM-DB/2_4/GUCACU/2_4-GUCACU.mcs
MCSYM-DB/2_4/GUCAGC/
MCSYM-DB/2_4/GUCAGC/2_4-GUCAGC.mcs
MCSYM-DB/2_4/GUCAUC/
MCSYM-DB/2_4/GUCAUC/2_4-GUCAUC.mcs
MCSYM-DB/2_4/GUCAUU/
MCSYM-DB/2_4/GUCAUU/2_4-GUCAUU.mcs
MCSYM-DB/2_4/GUCCAC/
MCSYM-DB/2_4/GUCCAC/2_4-GUCCAC.mcs
MCSYM-DB/2_4/GUCCAG/
MCSYM-DB/2_4/GUCCAG/2_4-GUCCAG.mcs
MCSYM-DB/2_4/GUCCAG/ds-2_4-GUCCAG_x.pdb.gz
MCSYM-DB/2_4/GUCCCC/
MCSYM-DB/2_4/GUCCCC/2_4-GUCCCC.mcs
MCSYM-DB/2_4/GUCCUC/
MCSYM-DB/2_4/GUCCUC/2_4-GUCCUC.mcs
MCSYM-DB/2_4/GUCCUU/
MCSYM-DB/2_4/GUCCUU/2_4-GUCCUU.mcs
MCSYM-DB/2_4/GUCGCC/
MCSYM-DB/2_4/GUCGCC/2_4-GUCGCC.mcs
MCSYM-DB/2_4/GUCGGC/
MCSYM-DB/2_4/GUCGGC/2_4-GUCGGC.mcs
MCSYM-DB/2_4/GUCGGC/ds-2_4-GUCGGC_x.pdb.gz
MCSYM-DB/2_4/GUCUAC/
MCSYM-DB/2_4/GUCUAC/2_4-GUCUAC.mcs
MCSYM-DB/2_4/GUCUCC/
MCSYM-DB/2_4/GUCUCC/2_4-GUCUCC.mcs
MCSYM-DB/2_4/GUCUGA/
MCSYM-DB/2_4/GUCUGA/2_4-GUCUGA.mcs
MCSYM-DB/2_4/GUCUGC/
MCSYM-DB/2_4/GUCUGC/2_4-GUCUGC.mcs
MCSYM-DB/2_4/GUCUGU/
MCSYM-DB/2_4/GUCUGU/2_4-GUCUGU.mcs
MCSYM-DB/2_4/GUCUUA/
MCSYM-DB/2_4/GUCUUA/2_4-GUCUUA.mcs
MCSYM-DB/2_4/GUCUUC/
MCSYM-DB/2_4/GUCUUC/2_4-GUCUUC.mcs
MCSYM-DB/2_4/GUCUUC/ds-2_4-GUCUUC_x.pdb.gz
MCSYM-DB/2_4/GUCUUU/
MCSYM-DB/2_4/GUCUUU/2_4-GUCUUU.mcs
MCSYM-DB/2_4/GUGAAA/
MCSYM-DB/2_4/GUGAAA/2_4-GUGAAA.mcs
MCSYM-DB/2_4/GUGAAC/
MCSYM-DB/2_4/GUGAAC/2_4-GUGAAC.mcs
MCSYM-DB/2_4/GUGAAG/
MCSYM-DB/2_4/GUGAAG/2_4-GUGAAG.mcs
MCSYM-DB/2_4/GUGAAG/ds-2_4-GUGAAG_x.pdb.gz
MCSYM-DB/2_4/GUGAAU/
MCSYM-DB/2_4/GUGAAU/2_4-GUGAAU.mcs
MCSYM-DB/2_4/GUGACC/
MCSYM-DB/2_4/GUGACC/2_4-GUGACC.mcs
MCSYM-DB/2_4/GUGACC/ds-2_4-GUGACC_x.pdb.gz
MCSYM-DB/2_4/GUGAGC/
MCSYM-DB/2_4/GUGAGC/2_4-GUGAGC.mcs
MCSYM-DB/2_4/GUGAGC/ds-2_4-GUGAGC_x.pdb.gz
MCSYM-DB/2_4/GUGAUC/
MCSYM-DB/2_4/GUGAUC/2_4-GUGAUC.mcs
MCSYM-DB/2_4/GUGAUC/ds-2_4-GUGAUC_x.pdb.gz
MCSYM-DB/2_4/GUGAUU/
MCSYM-DB/2_4/GUGAUU/2_4-GUGAUU.mcs
MCSYM-DB/2_4/GUGAUU/ds-2_4-GUGAUU_x.pdb.gz
MCSYM-DB/2_4/GUGCAC/
MCSYM-DB/2_4/GUGCAC/2_4-GUGCAC.mcs
MCSYM-DB/2_4/GUGCAC/ds-2_4-GUGCAC_x.pdb.gz
MCSYM-DB/2_4/GUGCAG/
MCSYM-DB/2_4/GUGCAG/2_4-GUGCAG.mcs
MCSYM-DB/2_4/GUGCCC/
MCSYM-DB/2_4/GUGCCC/2_4-GUGCCC.mcs
MCSYM-DB/2_4/GUGCCC/ds-2_4-GUGCCC_x.pdb.gz
MCSYM-DB/2_4/GUGCCG/
MCSYM-DB/2_4/GUGCCG/2_4-GUGCCG.mcs
MCSYM-DB/2_4/GUGCCG/ds-2_4-GUGCCG_x.pdb.gz
MCSYM-DB/2_4/GUGCUA/
MCSYM-DB/2_4/GUGCUA/2_4-GUGCUA.mcs
MCSYM-DB/2_4/GUGCUC/
MCSYM-DB/2_4/GUGCUC/2_4-GUGCUC.mcs
MCSYM-DB/2_4/GUGCUC/ds-2_4-GUGCUC_x.pdb.gz
MCSYM-DB/2_4/GUGCUG/
MCSYM-DB/2_4/GUGCUG/2_4-GUGCUG.mcs
MCSYM-DB/2_4/GUGCUG/ds-2_4-GUGCUG_x.pdb.gz
MCSYM-DB/2_4/GUGCUU/
MCSYM-DB/2_4/GUGCUU/2_4-GUGCUU.mcs
MCSYM-DB/2_4/GUGGAA/
MCSYM-DB/2_4/GUGGAA/2_4-GUGGAA.mcs
MCSYM-DB/2_4/GUGGAA/ds-2_4-GUGGAA_x.pdb.gz
MCSYM-DB/2_4/GUGGCA/
MCSYM-DB/2_4/GUGGCA/2_4-GUGGCA.mcs
MCSYM-DB/2_4/GUGGCC/
MCSYM-DB/2_4/GUGGCC/2_4-GUGGCC.mcs
MCSYM-DB/2_4/GUGGCC/ds-2_4-GUGGCC_x.pdb.gz
MCSYM-DB/2_4/GUGGGC/
MCSYM-DB/2_4/GUGGGC/2_4-GUGGGC.mcs
MCSYM-DB/2_4/GUGGGC/ds-2_4-GUGGGC_x.pdb.gz
MCSYM-DB/2_4/GUGGGG/
MCSYM-DB/2_4/GUGGGG/2_4-GUGGGG.mcs
MCSYM-DB/2_4/GUGGGG/ds-2_4-GUGGGG_x.pdb.gz
MCSYM-DB/2_4/GUGGGU/
MCSYM-DB/2_4/GUGGGU/2_4-GUGGGU.mcs
MCSYM-DB/2_4/GUGGGU/ds-2_4-GUGGGU_x.pdb.gz
MCSYM-DB/2_4/GUGGUC/
MCSYM-DB/2_4/GUGGUC/2_4-GUGGUC.mcs
MCSYM-DB/2_4/GUGGUC/ds-2_4-GUGGUC_x.pdb.gz
MCSYM-DB/2_4/GUGGUU/
MCSYM-DB/2_4/GUGGUU/2_4-GUGGUU.mcs
MCSYM-DB/2_4/GUGGUU/ds-2_4-GUGGUU_x.pdb.gz
MCSYM-DB/2_4/GUGUAC/
MCSYM-DB/2_4/GUGUAC/2_4-GUGUAC.mcs
MCSYM-DB/2_4/GUGUAU/
MCSYM-DB/2_4/GUGUAU/2_4-GUGUAU.mcs
MCSYM-DB/2_4/GUGUCC/
MCSYM-DB/2_4/GUGUCC/2_4-GUGUCC.mcs
MCSYM-DB/2_4/GUGUCC/ds-2_4-GUGUCC_x.pdb.gz
MCSYM-DB/2_4/GUGUGA/
MCSYM-DB/2_4/GUGUGA/2_4-GUGUGA.mcs
MCSYM-DB/2_4/GUGUGC/
MCSYM-DB/2_4/GUGUGC/2_4-GUGUGC.mcs
MCSYM-DB/2_4/GUGUGC/ds-2_4-GUGUGC_x.pdb.gz
MCSYM-DB/2_4/GUGUGG/
MCSYM-DB/2_4/GUGUGG/2_4-GUGUGG.mcs
MCSYM-DB/2_4/GUGUGU/
MCSYM-DB/2_4/GUGUGU/2_4-GUGUGU.mcs
MCSYM-DB/2_4/GUGUGU/ds-2_4-GUGUGU_x.pdb.gz
MCSYM-DB/2_4/GUGUUA/
MCSYM-DB/2_4/GUGUUA/2_4-GUGUUA.mcs
MCSYM-DB/2_4/GUGUUC/
MCSYM-DB/2_4/GUGUUC/2_4-GUGUUC.mcs
MCSYM-DB/2_4/GUGUUC/ds-2_4-GUGUUC_x.pdb.gz
MCSYM-DB/2_4/GUGUUU/
MCSYM-DB/2_4/GUGUUU/2_4-GUGUUU.mcs
MCSYM-DB/2_4/GUGUUU/ds-2_4-GUGUUU_x.pdb.gz
MCSYM-DB/2_4/GUUAAC/
MCSYM-DB/2_4/GUUAAC/2_4-GUUAAC.mcs
MCSYM-DB/2_4/GUUAAU/
MCSYM-DB/2_4/GUUAAU/2_4-GUUAAU.mcs
MCSYM-DB/2_4/GUUACC/
MCSYM-DB/2_4/GUUACC/2_4-GUUACC.mcs
MCSYM-DB/2_4/GUUACC/ds-2_4-GUUACC_x.pdb.gz
MCSYM-DB/2_4/GUUACU/
MCSYM-DB/2_4/GUUACU/2_4-GUUACU.mcs
MCSYM-DB/2_4/GUUAGA/
MCSYM-DB/2_4/GUUAGA/2_4-GUUAGA.mcs
MCSYM-DB/2_4/GUUAGC/
MCSYM-DB/2_4/GUUAGC/2_4-GUUAGC.mcs
MCSYM-DB/2_4/GUUAGC/ds-2_4-GUUAGC_x.pdb.gz
MCSYM-DB/2_4/GUUAGU/
MCSYM-DB/2_4/GUUAGU/2_4-GUUAGU.mcs
MCSYM-DB/2_4/GUUAUC/
MCSYM-DB/2_4/GUUAUC/2_4-GUUAUC.mcs
MCSYM-DB/2_4/GUUAUC/ds-2_4-GUUAUC_x.pdb.gz
MCSYM-DB/2_4/GUUAUU/
MCSYM-DB/2_4/GUUAUU/2_4-GUUAUU.mcs
MCSYM-DB/2_4/GUUAUU/ds-2_4-GUUAUU_x.pdb.gz
MCSYM-DB/2_4/GUUCAC/
MCSYM-DB/2_4/GUUCAC/2_4-GUUCAC.mcs
MCSYM-DB/2_4/GUUCAU/
MCSYM-DB/2_4/GUUCAU/2_4-GUUCAU.mcs
MCSYM-DB/2_4/GUUCCC/
MCSYM-DB/2_4/GUUCCC/2_4-GUUCCC.mcs
MCSYM-DB/2_4/GUUCCC/ds-2_4-GUUCCC_x.pdb.gz
MCSYM-DB/2_4/GUUCCU/
MCSYM-DB/2_4/GUUCCU/2_4-GUUCCU.mcs
MCSYM-DB/2_4/GUUCGG/
MCSYM-DB/2_4/GUUCGG/2_4-GUUCGG.mcs
MCSYM-DB/2_4/GUUCGG/ds-2_4-GUUCGG_x.pdb.gz
MCSYM-DB/2_4/GUUCUC/
MCSYM-DB/2_4/GUUCUC/2_4-GUUCUC.mcs
MCSYM-DB/2_4/GUUCUC/ds-2_4-GUUCUC_x.pdb.gz
MCSYM-DB/2_4/GUUGAC/
MCSYM-DB/2_4/GUUGAC/2_4-GUUGAC.mcs
MCSYM-DB/2_4/GUUGAG/
MCSYM-DB/2_4/GUUGAG/2_4-GUUGAG.mcs
MCSYM-DB/2_4/GUUGCC/
MCSYM-DB/2_4/GUUGCC/2_4-GUUGCC.mcs
MCSYM-DB/2_4/GUUGCC/ds-2_4-GUUGCC_x.pdb.gz
MCSYM-DB/2_4/GUUGCU/
MCSYM-DB/2_4/GUUGCU/2_4-GUUGCU.mcs
MCSYM-DB/2_4/GUUGCU/ds-2_4-GUUGCU_x.pdb.gz
MCSYM-DB/2_4/GUUGGA/
MCSYM-DB/2_4/GUUGGA/2_4-GUUGGA.mcs
MCSYM-DB/2_4/GUUGGA/ds-2_4-GUUGGA_x.pdb.gz
MCSYM-DB/2_4/GUUGGC/
MCSYM-DB/2_4/GUUGGC/2_4-GUUGGC.mcs
MCSYM-DB/2_4/GUUGGU/
MCSYM-DB/2_4/GUUGGU/2_4-GUUGGU.mcs
MCSYM-DB/2_4/GUUGUA/
MCSYM-DB/2_4/GUUGUA/2_4-GUUGUA.mcs
MCSYM-DB/2_4/GUUGUA/ds-2_4-GUUGUA_x.pdb.gz
MCSYM-DB/2_4/GUUGUC/
MCSYM-DB/2_4/GUUGUC/2_4-GUUGUC.mcs
MCSYM-DB/2_4/GUUGUC/ds-2_4-GUUGUC_x.pdb.gz
MCSYM-DB/2_4/GUUGUG/
MCSYM-DB/2_4/GUUGUG/2_4-GUUGUG.mcs
MCSYM-DB/2_4/GUUGUU/
MCSYM-DB/2_4/GUUGUU/2_4-GUUGUU.mcs
MCSYM-DB/2_4/GUUGUU/ds-2_4-GUUGUU_x.pdb.gz
MCSYM-DB/2_4/GUUUAC/
MCSYM-DB/2_4/GUUUAC/2_4-GUUUAC.mcs
MCSYM-DB/2_4/GUUUAU/
MCSYM-DB/2_4/GUUUAU/2_4-GUUUAU.mcs
MCSYM-DB/2_4/GUUUCC/
MCSYM-DB/2_4/GUUUCC/2_4-GUUUCC.mcs
MCSYM-DB/2_4/GUUUCC/ds-2_4-GUUUCC_x.pdb.gz
MCSYM-DB/2_4/GUUUCU/
MCSYM-DB/2_4/GUUUCU/2_4-GUUUCU.mcs
MCSYM-DB/2_4/GUUUGA/
MCSYM-DB/2_4/GUUUGA/2_4-GUUUGA.mcs
MCSYM-DB/2_4/GUUUGC/
MCSYM-DB/2_4/GUUUGC/2_4-GUUUGC.mcs
MCSYM-DB/2_4/GUUUGC/ds-2_4-GUUUGC_x.pdb.gz
MCSYM-DB/2_4/GUUUUC/
MCSYM-DB/2_4/GUUUUC/2_4-GUUUUC.mcs
MCSYM-DB/2_4/GUUUUC/ds-2_4-GUUUUC_x.pdb.gz
MCSYM-DB/2_4/UAAAAA/
MCSYM-DB/2_4/UAAAAA/2_4-UAAAAA.mcs
MCSYM-DB/2_4/UAAAAA/ds-2_4-UAAAAA_x.pdb.gz
MCSYM-DB/2_4/UAAACA/
MCSYM-DB/2_4/UAAACA/2_4-UAAACA.mcs
MCSYM-DB/2_4/UAAACA/ds-2_4-UAAACA_x.pdb.gz
MCSYM-DB/2_4/UAAAGA/
MCSYM-DB/2_4/UAAAGA/2_4-UAAAGA.mcs
MCSYM-DB/2_4/UAAAGU/
MCSYM-DB/2_4/UAAAGU/2_4-UAAAGU.mcs
MCSYM-DB/2_4/UAACAA/
MCSYM-DB/2_4/UAACAA/2_4-UAACAA.mcs
MCSYM-DB/2_4/UAACAA/ds-2_4-UAACAA_x.pdb.gz
MCSYM-DB/2_4/UAACAG/
MCSYM-DB/2_4/UAACAG/2_4-UAACAG.mcs
MCSYM-DB/2_4/UAACCA/
MCSYM-DB/2_4/UAACCA/2_4-UAACCA.mcs
MCSYM-DB/2_4/UAACGG/
MCSYM-DB/2_4/UAACGG/2_4-UAACGG.mcs
MCSYM-DB/2_4/UAACGG/ds-2_4-UAACGG_x.pdb.gz
MCSYM-DB/2_4/UAACUA/
MCSYM-DB/2_4/UAACUA/2_4-UAACUA.mcs
MCSYM-DB/2_4/UAACUA/ds-2_4-UAACUA_x.pdb.gz
MCSYM-DB/2_4/UAACUU/
MCSYM-DB/2_4/UAACUU/2_4-UAACUU.mcs
MCSYM-DB/2_4/UAAGAG/
MCSYM-DB/2_4/UAAGAG/2_4-UAAGAG.mcs
MCSYM-DB/2_4/UAAGCU/
MCSYM-DB/2_4/UAAGCU/2_4-UAAGCU.mcs
MCSYM-DB/2_4/UAAGGG/
MCSYM-DB/2_4/UAAGGG/2_4-UAAGGG.mcs
MCSYM-DB/2_4/UAAGUA/
MCSYM-DB/2_4/UAAGUA/2_4-UAAGUA.mcs
MCSYM-DB/2_4/UAAUAA/
MCSYM-DB/2_4/UAAUAA/2_4-UAAUAA.mcs
MCSYM-DB/2_4/UAAUAA/ds-2_4-UAAUAA_x.pdb.gz
MCSYM-DB/2_4/UAAUAC/
MCSYM-DB/2_4/UAAUAC/2_4-UAAUAC.mcs
MCSYM-DB/2_4/UAAUCA/
MCSYM-DB/2_4/UAAUCA/2_4-UAAUCA.mcs
MCSYM-DB/2_4/UAAUCA/ds-2_4-UAAUCA_x.pdb.gz
MCSYM-DB/2_4/UAAUCU/
MCSYM-DB/2_4/UAAUCU/2_4-UAAUCU.mcs
MCSYM-DB/2_4/UAAUCU/ds-2_4-UAAUCU_x.pdb.gz
MCSYM-DB/2_4/UAAUGG/
MCSYM-DB/2_4/UAAUGG/2_4-UAAUGG.mcs
MCSYM-DB/2_4/UAAUUA/
MCSYM-DB/2_4/UAAUUA/2_4-UAAUUA.mcs
MCSYM-DB/2_4/UACAAA/
MCSYM-DB/2_4/UACAAA/2_4-UACAAA.mcs
MCSYM-DB/2_4/UACACA/
MCSYM-DB/2_4/UACACA/2_4-UACACA.mcs
MCSYM-DB/2_4/UACACA/ds-2_4-UACACA_x.pdb.gz
MCSYM-DB/2_4/UACAGA/
MCSYM-DB/2_4/UACAGA/2_4-UACAGA.mcs
MCSYM-DB/2_4/UACAGU/
MCSYM-DB/2_4/UACAGU/2_4-UACAGU.mcs
MCSYM-DB/2_4/UACAGU/ds-2_4-UACAGU_x.pdb.gz
MCSYM-DB/2_4/UACCAA/
MCSYM-DB/2_4/UACCAA/2_4-UACCAA.mcs
MCSYM-DB/2_4/UACCAC/
MCSYM-DB/2_4/UACCAC/2_4-UACCAC.mcs
MCSYM-DB/2_4/UACCCA/
MCSYM-DB/2_4/UACCCA/2_4-UACCCA.mcs
MCSYM-DB/2_4/UACCCA/ds-2_4-UACCCA_x.pdb.gz
MCSYM-DB/2_4/UACGAA/
MCSYM-DB/2_4/UACGAA/2_4-UACGAA.mcs
MCSYM-DB/2_4/UACGGA/
MCSYM-DB/2_4/UACGGA/2_4-UACGGA.mcs
MCSYM-DB/2_4/UACGUA/
MCSYM-DB/2_4/UACGUA/2_4-UACGUA.mcs
MCSYM-DB/2_4/UACGUA/ds-2_4-UACGUA_x.pdb.gz
MCSYM-DB/2_4/UACUAA/
MCSYM-DB/2_4/UACUAA/2_4-UACUAA.mcs
MCSYM-DB/2_4/UACUCA/
MCSYM-DB/2_4/UACUCA/2_4-UACUCA.mcs
MCSYM-DB/2_4/UACUGA/
MCSYM-DB/2_4/UACUGA/2_4-UACUGA.mcs
MCSYM-DB/2_4/UACUUU/
MCSYM-DB/2_4/UACUUU/2_4-UACUUU.mcs
MCSYM-DB/2_4/UAGAAA/
MCSYM-DB/2_4/UAGAAA/2_4-UAGAAA.mcs
MCSYM-DB/2_4/UAGACA/
MCSYM-DB/2_4/UAGACA/2_4-UAGACA.mcs
MCSYM-DB/2_4/UAGACA/ds-2_4-UAGACA_x.pdb.gz
MCSYM-DB/2_4/UAGACC/
MCSYM-DB/2_4/UAGACC/2_4-UAGACC.mcs
MCSYM-DB/2_4/UAGACC/ds-2_4-UAGACC_x.pdb.gz
MCSYM-DB/2_4/UAGAGA/
MCSYM-DB/2_4/UAGAGA/2_4-UAGAGA.mcs
MCSYM-DB/2_4/UAGAUC/
MCSYM-DB/2_4/UAGAUC/2_4-UAGAUC.mcs
MCSYM-DB/2_4/UAGAUG/
MCSYM-DB/2_4/UAGAUG/2_4-UAGAUG.mcs
MCSYM-DB/2_4/UAGCUA/
MCSYM-DB/2_4/UAGCUA/2_4-UAGCUA.mcs
MCSYM-DB/2_4/UAGCUC/
MCSYM-DB/2_4/UAGCUC/2_4-UAGCUC.mcs
MCSYM-DB/2_4/UAGGCA/
MCSYM-DB/2_4/UAGGCA/2_4-UAGGCA.mcs
MCSYM-DB/2_4/UAGGCA/ds-2_4-UAGGCA_x.pdb.gz
MCSYM-DB/2_4/UAGGGA/
MCSYM-DB/2_4/UAGGGA/2_4-UAGGGA.mcs
MCSYM-DB/2_4/UAGGGA/ds-2_4-UAGGGA_x.pdb.gz
MCSYM-DB/2_4/UAGGGC/
MCSYM-DB/2_4/UAGGGC/2_4-UAGGGC.mcs
MCSYM-DB/2_4/UAGGGU/
MCSYM-DB/2_4/UAGGGU/2_4-UAGGGU.mcs
MCSYM-DB/2_4/UAGGUG/
MCSYM-DB/2_4/UAGGUG/2_4-UAGGUG.mcs
MCSYM-DB/2_4/UAGUAA/
MCSYM-DB/2_4/UAGUAA/2_4-UAGUAA.mcs
MCSYM-DB/2_4/UAGUAG/
MCSYM-DB/2_4/UAGUAG/2_4-UAGUAG.mcs
MCSYM-DB/2_4/UAGUCA/
MCSYM-DB/2_4/UAGUCA/2_4-UAGUCA.mcs
MCSYM-DB/2_4/UAGUCU/
MCSYM-DB/2_4/UAGUCU/2_4-UAGUCU.mcs
MCSYM-DB/2_4/UAGUGG/
MCSYM-DB/2_4/UAGUGG/2_4-UAGUGG.mcs
MCSYM-DB/2_4/UAGUUA/
MCSYM-DB/2_4/UAGUUA/2_4-UAGUUA.mcs
MCSYM-DB/2_4/UAGUUU/
MCSYM-DB/2_4/UAGUUU/2_4-UAGUUU.mcs
MCSYM-DB/2_4/UAUAAA/
MCSYM-DB/2_4/UAUAAA/2_4-UAUAAA.mcs
MCSYM-DB/2_4/UAUAAA/ds-2_4-UAUAAA_x.pdb
MCSYM-DB/2_4/UAUAAA/ds-2_4-UAUAAA_x.pdb.gz
MCSYM-DB/2_4/UAUAAG/
MCSYM-DB/2_4/UAUAAG/2_4-UAUAAG.mcs
MCSYM-DB/2_4/UAUAAG/ds-2_4-UAUAAG.pdb.gz
MCSYM-DB/2_4/UAUAAG/ds-2_4-UAUAAG_x.pdb.gz
MCSYM-DB/2_4/UAUAAU/
MCSYM-DB/2_4/UAUAAU/2_4-UAUAAU.mcs
MCSYM-DB/2_4/UAUACA/
MCSYM-DB/2_4/UAUACA/2_4-UAUACA.mcs
MCSYM-DB/2_4/UAUACA/ds-2_4-UAUACA_x.pdb.gz
MCSYM-DB/2_4/UAUACC/
MCSYM-DB/2_4/UAUACC/2_4-UAUACC.mcs
MCSYM-DB/2_4/UAUACG/
MCSYM-DB/2_4/UAUACG/2_4-UAUACG.mcs
MCSYM-DB/2_4/UAUACG/ds-2_4-UAUACG_x.pdb.gz
MCSYM-DB/2_4/UAUAGA/
MCSYM-DB/2_4/UAUAGA/2_4-UAUAGA.mcs
MCSYM-DB/2_4/UAUAGA/ds-2_4-UAUAGA_x.pdb.gz
MCSYM-DB/2_4/UAUAGG/
MCSYM-DB/2_4/UAUAGG/2_4-UAUAGG.mcs
MCSYM-DB/2_4/UAUAGU/
MCSYM-DB/2_4/UAUAGU/2_4-UAUAGU.mcs
MCSYM-DB/2_4/UAUAUA/
MCSYM-DB/2_4/UAUAUA/2_4-UAUAUA.mcs
MCSYM-DB/2_4/UAUAUA/ds-2_4-UAUAUA_x.pdb.gz
MCSYM-DB/2_4/UAUAUC/
MCSYM-DB/2_4/UAUAUC/2_4-UAUAUC.mcs
MCSYM-DB/2_4/UAUAUG/
MCSYM-DB/2_4/UAUAUG/2_4-UAUAUG.mcs
MCSYM-DB/2_4/UAUCAA/
MCSYM-DB/2_4/UAUCAA/2_4-UAUCAA.mcs
MCSYM-DB/2_4/UAUCAA/ds-2_4-UAUCAA_x.pdb.gz
MCSYM-DB/2_4/UAUCAG/
MCSYM-DB/2_4/UAUCAG/2_4-UAUCAG.mcs
MCSYM-DB/2_4/UAUCAG/ds-2_4-UAUCAG_x.pdb.gz
MCSYM-DB/2_4/UAUCAU/
MCSYM-DB/2_4/UAUCAU/2_4-UAUCAU.mcs
MCSYM-DB/2_4/UAUCAU/ds-2_4-UAUCAU_x.pdb.gz
MCSYM-DB/2_4/UAUCCA/
MCSYM-DB/2_4/UAUCCA/2_4-UAUCCA.mcs
MCSYM-DB/2_4/UAUCCA/ds-2_4-UAUCCA_x.pdb.gz
MCSYM-DB/2_4/UAUCCC/
MCSYM-DB/2_4/UAUCCC/2_4-UAUCCC.mcs
MCSYM-DB/2_4/UAUCCC/ds-2_4-UAUCCC_x.pdb.gz
MCSYM-DB/2_4/UAUCCG/
MCSYM-DB/2_4/UAUCCG/2_4-UAUCCG.mcs
MCSYM-DB/2_4/UAUCCG/ds-2_4-UAUCCG_x.pdb.gz
MCSYM-DB/2_4/UAUCCU/
MCSYM-DB/2_4/UAUCCU/2_4-UAUCCU.mcs
MCSYM-DB/2_4/UAUCCU/ds-2_4-UAUCCU_x.pdb.gz
MCSYM-DB/2_4/UAUCGA/
MCSYM-DB/2_4/UAUCGA/2_4-UAUCGA.mcs
MCSYM-DB/2_4/UAUCGA/ds-2_4-UAUCGA_x.pdb.gz
MCSYM-DB/2_4/UAUCGU/
MCSYM-DB/2_4/UAUCGU/2_4-UAUCGU.mcs
MCSYM-DB/2_4/UAUCUA/
MCSYM-DB/2_4/UAUCUA/2_4-UAUCUA.mcs
MCSYM-DB/2_4/UAUCUA/ds-2_4-UAUCUA_x.pdb.gz
MCSYM-DB/2_4/UAUCUG/
MCSYM-DB/2_4/UAUCUG/2_4-UAUCUG.mcs
MCSYM-DB/2_4/UAUCUG/ds-2_4-UAUCUG_x.pdb.gz
MCSYM-DB/2_4/UAUGAA/
MCSYM-DB/2_4/UAUGAA/2_4-UAUGAA.mcs
MCSYM-DB/2_4/UAUGAA/ds-2_4-UAUGAA_x.pdb.gz
MCSYM-DB/2_4/UAUGAC/
MCSYM-DB/2_4/UAUGAC/2_4-UAUGAC.mcs
MCSYM-DB/2_4/UAUGAG/
MCSYM-DB/2_4/UAUGAG/2_4-UAUGAG.mcs
MCSYM-DB/2_4/UAUGAG/ds-2_4-UAUGAG_x.pdb.gz
MCSYM-DB/2_4/UAUGAU/
MCSYM-DB/2_4/UAUGAU/2_4-UAUGAU.mcs
MCSYM-DB/2_4/UAUGCA/
MCSYM-DB/2_4/UAUGCA/2_4-UAUGCA.mcs
MCSYM-DB/2_4/UAUGCA/ds-2_4-UAUGCA_x.pdb.gz
MCSYM-DB/2_4/UAUGCU/
MCSYM-DB/2_4/UAUGCU/2_4-UAUGCU.mcs
MCSYM-DB/2_4/UAUGGA/
MCSYM-DB/2_4/UAUGGA/2_4-UAUGGA.mcs
MCSYM-DB/2_4/UAUGGA/ds-2_4-UAUGGA_x.pdb.gz
MCSYM-DB/2_4/UAUGGG/
MCSYM-DB/2_4/UAUGGG/2_4-UAUGGG.mcs
MCSYM-DB/2_4/UAUGGG/ds-2_4-UAUGGG_x.pdb.gz
MCSYM-DB/2_4/UAUGGU/
MCSYM-DB/2_4/UAUGGU/2_4-UAUGGU.mcs
MCSYM-DB/2_4/UAUGUA/
MCSYM-DB/2_4/UAUGUA/2_4-UAUGUA.mcs
MCSYM-DB/2_4/UAUGUA/ds-2_4-UAUGUA_x.pdb.gz
MCSYM-DB/2_4/UAUGUC/
MCSYM-DB/2_4/UAUGUC/2_4-UAUGUC.mcs
MCSYM-DB/2_4/UAUGUG/
MCSYM-DB/2_4/UAUGUG/ds-2_4-UAUGUG.pdb.gz
MCSYM-DB/2_4/UAUGUU/
MCSYM-DB/2_4/UAUGUU/2_4-UAUGUU.mcs
MCSYM-DB/2_4/UAUUAA/
MCSYM-DB/2_4/UAUUAA/2_4-UAUUAA.mcs
MCSYM-DB/2_4/UAUUAA/ds-2_4-UAUUAA_x.pdb.gz
MCSYM-DB/2_4/UAUUAG/
MCSYM-DB/2_4/UAUUAG/2_4-UAUUAG.mcs
MCSYM-DB/2_4/UAUUCA/
MCSYM-DB/2_4/UAUUCA/2_4-UAUUCA.mcs
MCSYM-DB/2_4/UAUUCA/ds-2_4-UAUUCA_x.pdb.gz
MCSYM-DB/2_4/UAUUCC/
MCSYM-DB/2_4/UAUUCC/2_4-UAUUCC.mcs
MCSYM-DB/2_4/UAUUCG/
MCSYM-DB/2_4/UAUUCG/2_4-UAUUCG.mcs
MCSYM-DB/2_4/UAUUCG/ds-2_4-UAUUCG_x.pdb.gz
MCSYM-DB/2_4/UAUUCU/
MCSYM-DB/2_4/UAUUCU/2_4-UAUUCU.mcs
MCSYM-DB/2_4/UAUUGA/
MCSYM-DB/2_4/UAUUGA/2_4-UAUUGA.mcs
MCSYM-DB/2_4/UAUUGA/ds-2_4-UAUUGA_x.pdb.gz
MCSYM-DB/2_4/UAUUGG/
MCSYM-DB/2_4/UAUUGG/2_4-UAUUGG.mcs
MCSYM-DB/2_4/UAUUUA/
MCSYM-DB/2_4/UAUUUA/2_4-UAUUUA.mcs
MCSYM-DB/2_4/UAUUUA/ds-2_4-UAUUUA_x.pdb.gz
MCSYM-DB/2_4/UAUUUC/
MCSYM-DB/2_4/UAUUUC/2_4-UAUUUC.mcs
MCSYM-DB/2_4/UAUUUC/ds-2_4-UAUUUC_x.pdb.gz
MCSYM-DB/2_4/UAUUUG/
MCSYM-DB/2_4/UAUUUG/2_4-UAUUUG.mcs
MCSYM-DB/2_4/UAUUUG/ds-2_4-UAUUUG_x.pdb.gz
MCSYM-DB/2_4/UAUUUU/
MCSYM-DB/2_4/UAUUUU/2_4-UAUUUU.mcs
MCSYM-DB/2_4/UAUUUU/ds-2_4-UAUUUU_x.pdb.gz
MCSYM-DB/2_4/UCAAAA/
MCSYM-DB/2_4/UCAAAA/2_4-UCAAAA.mcs
MCSYM-DB/2_4/UCAAAC/
MCSYM-DB/2_4/UCAAAC/2_4-UCAAAC.mcs
MCSYM-DB/2_4/UCAAAU/
MCSYM-DB/2_4/UCAAAU/2_4-UCAAAU.mcs
MCSYM-DB/2_4/UCAACA/
MCSYM-DB/2_4/UCAACA/2_4-UCAACA.mcs
MCSYM-DB/2_4/UCAACU/
MCSYM-DB/2_4/UCAACU/2_4-UCAACU.mcs
MCSYM-DB/2_4/UCAAGG/
MCSYM-DB/2_4/UCAAGG/2_4-UCAAGG.mcs
MCSYM-DB/2_4/UCAAGG/ds-2_4-UCAAGG_x.pdb.gz
MCSYM-DB/2_4/UCAAUA/
MCSYM-DB/2_4/UCAAUA/2_4-UCAAUA.mcs
MCSYM-DB/2_4/UCAAUA/ds-2_4-UCAAUA_x.pdb.gz
MCSYM-DB/2_4/UCACAA/
MCSYM-DB/2_4/UCACAA/2_4-UCACAA.mcs
MCSYM-DB/2_4/UCACAG/
MCSYM-DB/2_4/UCACAG/2_4-UCACAG.mcs
MCSYM-DB/2_4/UCACAG/ds-2_4-UCACAG_x.pdb.gz
MCSYM-DB/2_4/UCACAU/
MCSYM-DB/2_4/UCACAU/2_4-UCACAU.mcs
MCSYM-DB/2_4/UCACCC/
MCSYM-DB/2_4/UCACCC/2_4-UCACCC.mcs
MCSYM-DB/2_4/UCACGA/
MCSYM-DB/2_4/UCACGA/2_4-UCACGA.mcs
MCSYM-DB/2_4/UCACUA/
MCSYM-DB/2_4/UCACUA/2_4-UCACUA.mcs
MCSYM-DB/2_4/UCACUA/ds-2_4-UCACUA_x.pdb.gz
MCSYM-DB/2_4/UCACUC/
MCSYM-DB/2_4/UCACUC/2_4-UCACUC.mcs
MCSYM-DB/2_4/UCACUG/
MCSYM-DB/2_4/UCACUG/2_4-UCACUG.mcs
MCSYM-DB/2_4/UCAGAA/
MCSYM-DB/2_4/UCAGAA/2_4-UCAGAA.mcs
MCSYM-DB/2_4/UCAGAA/ds-2_4-UCAGAA_x.pdb.gz
MCSYM-DB/2_4/UCAGGA/
MCSYM-DB/2_4/UCAGGA/2_4-UCAGGA.mcs
MCSYM-DB/2_4/UCAGGA/ds-2_4-UCAGGA_x.pdb.gz
MCSYM-DB/2_4/UCAUAA/
MCSYM-DB/2_4/UCAUAA/2_4-UCAUAA.mcs
MCSYM-DB/2_4/UCAUAA/ds-2_4-UCAUAA_x.pdb.gz
MCSYM-DB/2_4/UCAUAU/
MCSYM-DB/2_4/UCAUAU/2_4-UCAUAU.mcs
MCSYM-DB/2_4/UCAUCA/
MCSYM-DB/2_4/UCAUCA/2_4-UCAUCA.mcs
MCSYM-DB/2_4/UCAUCC/
MCSYM-DB/2_4/UCAUCC/2_4-UCAUCC.mcs
MCSYM-DB/2_4/UCAUCU/
MCSYM-DB/2_4/UCAUCU/2_4-UCAUCU.mcs
MCSYM-DB/2_4/UCAUGA/
MCSYM-DB/2_4/UCAUGA/2_4-UCAUGA.mcs
MCSYM-DB/2_4/UCAUGU/
MCSYM-DB/2_4/UCAUGU/2_4-UCAUGU.mcs
MCSYM-DB/2_4/UCAUUA/
MCSYM-DB/2_4/UCAUUA/2_4-UCAUUA.mcs
MCSYM-DB/2_4/UCCAAA/
MCSYM-DB/2_4/UCCAAA/2_4-UCCAAA.mcs
MCSYM-DB/2_4/UCCAAG/
MCSYM-DB/2_4/UCCAAG/2_4-UCCAAG.mcs
MCSYM-DB/2_4/UCCACA/
MCSYM-DB/2_4/UCCACA/2_4-UCCACA.mcs
MCSYM-DB/2_4/UCCACC/
MCSYM-DB/2_4/UCCACC/2_4-UCCACC.mcs
MCSYM-DB/2_4/UCCACG/
MCSYM-DB/2_4/UCCACG/2_4-UCCACG.mcs
MCSYM-DB/2_4/UCCACU/
MCSYM-DB/2_4/UCCACU/2_4-UCCACU.mcs
MCSYM-DB/2_4/UCCAUA/
MCSYM-DB/2_4/UCCAUA/2_4-UCCAUA.mcs
MCSYM-DB/2_4/UCCAUA/ds-2_4-UCCAUA_x.pdb.gz
MCSYM-DB/2_4/UCCCAC/
MCSYM-DB/2_4/UCCCAC/2_4-UCCCAC.mcs
MCSYM-DB/2_4/UCCCAC/ds-2_4-UCCCAC_x.pdb.gz
MCSYM-DB/2_4/UCCCCA/
MCSYM-DB/2_4/UCCCCA/2_4-UCCCCA.mcs
MCSYM-DB/2_4/UCCCCA/ds-2_4-UCCCCA_x.pdb.gz
MCSYM-DB/2_4/UCCCCC/
MCSYM-DB/2_4/UCCCCC/2_4-UCCCCC.mcs
MCSYM-DB/2_4/UCCCCC/ds-2_4-UCCCCC_x.pdb.gz
MCSYM-DB/2_4/UCCCCG/
MCSYM-DB/2_4/UCCCCG/2_4-UCCCCG.mcs
MCSYM-DB/2_4/UCCCCG/ds-2_4-UCCCCG_x.pdb.gz
MCSYM-DB/2_4/UCCCUC/
MCSYM-DB/2_4/UCCCUC/2_4-UCCCUC.mcs
MCSYM-DB/2_4/UCCGAG/
MCSYM-DB/2_4/UCCGAG/2_4-UCCGAG.mcs
MCSYM-DB/2_4/UCCGAG/ds-2_4-UCCGAG_x.pdb.gz
MCSYM-DB/2_4/UCCUAA/
MCSYM-DB/2_4/UCCUAA/2_4-UCCUAA.mcs
MCSYM-DB/2_4/UCCUAA/ds-2_4-UCCUAA_x.pdb.gz
MCSYM-DB/2_4/UCCUAG/
MCSYM-DB/2_4/UCCUAG/2_4-UCCUAG.mcs
MCSYM-DB/2_4/UCCUAG/ds-2_4-UCCUAG_x.pdb.gz
MCSYM-DB/2_4/UCCUCA/
MCSYM-DB/2_4/UCCUCA/2_4-UCCUCA.mcs
MCSYM-DB/2_4/UCCUCA/ds-2_4-UCCUCA_x.pdb.gz
MCSYM-DB/2_4/UCCUCU/
MCSYM-DB/2_4/UCCUCU/2_4-UCCUCU.mcs
MCSYM-DB/2_4/UCCUCU/ds-2_4-UCCUCU_x.pdb.gz
MCSYM-DB/2_4/UCCUGA/
MCSYM-DB/2_4/UCCUGA/2_4-UCCUGA.mcs
MCSYM-DB/2_4/UCCUUC/
MCSYM-DB/2_4/UCCUUC/2_4-UCCUUC.mcs
MCSYM-DB/2_4/UCCUUC/ds-2_4-UCCUUC_x.pdb.gz
MCSYM-DB/2_4/UCCUUG/
MCSYM-DB/2_4/UCCUUG/2_4-UCCUUG.mcs
MCSYM-DB/2_4/UCCUUG/ds-2_4-UCCUUG_x.pdb.gz
MCSYM-DB/2_4/UCGAAA/
MCSYM-DB/2_4/UCGAAA/2_4-UCGAAA.mcs
MCSYM-DB/2_4/UCGAAA/ds-2_4-UCGAAA_x.pdb.gz
MCSYM-DB/2_4/UCGAAG/
MCSYM-DB/2_4/UCGAAG/2_4-UCGAAG.mcs
MCSYM-DB/2_4/UCGAAG/ds-2_4-UCGAAG_x.pdb.gz
MCSYM-DB/2_4/UCGAAU/
MCSYM-DB/2_4/UCGAAU/2_4-UCGAAU.mcs
MCSYM-DB/2_4/UCGACA/
MCSYM-DB/2_4/UCGACA/2_4-UCGACA.mcs
MCSYM-DB/2_4/UCGACA/ds-2_4-UCGACA_x.pdb.gz
MCSYM-DB/2_4/UCGACG/
MCSYM-DB/2_4/UCGACG/2_4-UCGACG.mcs
MCSYM-DB/2_4/UCGACG/ds-2_4-UCGACG_x.pdb.gz
MCSYM-DB/2_4/UCGACU/
MCSYM-DB/2_4/UCGACU/2_4-UCGACU.mcs
MCSYM-DB/2_4/UCGACU/ds-2_4-UCGACU_x.pdb.gz
MCSYM-DB/2_4/UCGAGA/
MCSYM-DB/2_4/UCGAGA/2_4-UCGAGA.mcs
MCSYM-DB/2_4/UCGAGA/ds-2_4-UCGAGA_x.pdb.gz
MCSYM-DB/2_4/UCGAGG/
MCSYM-DB/2_4/UCGAGG/2_4-UCGAGG.mcs
MCSYM-DB/2_4/UCGAGU/
MCSYM-DB/2_4/UCGAGU/2_4-UCGAGU.mcs
MCSYM-DB/2_4/UCGAUA/
MCSYM-DB/2_4/UCGAUA/2_4-UCGAUA.mcs
MCSYM-DB/2_4/UCGAUA/ds-2_4-UCGAUA_x.pdb.gz
MCSYM-DB/2_4/UCGAUC/
MCSYM-DB/2_4/UCGAUC/2_4-UCGAUC.mcs
MCSYM-DB/2_4/UCGAUG/
MCSYM-DB/2_4/UCGAUG/2_4-UCGAUG.mcs
MCSYM-DB/2_4/UCGAUU/
MCSYM-DB/2_4/UCGAUU/2_4-UCGAUU.mcs
MCSYM-DB/2_4/UCGAUU/ds-2_4-UCGAUU_x.pdb.gz
MCSYM-DB/2_4/UCGCAA/
MCSYM-DB/2_4/UCGCAA/2_4-UCGCAA.mcs
MCSYM-DB/2_4/UCGCAA/ds-2_4-UCGCAA_x.pdb.gz
MCSYM-DB/2_4/UCGCAC/
MCSYM-DB/2_4/UCGCAC/2_4-UCGCAC.mcs
MCSYM-DB/2_4/UCGCAG/
MCSYM-DB/2_4/UCGCAG/2_4-UCGCAG.mcs
MCSYM-DB/2_4/UCGCAG/ds-2_4-UCGCAG_x.pdb.gz
MCSYM-DB/2_4/UCGCAU/
MCSYM-DB/2_4/UCGCAU/2_4-UCGCAU.mcs
MCSYM-DB/2_4/UCGCAU/ds-2_4-UCGCAU_x.pdb.gz
MCSYM-DB/2_4/UCGCCA/
MCSYM-DB/2_4/UCGCCA/2_4-UCGCCA.mcs
MCSYM-DB/2_4/UCGCCA/ds-2_4-UCGCCA_x.pdb.gz
MCSYM-DB/2_4/UCGCCC/
MCSYM-DB/2_4/UCGCCC/2_4-UCGCCC.mcs
MCSYM-DB/2_4/UCGCCC/ds-2_4-UCGCCC_x.pdb.gz
MCSYM-DB/2_4/UCGCCG/
MCSYM-DB/2_4/UCGCCG/2_4-UCGCCG.mcs
MCSYM-DB/2_4/UCGCCG/ds-2_4-UCGCCG_x.pdb.gz
MCSYM-DB/2_4/UCGCCU/
MCSYM-DB/2_4/UCGCCU/2_4-UCGCCU.mcs
MCSYM-DB/2_4/UCGCCU/ds-2_4-UCGCCU_x.pdb.gz
MCSYM-DB/2_4/UCGCGA/
MCSYM-DB/2_4/UCGCGA/2_4-UCGCGA.mcs
MCSYM-DB/2_4/UCGCGA/ds-2_4-UCGCGA_x.pdb.gz
MCSYM-DB/2_4/UCGCGG/
MCSYM-DB/2_4/UCGCGG/2_4-UCGCGG.mcs
MCSYM-DB/2_4/UCGCGU/
MCSYM-DB/2_4/UCGCGU/2_4-UCGCGU.mcs
MCSYM-DB/2_4/UCGCGU/ds-2_4-UCGCGU_x.pdb.gz
MCSYM-DB/2_4/UCGCUA/
MCSYM-DB/2_4/UCGCUA/2_4-UCGCUA.mcs
MCSYM-DB/2_4/UCGCUA/ds-2_4-UCGCUA_x.pdb.gz
MCSYM-DB/2_4/UCGCUC/
MCSYM-DB/2_4/UCGCUC/2_4-UCGCUC.mcs
MCSYM-DB/2_4/UCGCUC/ds-2_4-UCGCUC_x.pdb.gz
MCSYM-DB/2_4/UCGCUG/
MCSYM-DB/2_4/UCGCUG/2_4-UCGCUG.mcs
MCSYM-DB/2_4/UCGCUG/ds-2_4-UCGCUG_x.pdb.gz
MCSYM-DB/2_4/UCGCUU/
MCSYM-DB/2_4/UCGCUU/2_4-UCGCUU.mcs
MCSYM-DB/2_4/UCGCUU/ds-2_4-UCGCUU_x.pdb.gz
MCSYM-DB/2_4/UCGGAA/
MCSYM-DB/2_4/UCGGAA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/UCGGAA/2_4-UCGGAA.mcs
MCSYM-DB/2_4/UCGGAA/ds-2_4-UCGGAA_x.pdb.gz
MCSYM-DB/2_4/UCGGAC/
MCSYM-DB/2_4/UCGGAC/2_4-UCGGAC.mcs
MCSYM-DB/2_4/UCGGAG/
MCSYM-DB/2_4/UCGGAG/2_4-UCGGAG.mcs
MCSYM-DB/2_4/UCGGAG/ds-2_4-UCGGAG_x.pdb.gz
MCSYM-DB/2_4/UCGGCA/
MCSYM-DB/2_4/UCGGCA/2_4-UCGGCA.mcs
MCSYM-DB/2_4/UCGGCA/ds-2_4-UCGGCA_x.pdb.gz
MCSYM-DB/2_4/UCGGCC/
MCSYM-DB/2_4/UCGGCC/2_4-UCGGCC.mcs
MCSYM-DB/2_4/UCGGCG/
MCSYM-DB/2_4/UCGGCG/2_4-UCGGCG.mcs
MCSYM-DB/2_4/UCGGCG/ds-2_4-UCGGCG_x.pdb.gz
MCSYM-DB/2_4/UCGGCU/
MCSYM-DB/2_4/UCGGCU/2_4-UCGGCU.mcs
MCSYM-DB/2_4/UCGGGA/
MCSYM-DB/2_4/UCGGGA/2_4-UCGGGA.mcs
MCSYM-DB/2_4/UCGGGA/ds-2_4-UCGGGA_x.pdb.gz
MCSYM-DB/2_4/UCGGGG/
MCSYM-DB/2_4/UCGGGG/2_4-UCGGGG.mcs
MCSYM-DB/2_4/UCGGGG/ds-2_4-UCGGGG_x.pdb.gz
MCSYM-DB/2_4/UCGGGU/
MCSYM-DB/2_4/UCGGGU/2_4-UCGGGU.mcs
MCSYM-DB/2_4/UCGGGU/ds-2_4-UCGGGU_x.pdb
MCSYM-DB/2_4/UCGGGU/ds-2_4-UCGGGU_x.pdb.gz
MCSYM-DB/2_4/UCGGUA/
MCSYM-DB/2_4/UCGGUA/2_4-UCGGUA.mcs
MCSYM-DB/2_4/UCGGUA/ds-2_4-UCGGUA_x.pdb.gz
MCSYM-DB/2_4/UCGGUC/
MCSYM-DB/2_4/UCGGUC/2_4-UCGGUC.mcs
MCSYM-DB/2_4/UCGGUG/
MCSYM-DB/2_4/UCGGUG/2_4-UCGGUG.mcs
MCSYM-DB/2_4/UCGGUG/ds-2_4-UCGGUG_x.pdb.gz
MCSYM-DB/2_4/UCGGUU/
MCSYM-DB/2_4/UCGGUU/2_4-UCGGUU.mcs
MCSYM-DB/2_4/UCGUAA/
MCSYM-DB/2_4/UCGUAA/2_4-UCGUAA.mcs
MCSYM-DB/2_4/UCGUAA/ds-2_4-UCGUAA_x.pdb.gz
MCSYM-DB/2_4/UCGUAG/
MCSYM-DB/2_4/UCGUAG/2_4-UCGUAG.mcs
MCSYM-DB/2_4/UCGUAU/
MCSYM-DB/2_4/UCGUAU/2_4-UCGUAU.mcs
MCSYM-DB/2_4/UCGUAU/ds-2_4-UCGUAU_x.pdb.gz
MCSYM-DB/2_4/UCGUCA/
MCSYM-DB/2_4/UCGUCA/2_4-UCGUCA.mcs
MCSYM-DB/2_4/UCGUCA/ds-2_4-UCGUCA_x.pdb.gz
MCSYM-DB/2_4/UCGUCC/
MCSYM-DB/2_4/UCGUCC/2_4-UCGUCC.mcs
MCSYM-DB/2_4/UCGUCC/ds-2_4-UCGUCC_x.pdb.gz
MCSYM-DB/2_4/UCGUCG/
MCSYM-DB/2_4/UCGUCG/2_4-UCGUCG.mcs
MCSYM-DB/2_4/UCGUCG/ds-2_4-UCGUCG_x.pdb.gz
MCSYM-DB/2_4/UCGUCU/
MCSYM-DB/2_4/UCGUCU/2_4-UCGUCU.mcs
MCSYM-DB/2_4/UCGUCU/ds-2_4-UCGUCU_x.pdb.gz
MCSYM-DB/2_4/UCGUGA/
MCSYM-DB/2_4/UCGUGA/2_4-UCGUGA.mcs
MCSYM-DB/2_4/UCGUGG/
MCSYM-DB/2_4/UCGUGG/2_4-UCGUGG.mcs
MCSYM-DB/2_4/UCGUGU/
MCSYM-DB/2_4/UCGUGU/2_4-UCGUGU.mcs
MCSYM-DB/2_4/UCGUGU/ds-2_4-UCGUGU_x.pdb.gz
MCSYM-DB/2_4/UCGUUA/
MCSYM-DB/2_4/UCGUUA/2_4-UCGUUA.mcs
MCSYM-DB/2_4/UCGUUA/ds-2_4-UCGUUA_x.pdb.gz
MCSYM-DB/2_4/UCGUUC/
MCSYM-DB/2_4/UCGUUC/2_4-UCGUUC.mcs
MCSYM-DB/2_4/UCGUUC/ds-2_4-UCGUUC_x.pdb.gz
MCSYM-DB/2_4/UCGUUG/
MCSYM-DB/2_4/UCGUUG/2_4-UCGUUG.mcs
MCSYM-DB/2_4/UCGUUG/ds-2_4-UCGUUG_x.pdb.gz
MCSYM-DB/2_4/UCGUUU/
MCSYM-DB/2_4/UCGUUU/2_4-UCGUUU.mcs
MCSYM-DB/2_4/UCUAAA/
MCSYM-DB/2_4/UCUAAA/2_4-UCUAAA.mcs
MCSYM-DB/2_4/UCUAAA/ds-2_4-UCUAAA_x.pdb.gz
MCSYM-DB/2_4/UCUAGA/
MCSYM-DB/2_4/UCUAGA/2_4-UCUAGA.mcs
MCSYM-DB/2_4/UCUAUA/
MCSYM-DB/2_4/UCUAUA/2_4-UCUAUA.mcs
MCSYM-DB/2_4/UCUAUG/
MCSYM-DB/2_4/UCUAUG/2_4-UCUAUG.mcs
MCSYM-DB/2_4/UCUCAA/
MCSYM-DB/2_4/UCUCAA/2_4-UCUCAA.mcs
MCSYM-DB/2_4/UCUCAG/
MCSYM-DB/2_4/UCUCAG/2_4-UCUCAG.mcs
MCSYM-DB/2_4/UCUCAG/ds-2_4-UCUCAG_x.pdb.gz
MCSYM-DB/2_4/UCUCCU/
MCSYM-DB/2_4/UCUCCU/2_4-UCUCCU.mcs
MCSYM-DB/2_4/UCUCUA/
MCSYM-DB/2_4/UCUCUA/2_4-UCUCUA.mcs
MCSYM-DB/2_4/UCUCUC/
MCSYM-DB/2_4/UCUCUC/2_4-UCUCUC.mcs
MCSYM-DB/2_4/UCUCUG/
MCSYM-DB/2_4/UCUCUG/2_4-UCUCUG.mcs
MCSYM-DB/2_4/UCUCUG/ds-2_4-UCUCUG_x.pdb.gz
MCSYM-DB/2_4/UCUCUU/
MCSYM-DB/2_4/UCUCUU/2_4-UCUCUU.mcs
MCSYM-DB/2_4/UCUGCU/
MCSYM-DB/2_4/UCUGCU/2_4-UCUGCU.mcs
MCSYM-DB/2_4/UCUGGC/
MCSYM-DB/2_4/UCUGGC/2_4-UCUGGC.mcs
MCSYM-DB/2_4/UCUUAA/
MCSYM-DB/2_4/UCUUAA/2_4-UCUUAA.mcs
MCSYM-DB/2_4/UCUUCA/
MCSYM-DB/2_4/UCUUCA/2_4-UCUUCA.mcs
MCSYM-DB/2_4/UCUUCC/
MCSYM-DB/2_4/UCUUCC/2_4-UCUUCC.mcs
MCSYM-DB/2_4/UCUUUA/
MCSYM-DB/2_4/UCUUUA/2_4-UCUUUA.mcs
MCSYM-DB/2_4/UCUUUA/ds-2_4-UCUUUA_x.pdb.gz
MCSYM-DB/2_4/UCUUUG/
MCSYM-DB/2_4/UCUUUG/2_4-UCUUUG.mcs
MCSYM-DB/2_4/UCUUUG/ds-2_4-UCUUUG_x.pdb.gz
MCSYM-DB/2_4/UGAAAA/
MCSYM-DB/2_4/UGAAAA/2_4-UGAAAA.mcs
MCSYM-DB/2_4/UGAAAA/ds-2_4-UGAAAA_x.pdb.gz
MCSYM-DB/2_4/UGAAAG/
MCSYM-DB/2_4/UGAAAG/2_4-UGAAAG.mcs
MCSYM-DB/2_4/UGAAAG/ds-2_4-UGAAAG_x.pdb.gz
MCSYM-DB/2_4/UGAAAU/
MCSYM-DB/2_4/UGAAAU/2_4-UGAAAU.mcs
MCSYM-DB/2_4/UGAACC/
MCSYM-DB/2_4/UGAACC/2_4-UGAACC.mcs
MCSYM-DB/2_4/UGAACC/ds-2_4-UGAACC_x.pdb.gz
MCSYM-DB/2_4/UGAACU/
MCSYM-DB/2_4/UGAACU/2_4-UGAACU.mcs
MCSYM-DB/2_4/UGAAGA/
MCSYM-DB/2_4/UGAAGA/2_4-UGAAGA.mcs
MCSYM-DB/2_4/UGAAGA/ds-2_4-UGAAGA_x.pdb.gz
MCSYM-DB/2_4/UGAAGC/
MCSYM-DB/2_4/UGAAGC/2_4-UGAAGC.mcs
MCSYM-DB/2_4/UGAAGC/ds-2_4-UGAAGC_x.pdb.gz
MCSYM-DB/2_4/UGAAGG/
MCSYM-DB/2_4/UGAAGG/2_4-UGAAGG.mcs
MCSYM-DB/2_4/UGAAUA/
MCSYM-DB/2_4/UGAAUA/2_4-UGAAUA.mcs
MCSYM-DB/2_4/UGAAUC/
MCSYM-DB/2_4/UGAAUC/2_4-UGAAUC.mcs
MCSYM-DB/2_4/UGAAUG/
MCSYM-DB/2_4/UGAAUG/2_4-UGAAUG.mcs
MCSYM-DB/2_4/UGAAUG/ds-2_4-UGAAUG_x.pdb.gz
MCSYM-DB/2_4/UGAAUU/
MCSYM-DB/2_4/UGAAUU/2_4-UGAAUU.mcs
MCSYM-DB/2_4/UGACAC/
MCSYM-DB/2_4/UGACAC/2_4-UGACAC.mcs
MCSYM-DB/2_4/UGACCA/
MCSYM-DB/2_4/UGACCA/2_4-UGACCA.mcs
MCSYM-DB/2_4/UGACCC/
MCSYM-DB/2_4/UGACCC/2_4-UGACCC.mcs
MCSYM-DB/2_4/UGACUA/
MCSYM-DB/2_4/UGACUA/2_4-UGACUA.mcs
MCSYM-DB/2_4/UGACUC/
MCSYM-DB/2_4/UGACUC/2_4-UGACUC.mcs
MCSYM-DB/2_4/UGACUC/ds-2_4-UGACUC_x.pdb.gz
MCSYM-DB/2_4/UGACUU/
MCSYM-DB/2_4/UGACUU/2_4-UGACUU.mcs
MCSYM-DB/2_4/UGAGAA/
MCSYM-DB/2_4/UGAGAA/2_4-UGAGAA.mcs
MCSYM-DB/2_4/UGAGAA/ds-2_4-UGAGAA_x.pdb.gz
MCSYM-DB/2_4/UGAGCA/
MCSYM-DB/2_4/UGAGCA/2_4-UGAGCA.mcs
MCSYM-DB/2_4/UGAGCG/
MCSYM-DB/2_4/UGAGCG/2_4-UGAGCG.mcs
MCSYM-DB/2_4/UGAGGA/
MCSYM-DB/2_4/UGAGGA/2_4-UGAGGA.mcs
MCSYM-DB/2_4/UGAGGA/ds-2_4-UGAGGA_x.pdb.gz
MCSYM-DB/2_4/UGAGGC/
MCSYM-DB/2_4/UGAGGC/2_4-UGAGGC.mcs
MCSYM-DB/2_4/UGAGGC/ds-2_4-UGAGGC_x.pdb.gz
MCSYM-DB/2_4/UGAGGG/
MCSYM-DB/2_4/UGAGGG/2_4-UGAGGG.mcs
MCSYM-DB/2_4/UGAGUA/
MCSYM-DB/2_4/UGAGUA/2_4-UGAGUA.mcs
MCSYM-DB/2_4/UGAGUC/
MCSYM-DB/2_4/UGAGUC/2_4-UGAGUC.mcs
MCSYM-DB/2_4/UGAGUG/
MCSYM-DB/2_4/UGAGUG/2_4-UGAGUG.mcs
MCSYM-DB/2_4/UGAGUG/ds-2_4-UGAGUG_x.pdb.gz
MCSYM-DB/2_4/UGAUAG/
MCSYM-DB/2_4/UGAUAG/2_4-UGAUAG.mcs
MCSYM-DB/2_4/UGAUAU/
MCSYM-DB/2_4/UGAUAU/2_4-UGAUAU.mcs
MCSYM-DB/2_4/UGAUAU/ds-2_4-UGAUAU_x.pdb.gz
MCSYM-DB/2_4/UGAUCU/
MCSYM-DB/2_4/UGAUCU/2_4-UGAUCU.mcs
MCSYM-DB/2_4/UGAUGA/
MCSYM-DB/2_4/UGAUGA/2_4-UGAUGA.mcs
MCSYM-DB/2_4/UGAUGA/ds-2_4-UGAUGA_x.pdb.gz
MCSYM-DB/2_4/UGAUGG/
MCSYM-DB/2_4/UGAUGG/2_4-UGAUGG.mcs
MCSYM-DB/2_4/UGAUGG/ds-2_4-UGAUGG_x.pdb.gz
MCSYM-DB/2_4/UGAUUA/
MCSYM-DB/2_4/UGAUUA/2_4-UGAUUA.mcs
MCSYM-DB/2_4/UGAUUG/
MCSYM-DB/2_4/UGAUUG/2_4-UGAUUG.mcs
MCSYM-DB/2_4/UGAUUG/ds-2_4-UGAUUG_x.pdb.gz
MCSYM-DB/2_4/UGAUUU/
MCSYM-DB/2_4/UGAUUU/2_4-UGAUUU.mcs
MCSYM-DB/2_4/UGCAAA/
MCSYM-DB/2_4/UGCAAA/2_4-UGCAAA.mcs
MCSYM-DB/2_4/UGCAAA/ds-2_4-UGCAAA_x.pdb.gz
MCSYM-DB/2_4/UGCAAG/
MCSYM-DB/2_4/UGCAAG/2_4-UGCAAG.mcs
MCSYM-DB/2_4/UGCAAG/ds-2_4-UGCAAG_x.pdb.gz
MCSYM-DB/2_4/UGCAAU/
MCSYM-DB/2_4/UGCAAU/2_4-UGCAAU.mcs
MCSYM-DB/2_4/UGCACA/
MCSYM-DB/2_4/UGCACA/2_4-UGCACA.mcs
MCSYM-DB/2_4/UGCACA/ds-2_4-UGCACA_x.pdb.gz
MCSYM-DB/2_4/UGCACC/
MCSYM-DB/2_4/UGCACC/2_4-UGCACC.mcs
MCSYM-DB/2_4/UGCACG/
MCSYM-DB/2_4/UGCACG/2_4-UGCACG.mcs
MCSYM-DB/2_4/UGCACG/ds-2_4-UGCACG_x.pdb.gz
MCSYM-DB/2_4/UGCAGA/
MCSYM-DB/2_4/UGCAGA/2_4-UGCAGA.mcs
MCSYM-DB/2_4/UGCAGA/ds-2_4-UGCAGA_x.pdb.gz
MCSYM-DB/2_4/UGCAGG/
MCSYM-DB/2_4/UGCAGG/2_4-UGCAGG.mcs
MCSYM-DB/2_4/UGCAGG/ds-2_4-UGCAGG_x.pdb.gz
MCSYM-DB/2_4/UGCAGU/
MCSYM-DB/2_4/UGCAGU/2_4-UGCAGU.mcs
MCSYM-DB/2_4/UGCAGU/ds-2_4-UGCAGU_x.pdb.gz
MCSYM-DB/2_4/UGCAUA/
MCSYM-DB/2_4/UGCAUA/2_4-UGCAUA.mcs
MCSYM-DB/2_4/UGCAUA/ds-2_4-UGCAUA_x.pdb.gz
MCSYM-DB/2_4/UGCAUC/
MCSYM-DB/2_4/UGCAUC/2_4-UGCAUC.mcs
MCSYM-DB/2_4/UGCAUG/
MCSYM-DB/2_4/UGCAUG/2_4-UGCAUG.mcs
MCSYM-DB/2_4/UGCAUG/ds-2_4-UGCAUG_x.pdb.gz
MCSYM-DB/2_4/UGCAUU/
MCSYM-DB/2_4/UGCAUU/2_4-UGCAUU.mcs
MCSYM-DB/2_4/UGCCAA/
MCSYM-DB/2_4/UGCCAA/2_4-UGCCAA.mcs
MCSYM-DB/2_4/UGCCAA/ds-2_4-UGCCAA_x.pdb.gz
MCSYM-DB/2_4/UGCCAC/
MCSYM-DB/2_4/UGCCAC/2_4-UGCCAC.mcs
MCSYM-DB/2_4/UGCCAC/ds-2_4-UGCCAC_x.pdb.gz
MCSYM-DB/2_4/UGCCAG/
MCSYM-DB/2_4/UGCCAG/2_4-UGCCAG.mcs
MCSYM-DB/2_4/UGCCAG/ds-2_4-UGCCAG_x.pdb.gz
MCSYM-DB/2_4/UGCCCA/
MCSYM-DB/2_4/UGCCCA/2_4-UGCCCA.mcs
MCSYM-DB/2_4/UGCCCA/ds-2_4-UGCCCA_x.pdb.gz
MCSYM-DB/2_4/UGCCCC/
MCSYM-DB/2_4/UGCCCC/2_4-UGCCCC.mcs
MCSYM-DB/2_4/UGCCCC/ds-2_4-UGCCCC_x.pdb.gz
MCSYM-DB/2_4/UGCCCG/
MCSYM-DB/2_4/UGCCCG/2_4-UGCCCG.mcs
MCSYM-DB/2_4/UGCCCG/ds-2_4-UGCCCG_x.pdb.gz
MCSYM-DB/2_4/UGCCCU/
MCSYM-DB/2_4/UGCCCU/2_4-UGCCCU.mcs
MCSYM-DB/2_4/UGCCCU/ds-2_4-UGCCCU_x.pdb.gz
MCSYM-DB/2_4/UGCCGA/
MCSYM-DB/2_4/UGCCGA/2_4-UGCCGA.mcs
MCSYM-DB/2_4/UGCCGA/ds-2_4-UGCCGA_x.pdb.gz
MCSYM-DB/2_4/UGCCGC/
MCSYM-DB/2_4/UGCCGC/2_4-UGCCGC.mcs
MCSYM-DB/2_4/UGCCGC/ds-2_4-UGCCGC_x.pdb.gz
MCSYM-DB/2_4/UGCCGG/
MCSYM-DB/2_4/UGCCGG/2_4-UGCCGG.mcs
MCSYM-DB/2_4/UGCCGG/ds-2_4-UGCCGG_x.pdb.gz
MCSYM-DB/2_4/UGCCGU/
MCSYM-DB/2_4/UGCCGU/2_4-UGCCGU.mcs
MCSYM-DB/2_4/UGCCGU/ds-2_4-UGCCGU_x.pdb.gz
MCSYM-DB/2_4/UGCCUA/
MCSYM-DB/2_4/UGCCUA/2_4-UGCCUA.mcs
MCSYM-DB/2_4/UGCCUA/ds-2_4-UGCCUA_x.pdb.gz
MCSYM-DB/2_4/UGCCUC/
MCSYM-DB/2_4/UGCCUC/2_4-UGCCUC.mcs
MCSYM-DB/2_4/UGCCUC/ds-2_4-UGCCUC_x.pdb.gz
MCSYM-DB/2_4/UGCCUG/
MCSYM-DB/2_4/UGCCUG/2_4-UGCCUG.mcs
MCSYM-DB/2_4/UGCCUG/ds-2_4-UGCCUG_x.pdb.gz
MCSYM-DB/2_4/UGCCUU/
MCSYM-DB/2_4/UGCCUU/2_4-UGCCUU.mcs
MCSYM-DB/2_4/UGCCUU/ds-2_4-UGCCUU_x.pdb.gz
MCSYM-DB/2_4/UGCGAA/
MCSYM-DB/2_4/UGCGAA/1VQ7_model_1.pdb.gz
MCSYM-DB/2_4/UGCGAA/2_4-UGCGAA.mcs
MCSYM-DB/2_4/UGCGAA/ds-2_4-UGCGAA_x.pdb.gz
MCSYM-DB/2_4/UGCGAG/
MCSYM-DB/2_4/UGCGAG/2_4-UGCGAG.mcs
MCSYM-DB/2_4/UGCGAG/ds-2_4-UGCGAG_x.pdb.gz
MCSYM-DB/2_4/UGCGCA/
MCSYM-DB/2_4/UGCGCA/2_4-UGCGCA.mcs
MCSYM-DB/2_4/UGCGCA/ds-2_4-UGCGCA_x.pdb.gz
MCSYM-DB/2_4/UGCGCG/
MCSYM-DB/2_4/UGCGCG/2_4-UGCGCG.mcs
MCSYM-DB/2_4/UGCGCG/ds-2_4-UGCGCG_x.pdb.gz
MCSYM-DB/2_4/UGCGGA/
MCSYM-DB/2_4/UGCGGA/2_4-UGCGGA.mcs
MCSYM-DB/2_4/UGCGGA/ds-2_4-UGCGGA_x.pdb.gz
MCSYM-DB/2_4/UGCGGG/
MCSYM-DB/2_4/UGCGGG/2_4-UGCGGG.mcs
MCSYM-DB/2_4/UGCGGG/ds-2_4-UGCGGG_x.pdb.gz
MCSYM-DB/2_4/UGCGGU/
MCSYM-DB/2_4/UGCGGU/2_4-UGCGGU.mcs
MCSYM-DB/2_4/UGCGGU/ds-2_4-UGCGGU_x.pdb.gz
MCSYM-DB/2_4/UGCGUA/
MCSYM-DB/2_4/UGCGUA/2_4-UGCGUA.mcs
MCSYM-DB/2_4/UGCGUA/ds-2_4-UGCGUA_x.pdb.gz
MCSYM-DB/2_4/UGCGUG/
MCSYM-DB/2_4/UGCGUG/2_4-UGCGUG.mcs
MCSYM-DB/2_4/UGCGUU/
MCSYM-DB/2_4/UGCGUU/2_4-UGCGUU.mcs
MCSYM-DB/2_4/UGCUAA/
MCSYM-DB/2_4/UGCUAA/1L8V_model_1.pdb.gz
MCSYM-DB/2_4/UGCUAA/2_4-UGCUAA.mcs
MCSYM-DB/2_4/UGCUAA/ds-2_4-UGCUAA_x.pdb.gz
MCSYM-DB/2_4/UGCUAG/
MCSYM-DB/2_4/UGCUAG/2_4-UGCUAG.mcs
MCSYM-DB/2_4/UGCUAG/ds-2_4-UGCUAG_x.pdb.gz
MCSYM-DB/2_4/UGCUAU/
MCSYM-DB/2_4/UGCUAU/2_4-UGCUAU.mcs
MCSYM-DB/2_4/UGCUAU/ds-2_4-UGCUAU_x.pdb.gz
MCSYM-DB/2_4/UGCUCA/
MCSYM-DB/2_4/UGCUCA/2_4-UGCUCA.mcs
MCSYM-DB/2_4/UGCUCA/ds-2_4-UGCUCA_x.pdb.gz
MCSYM-DB/2_4/UGCUCC/
MCSYM-DB/2_4/UGCUCC/2_4-UGCUCC.mcs
MCSYM-DB/2_4/UGCUCG/
MCSYM-DB/2_4/UGCUCG/2_4-UGCUCG.mcs
MCSYM-DB/2_4/UGCUGA/
MCSYM-DB/2_4/UGCUGA/2_4-UGCUGA.mcs
MCSYM-DB/2_4/UGCUGA/ds-2_4-UGCUGA_x.pdb.gz
MCSYM-DB/2_4/UGCUGC/
MCSYM-DB/2_4/UGCUGC/2_4-UGCUGC.mcs
MCSYM-DB/2_4/UGCUGC/ds-2_4-UGCUGC_x.pdb.gz
MCSYM-DB/2_4/UGCUGG/
MCSYM-DB/2_4/UGCUGG/2_4-UGCUGG.mcs
MCSYM-DB/2_4/UGCUGG/ds-2_4-UGCUGG_x.pdb.gz
MCSYM-DB/2_4/UGCUGU/
MCSYM-DB/2_4/UGCUGU/2_4-UGCUGU.mcs
MCSYM-DB/2_4/UGCUUA/
MCSYM-DB/2_4/UGCUUA/2_4-UGCUUA.mcs
MCSYM-DB/2_4/UGCUUA/ds-2_4-UGCUUA_x.pdb.gz
MCSYM-DB/2_4/UGCUUC/
MCSYM-DB/2_4/UGCUUC/2_4-UGCUUC.mcs
MCSYM-DB/2_4/UGCUUC/ds-2_4-UGCUUC_x.pdb.gz
MCSYM-DB/2_4/UGCUUG/
MCSYM-DB/2_4/UGCUUG/2_4-UGCUUG.mcs
MCSYM-DB/2_4/UGCUUG/ds-2_4-UGCUUG_x.pdb.gz
MCSYM-DB/2_4/UGCUUU/
MCSYM-DB/2_4/UGCUUU/2_4-UGCUUU.mcs
MCSYM-DB/2_4/UGGAAA/
MCSYM-DB/2_4/UGGAAA/2_4-UGGAAA.mcs
MCSYM-DB/2_4/UGGAAA/ds-2_4-UGGAAA_x.pdb.gz
MCSYM-DB/2_4/UGGACA/
MCSYM-DB/2_4/UGGACA/2_4-UGGACA.mcs
MCSYM-DB/2_4/UGGAGA/
MCSYM-DB/2_4/UGGAGA/2_4-UGGAGA.mcs
MCSYM-DB/2_4/UGGAGA/ds-2_4-UGGAGA_x.pdb.gz
MCSYM-DB/2_4/UGGCAA/
MCSYM-DB/2_4/UGGCAA/2_4-UGGCAA.mcs
MCSYM-DB/2_4/UGGCAA/ds-2_4-UGGCAA_x.pdb.gz
MCSYM-DB/2_4/UGGCAG/
MCSYM-DB/2_4/UGGCAG/2_4-UGGCAG.mcs
MCSYM-DB/2_4/UGGCCC/
MCSYM-DB/2_4/UGGCCC/2_4-UGGCCC.mcs
MCSYM-DB/2_4/UGGCCC/ds-2_4-UGGCCC_x.pdb.gz
MCSYM-DB/2_4/UGGCGA/
MCSYM-DB/2_4/UGGCGA/2_4-UGGCGA.mcs
MCSYM-DB/2_4/UGGCGA/ds-2_4-UGGCGA_x.pdb.gz
MCSYM-DB/2_4/UGGCGG/
MCSYM-DB/2_4/UGGCGG/2_4-UGGCGG.mcs
MCSYM-DB/2_4/UGGCGG/ds-2_4-UGGCGG_x.pdb.gz
MCSYM-DB/2_4/UGGGAA/
MCSYM-DB/2_4/UGGGAA/2_4-UGGGAA.mcs
MCSYM-DB/2_4/UGGGAC/
MCSYM-DB/2_4/UGGGAC/2_4-UGGGAC.mcs
MCSYM-DB/2_4/UGGGAC/ds-2_4-UGGGAC_x.pdb.gz
MCSYM-DB/2_4/UGGGAU/
MCSYM-DB/2_4/UGGGAU/2_4-UGGGAU.mcs
MCSYM-DB/2_4/UGGGGA/
MCSYM-DB/2_4/UGGGGA/2_4-UGGGGA.mcs
MCSYM-DB/2_4/UGGGGA/ds-2_4-UGGGGA_x.pdb.gz
MCSYM-DB/2_4/UGGGGC/
MCSYM-DB/2_4/UGGGGC/2_4-UGGGGC.mcs
MCSYM-DB/2_4/UGGGUA/
MCSYM-DB/2_4/UGGGUA/2_4-UGGGUA.mcs
MCSYM-DB/2_4/UGGGUG/
MCSYM-DB/2_4/UGGGUG/2_4-UGGGUG.mcs
MCSYM-DB/2_4/UGGUGA/
MCSYM-DB/2_4/UGGUGA/2_4-UGGUGA.mcs
MCSYM-DB/2_4/UGGUGA/ds-2_4-UGGUGA_x.pdb.gz
MCSYM-DB/2_4/UGUAAA/
MCSYM-DB/2_4/UGUAAA/2_4-UGUAAA.mcs
MCSYM-DB/2_4/UGUAAA/ds-2_4-UGUAAA_x.pdb.gz
MCSYM-DB/2_4/UGUAAC/
MCSYM-DB/2_4/UGUAAC/2_4-UGUAAC.mcs
MCSYM-DB/2_4/UGUAAU/
MCSYM-DB/2_4/UGUAAU/2_4-UGUAAU.mcs
MCSYM-DB/2_4/UGUACA/
MCSYM-DB/2_4/UGUACA/2_4-UGUACA.mcs
MCSYM-DB/2_4/UGUACG/
MCSYM-DB/2_4/UGUACG/2_4-UGUACG.mcs
MCSYM-DB/2_4/UGUACU/
MCSYM-DB/2_4/UGUACU/2_4-UGUACU.mcs
MCSYM-DB/2_4/UGUAGA/
MCSYM-DB/2_4/UGUAGA/2_4-UGUAGA.mcs
MCSYM-DB/2_4/UGUAGA/ds-2_4-UGUAGA_x.pdb.gz
MCSYM-DB/2_4/UGUAGG/
MCSYM-DB/2_4/UGUAGG/2_4-UGUAGG.mcs
MCSYM-DB/2_4/UGUAUA/
MCSYM-DB/2_4/UGUAUA/2_4-UGUAUA.mcs
MCSYM-DB/2_4/UGUAUA/ds-2_4-UGUAUA_x.pdb.gz
MCSYM-DB/2_4/UGUAUG/
MCSYM-DB/2_4/UGUAUG/2_4-UGUAUG.mcs
MCSYM-DB/2_4/UGUAUG/ds-2_4-UGUAUG_x.pdb.gz
MCSYM-DB/2_4/UGUAUU/
MCSYM-DB/2_4/UGUAUU/2_4-UGUAUU.mcs
MCSYM-DB/2_4/UGUAUU/ds-2_4-UGUAUU_x.pdb.gz
MCSYM-DB/2_4/UGUCAA/
MCSYM-DB/2_4/UGUCAA/2_4-UGUCAA.mcs
MCSYM-DB/2_4/UGUCAG/
MCSYM-DB/2_4/UGUCAG/2_4-UGUCAG.mcs
MCSYM-DB/2_4/UGUCAU/
MCSYM-DB/2_4/UGUCAU/2_4-UGUCAU.mcs
MCSYM-DB/2_4/UGUCCA/
MCSYM-DB/2_4/UGUCCA/2_4-UGUCCA.mcs
MCSYM-DB/2_4/UGUCCC/
MCSYM-DB/2_4/UGUCCC/2_4-UGUCCC.mcs
MCSYM-DB/2_4/UGUCCC/ds-2_4-UGUCCC_x.pdb.gz
MCSYM-DB/2_4/UGUCCU/
MCSYM-DB/2_4/UGUCCU/2_4-UGUCCU.mcs
MCSYM-DB/2_4/UGUCCU/ds-2_4-UGUCCU_x.pdb.gz
MCSYM-DB/2_4/UGUCGC/
MCSYM-DB/2_4/UGUCGC/2_4-UGUCGC.mcs
MCSYM-DB/2_4/UGUCGG/
MCSYM-DB/2_4/UGUCGG/2_4-UGUCGG.mcs
MCSYM-DB/2_4/UGUCUA/
MCSYM-DB/2_4/UGUCUA/2_4-UGUCUA.mcs
MCSYM-DB/2_4/UGUCUA/ds-2_4-UGUCUA_x.pdb.gz
MCSYM-DB/2_4/UGUCUC/
MCSYM-DB/2_4/UGUCUC/2_4-UGUCUC.mcs
MCSYM-DB/2_4/UGUCUG/
MCSYM-DB/2_4/UGUCUG/2_4-UGUCUG.mcs
MCSYM-DB/2_4/UGUCUG/ds-2_4-UGUCUG_x.pdb.gz
MCSYM-DB/2_4/UGUCUU/
MCSYM-DB/2_4/UGUCUU/2_4-UGUCUU.mcs
MCSYM-DB/2_4/UGUGAA/
MCSYM-DB/2_4/UGUGAA/2_4-UGUGAA.mcs
MCSYM-DB/2_4/UGUGAA/ds-2_4-UGUGAA_x.pdb.gz
MCSYM-DB/2_4/UGUGAG/
MCSYM-DB/2_4/UGUGAG/2_4-UGUGAG.mcs
MCSYM-DB/2_4/UGUGAG/ds-2_4-UGUGAG_x.pdb.gz
MCSYM-DB/2_4/UGUGAU/
MCSYM-DB/2_4/UGUGAU/2_4-UGUGAU.mcs
MCSYM-DB/2_4/UGUGCA/
MCSYM-DB/2_4/UGUGCA/2_4-UGUGCA.mcs
MCSYM-DB/2_4/UGUGCG/
MCSYM-DB/2_4/UGUGCG/2_4-UGUGCG.mcs
MCSYM-DB/2_4/UGUGCG/ds-2_4-UGUGCG_x.pdb.gz
MCSYM-DB/2_4/UGUGCU/
MCSYM-DB/2_4/UGUGCU/2_4-UGUGCU.mcs
MCSYM-DB/2_4/UGUGGA/
MCSYM-DB/2_4/UGUGGA/2_4-UGUGGA.mcs
MCSYM-DB/2_4/UGUGGA/ds-2_4-UGUGGA_x.pdb.gz
MCSYM-DB/2_4/UGUGGG/
MCSYM-DB/2_4/UGUGGG/2_4-UGUGGG.mcs
MCSYM-DB/2_4/UGUGGG/ds-2_4-UGUGGG_x.pdb.gz
MCSYM-DB/2_4/UGUGGU/
MCSYM-DB/2_4/UGUGGU/2_4-UGUGGU.mcs
MCSYM-DB/2_4/UGUGUA/
MCSYM-DB/2_4/UGUGUA/2_4-UGUGUA.mcs
MCSYM-DB/2_4/UGUGUG/
MCSYM-DB/2_4/UGUGUG/2_4-UGUGUG.mcs
MCSYM-DB/2_4/UGUGUU/
MCSYM-DB/2_4/UGUGUU/2_4-UGUGUU.mcs
MCSYM-DB/2_4/UGUUAA/
MCSYM-DB/2_4/UGUUAA/2_4-UGUUAA.mcs
MCSYM-DB/2_4/UGUUAA/ds-2_4-UGUUAA_x.pdb.gz
MCSYM-DB/2_4/UGUUAC/
MCSYM-DB/2_4/UGUUAC/2_4-UGUUAC.mcs
MCSYM-DB/2_4/UGUUAG/
MCSYM-DB/2_4/UGUUAG/2_4-UGUUAG.mcs
MCSYM-DB/2_4/UGUUAG/ds-2_4-UGUUAG_x.pdb.gz
MCSYM-DB/2_4/UGUUAU/
MCSYM-DB/2_4/UGUUAU/2_4-UGUUAU.mcs
MCSYM-DB/2_4/UGUUCA/
MCSYM-DB/2_4/UGUUCA/2_4-UGUUCA.mcs
MCSYM-DB/2_4/UGUUCC/
MCSYM-DB/2_4/UGUUCC/2_4-UGUUCC.mcs
MCSYM-DB/2_4/UGUUCU/
MCSYM-DB/2_4/UGUUCU/2_4-UGUUCU.mcs
MCSYM-DB/2_4/UGUUCU/ds-2_4-UGUUCU_x.pdb.gz
MCSYM-DB/2_4/UGUUGA/
MCSYM-DB/2_4/UGUUGA/2_4-UGUUGA.mcs
MCSYM-DB/2_4/UGUUGA/ds-2_4-UGUUGA_x.pdb.gz
MCSYM-DB/2_4/UGUUGU/
MCSYM-DB/2_4/UGUUGU/2_4-UGUUGU.mcs
MCSYM-DB/2_4/UGUUGU/ds-2_4-UGUUGU_x.pdb.gz
MCSYM-DB/2_4/UGUUUA/
MCSYM-DB/2_4/UGUUUA/2_4-UGUUUA.mcs
MCSYM-DB/2_4/UGUUUA/ds-2_4-UGUUUA_x.pdb.gz
MCSYM-DB/2_4/UGUUUC/
MCSYM-DB/2_4/UGUUUC/2_4-UGUUUC.mcs
MCSYM-DB/2_4/UGUUUC/ds-2_4-UGUUUC_x.pdb.gz
MCSYM-DB/2_4/UGUUUG/
MCSYM-DB/2_4/UGUUUG/2_4-UGUUUG.mcs
MCSYM-DB/2_4/UGUUUG/ds-2_4-UGUUUG_x.pdb.gz
MCSYM-DB/2_4/UGUUUU/
MCSYM-DB/2_4/UGUUUU/2_4-UGUUUU.mcs
MCSYM-DB/2_4/UGUUUU/ds-2_4-UGUUUU_x.pdb.gz
MCSYM-DB/2_4/UUAAAA/
MCSYM-DB/2_4/UUAAAA/2_4-UUAAAA.mcs
MCSYM-DB/2_4/UUAAAA/ds-2_4-UUAAAA_x.pdb.gz
MCSYM-DB/2_4/UUAAAG/
MCSYM-DB/2_4/UUAAAG/2_4-UUAAAG.mcs
MCSYM-DB/2_4/UUAAAU/
MCSYM-DB/2_4/UUAAAU/2_4-UUAAAU.mcs
MCSYM-DB/2_4/UUAAAU/ds-2_4-UUAAAU_x.pdb.gz
MCSYM-DB/2_4/UUAACA/
MCSYM-DB/2_4/UUAACA/2_4-UUAACA.mcs
MCSYM-DB/2_4/UUAACA/ds-2_4-UUAACA_x.pdb.gz
MCSYM-DB/2_4/UUAACC/
MCSYM-DB/2_4/UUAACC/2_4-UUAACC.mcs
MCSYM-DB/2_4/UUAACG/
MCSYM-DB/2_4/UUAACG/2_4-UUAACG.mcs
MCSYM-DB/2_4/UUAACG/ds-2_4-UUAACG_x.pdb.gz
MCSYM-DB/2_4/UUAACU/
MCSYM-DB/2_4/UUAACU/2_4-UUAACU.mcs
MCSYM-DB/2_4/UUAAGA/
MCSYM-DB/2_4/UUAAGA/2_4-UUAAGA.mcs
MCSYM-DB/2_4/UUAAGA/ds-2_4-UUAAGA_x.pdb.gz
MCSYM-DB/2_4/UUAAGC/
MCSYM-DB/2_4/UUAAGC/2_4-UUAAGC.mcs
MCSYM-DB/2_4/UUAAGC/ds-2_4-UUAAGC_x.pdb.gz
MCSYM-DB/2_4/UUAAGG/
MCSYM-DB/2_4/UUAAGG/2_4-UUAAGG.mcs
MCSYM-DB/2_4/UUAAGG/ds-2_4-UUAAGG_x.pdb.gz
MCSYM-DB/2_4/UUAAGU/
MCSYM-DB/2_4/UUAAGU/2_4-UUAAGU.mcs
MCSYM-DB/2_4/UUAAUA/
MCSYM-DB/2_4/UUAAUA/2_4-UUAAUA.mcs
MCSYM-DB/2_4/UUAAUA/ds-2_4-UUAAUA_x.pdb.gz
MCSYM-DB/2_4/UUAAUC/
MCSYM-DB/2_4/UUAAUC/2_4-UUAAUC.mcs
MCSYM-DB/2_4/UUAAUC/ds-2_4-UUAAUC_x.pdb.gz
MCSYM-DB/2_4/UUAAUG/
MCSYM-DB/2_4/UUAAUG/2_4-UUAAUG.mcs
MCSYM-DB/2_4/UUACAA/
MCSYM-DB/2_4/UUACAA/2_4-UUACAA.mcs
MCSYM-DB/2_4/UUACAA/ds-2_4-UUACAA_x.pdb.gz
MCSYM-DB/2_4/UUACAC/
MCSYM-DB/2_4/UUACAC/2_4-UUACAC.mcs
MCSYM-DB/2_4/UUACAG/
MCSYM-DB/2_4/UUACAG/2_4-UUACAG.mcs
MCSYM-DB/2_4/UUACAU/
MCSYM-DB/2_4/UUACAU/2_4-UUACAU.mcs
MCSYM-DB/2_4/UUACCA/
MCSYM-DB/2_4/UUACCA/2_4-UUACCA.mcs
MCSYM-DB/2_4/UUACCA/ds-2_4-UUACCA_x.pdb.gz
MCSYM-DB/2_4/UUACCC/
MCSYM-DB/2_4/UUACCC/2_4-UUACCC.mcs
MCSYM-DB/2_4/UUACCC/ds-2_4-UUACCC_x.pdb.gz
MCSYM-DB/2_4/UUACCG/
MCSYM-DB/2_4/UUACCG/2_4-UUACCG.mcs
MCSYM-DB/2_4/UUACCG/ds-2_4-UUACCG_x.pdb.gz
MCSYM-DB/2_4/UUACCU/
MCSYM-DB/2_4/UUACCU/2_4-UUACCU.mcs
MCSYM-DB/2_4/UUACCU/ds-2_4-UUACCU_x.pdb.gz
MCSYM-DB/2_4/UUACGA/
MCSYM-DB/2_4/UUACGA/2_4-UUACGA.mcs
MCSYM-DB/2_4/UUACGA/ds-2_4-UUACGA_x.pdb.gz
MCSYM-DB/2_4/UUACGC/
MCSYM-DB/2_4/UUACGC/2_4-UUACGC.mcs
MCSYM-DB/2_4/UUACGG/
MCSYM-DB/2_4/UUACGG/2_4-UUACGG.mcs
MCSYM-DB/2_4/UUACGG/ds-2_4-UUACGG_x.pdb.gz
MCSYM-DB/2_4/UUACUA/
MCSYM-DB/2_4/UUACUA/2_4-UUACUA.mcs
MCSYM-DB/2_4/UUACUA/ds-2_4-UUACUA_x.pdb.gz
MCSYM-DB/2_4/UUACUC/
MCSYM-DB/2_4/UUACUC/2_4-UUACUC.mcs
MCSYM-DB/2_4/UUACUC/ds-2_4-UUACUC_x.pdb.gz
MCSYM-DB/2_4/UUACUG/
MCSYM-DB/2_4/UUACUG/2_4-UUACUG.mcs
MCSYM-DB/2_4/UUACUG/ds-2_4-UUACUG_x.pdb.gz
MCSYM-DB/2_4/UUACUU/
MCSYM-DB/2_4/UUACUU/2_4-UUACUU.mcs
MCSYM-DB/2_4/UUACUU/ds-2_4-UUACUU_x.pdb.gz
MCSYM-DB/2_4/UUAGAA/
MCSYM-DB/2_4/UUAGAA/2_4-UUAGAA.mcs
MCSYM-DB/2_4/UUAGAA/ds-2_4-UUAGAA_x.pdb.gz
MCSYM-DB/2_4/UUAGAU/
MCSYM-DB/2_4/UUAGAU/2_4-UUAGAU.mcs
MCSYM-DB/2_4/UUAGCA/
MCSYM-DB/2_4/UUAGCA/2_4-UUAGCA.mcs
MCSYM-DB/2_4/UUAGCA/ds-2_4-UUAGCA_x.pdb.gz
MCSYM-DB/2_4/UUAGCC/
MCSYM-DB/2_4/UUAGCC/2_4-UUAGCC.mcs
MCSYM-DB/2_4/UUAGCC/ds-2_4-UUAGCC_x.pdb.gz
MCSYM-DB/2_4/UUAGCU/
MCSYM-DB/2_4/UUAGCU/2_4-UUAGCU.mcs
MCSYM-DB/2_4/UUAGGA/
MCSYM-DB/2_4/UUAGGA/2_4-UUAGGA.mcs
MCSYM-DB/2_4/UUAGGA/ds-2_4-UUAGGA_x.pdb.gz
MCSYM-DB/2_4/UUAGGG/
MCSYM-DB/2_4/UUAGGG/2_4-UUAGGG.mcs
MCSYM-DB/2_4/UUAGGU/
MCSYM-DB/2_4/UUAGGU/2_4-UUAGGU.mcs
MCSYM-DB/2_4/UUAGGU/ds-2_4-UUAGGU_x.pdb.gz
MCSYM-DB/2_4/UUAGUA/
MCSYM-DB/2_4/UUAGUA/2_4-UUAGUA.mcs
MCSYM-DB/2_4/UUAGUA/ds-2_4-UUAGUA_x.pdb.gz
MCSYM-DB/2_4/UUAGUU/
MCSYM-DB/2_4/UUAGUU/2_4-UUAGUU.mcs
MCSYM-DB/2_4/UUAGUU/ds-2_4-UUAGUU_x.pdb.gz
MCSYM-DB/2_4/UUAUAA/
MCSYM-DB/2_4/UUAUAA/2_4-UUAUAA.mcs
MCSYM-DB/2_4/UUAUAA/ds-2_4-UUAUAA_x.pdb.gz
MCSYM-DB/2_4/UUAUAC/
MCSYM-DB/2_4/UUAUAC/2_4-UUAUAC.mcs
MCSYM-DB/2_4/UUAUAU/
MCSYM-DB/2_4/UUAUAU/2_4-UUAUAU.mcs
MCSYM-DB/2_4/UUAUAU/ds-2_4-UUAUAU_x.pdb.gz
MCSYM-DB/2_4/UUAUCA/
MCSYM-DB/2_4/UUAUCA/2_4-UUAUCA.mcs
MCSYM-DB/2_4/UUAUCA/ds-2_4-UUAUCA_x.pdb.gz
MCSYM-DB/2_4/UUAUCC/
MCSYM-DB/2_4/UUAUCC/2_4-UUAUCC.mcs
MCSYM-DB/2_4/UUAUCC/ds-2_4-UUAUCC_x.pdb.gz
MCSYM-DB/2_4/UUAUCG/
MCSYM-DB/2_4/UUAUCG/2_4-UUAUCG.mcs
MCSYM-DB/2_4/UUAUCG/ds-2_4-UUAUCG_x.pdb.gz
MCSYM-DB/2_4/UUAUCU/
MCSYM-DB/2_4/UUAUCU/2_4-UUAUCU.mcs
MCSYM-DB/2_4/UUAUCU/ds-2_4-UUAUCU_x.pdb.gz
MCSYM-DB/2_4/UUAUGA/
MCSYM-DB/2_4/UUAUGA/2_4-UUAUGA.mcs
MCSYM-DB/2_4/UUAUGA/ds-2_4-UUAUGA_x.pdb.gz
MCSYM-DB/2_4/UUAUGC/
MCSYM-DB/2_4/UUAUGC/2_4-UUAUGC.mcs
MCSYM-DB/2_4/UUAUGG/
MCSYM-DB/2_4/UUAUGG/2_4-UUAUGG.mcs
MCSYM-DB/2_4/UUAUGG/ds-2_4-UUAUGG_x.pdb.gz
MCSYM-DB/2_4/UUAUGU/
MCSYM-DB/2_4/UUAUGU/2_4-UUAUGU.mcs
MCSYM-DB/2_4/UUAUGU/ds-2_4-UUAUGU_x.pdb.gz
MCSYM-DB/2_4/UUAUUA/
MCSYM-DB/2_4/UUAUUA/2_4-UUAUUA.mcs
MCSYM-DB/2_4/UUAUUA/ds-2_4-UUAUUA_x.pdb.gz
MCSYM-DB/2_4/UUAUUC/
MCSYM-DB/2_4/UUAUUC/2_4-UUAUUC.mcs
MCSYM-DB/2_4/UUAUUC/ds-2_4-UUAUUC_x.pdb.gz
MCSYM-DB/2_4/UUAUUG/
MCSYM-DB/2_4/UUAUUG/2_4-UUAUUG.mcs
MCSYM-DB/2_4/UUAUUG/ds-2_4-UUAUUG_x.pdb.gz
MCSYM-DB/2_4/UUAUUU/
MCSYM-DB/2_4/UUAUUU/2_4-UUAUUU.mcs
MCSYM-DB/2_4/UUAUUU/ds-2_4-UUAUUU_x.pdb.gz
MCSYM-DB/2_4/UUCAAA/
MCSYM-DB/2_4/UUCAAA/2_4-UUCAAA.mcs
MCSYM-DB/2_4/UUCAAG/
MCSYM-DB/2_4/UUCAAG/2_4-UUCAAG.mcs
MCSYM-DB/2_4/UUCAAU/
MCSYM-DB/2_4/UUCAAU/2_4-UUCAAU.mcs
MCSYM-DB/2_4/UUCACA/
MCSYM-DB/2_4/UUCACA/2_4-UUCACA.mcs
MCSYM-DB/2_4/UUCACC/
MCSYM-DB/2_4/UUCACC/2_4-UUCACC.mcs
MCSYM-DB/2_4/UUCACC/ds-2_4-UUCACC_x.pdb.gz
MCSYM-DB/2_4/UUCACU/
MCSYM-DB/2_4/UUCACU/2_4-UUCACU.mcs
MCSYM-DB/2_4/UUCAUA/
MCSYM-DB/2_4/UUCAUA/2_4-UUCAUA.mcs
MCSYM-DB/2_4/UUCCAA/
MCSYM-DB/2_4/UUCCAA/2_4-UUCCAA.mcs
MCSYM-DB/2_4/UUCCAC/
MCSYM-DB/2_4/UUCCAC/2_4-UUCCAC.mcs
MCSYM-DB/2_4/UUCCCA/
MCSYM-DB/2_4/UUCCCA/2_4-UUCCCA.mcs
MCSYM-DB/2_4/UUCCCC/
MCSYM-DB/2_4/UUCCCC/2_4-UUCCCC.mcs
MCSYM-DB/2_4/UUCCCU/
MCSYM-DB/2_4/UUCCCU/2_4-UUCCCU.mcs
MCSYM-DB/2_4/UUCCUA/
MCSYM-DB/2_4/UUCCUA/2_4-UUCCUA.mcs
MCSYM-DB/2_4/UUCGCA/
MCSYM-DB/2_4/UUCGCA/2_4-UUCGCA.mcs
MCSYM-DB/2_4/UUCGGA/
MCSYM-DB/2_4/UUCGGA/2_4-UUCGGA.mcs
MCSYM-DB/2_4/UUCGGA/ds-2_4-UUCGGA_x.pdb.gz
MCSYM-DB/2_4/UUCGUA/
MCSYM-DB/2_4/UUCGUA/2_4-UUCGUA.mcs
MCSYM-DB/2_4/UUCGUC/
MCSYM-DB/2_4/UUCGUC/2_4-UUCGUC.mcs
MCSYM-DB/2_4/UUCUCA/
MCSYM-DB/2_4/UUCUCA/2_4-UUCUCA.mcs
MCSYM-DB/2_4/UUCUCU/
MCSYM-DB/2_4/UUCUCU/2_4-UUCUCU.mcs
MCSYM-DB/2_4/UUCUGA/
MCSYM-DB/2_4/UUCUGA/2_4-UUCUGA.mcs
MCSYM-DB/2_4/UUCUUA/
MCSYM-DB/2_4/UUCUUA/2_4-UUCUUA.mcs
MCSYM-DB/2_4/UUCUUA/ds-2_4-UUCUUA_x.pdb.gz
MCSYM-DB/2_4/UUCUUU/
MCSYM-DB/2_4/UUCUUU/2_4-UUCUUU.mcs
MCSYM-DB/2_4/UUGAAA/
MCSYM-DB/2_4/UUGAAA/2_4-UUGAAA.mcs
MCSYM-DB/2_4/UUGAAU/
MCSYM-DB/2_4/UUGAAU/2_4-UUGAAU.mcs
MCSYM-DB/2_4/UUGACA/
MCSYM-DB/2_4/UUGACA/2_4-UUGACA.mcs
MCSYM-DB/2_4/UUGACA/ds-2_4-UUGACA_x.pdb.gz
MCSYM-DB/2_4/UUGACC/
MCSYM-DB/2_4/UUGACC/2_4-UUGACC.mcs
MCSYM-DB/2_4/UUGACG/
MCSYM-DB/2_4/UUGACG/2_4-UUGACG.mcs
MCSYM-DB/2_4/UUGACG/ds-2_4-UUGACG_x.pdb.gz
MCSYM-DB/2_4/UUGACU/
MCSYM-DB/2_4/UUGACU/2_4-UUGACU.mcs
MCSYM-DB/2_4/UUGACU/ds-2_4-UUGACU_x.pdb.gz
MCSYM-DB/2_4/UUGAGA/
MCSYM-DB/2_4/UUGAGA/2_4-UUGAGA.mcs
MCSYM-DB/2_4/UUGAGG/
MCSYM-DB/2_4/UUGAGG/2_4-UUGAGG.mcs
MCSYM-DB/2_4/UUGAGU/
MCSYM-DB/2_4/UUGAGU/2_4-UUGAGU.mcs
MCSYM-DB/2_4/UUGAUA/
MCSYM-DB/2_4/UUGAUA/2_4-UUGAUA.mcs
MCSYM-DB/2_4/UUGAUA/ds-2_4-UUGAUA_x.pdb.gz
MCSYM-DB/2_4/UUGAUU/
MCSYM-DB/2_4/UUGAUU/2_4-UUGAUU.mcs
MCSYM-DB/2_4/UUGCAA/
MCSYM-DB/2_4/UUGCAA/2_4-UUGCAA.mcs
MCSYM-DB/2_4/UUGCAA/ds-2_4-UUGCAA_x.pdb.gz
MCSYM-DB/2_4/UUGCAG/
MCSYM-DB/2_4/UUGCAG/2_4-UUGCAG.mcs
MCSYM-DB/2_4/UUGCAG/ds-2_4-UUGCAG_x.pdb.gz
MCSYM-DB/2_4/UUGCAU/
MCSYM-DB/2_4/UUGCAU/2_4-UUGCAU.mcs
MCSYM-DB/2_4/UUGCAU/ds-2_4-UUGCAU_x.pdb.gz
MCSYM-DB/2_4/UUGCCA/
MCSYM-DB/2_4/UUGCCA/2_4-UUGCCA.mcs
MCSYM-DB/2_4/UUGCCA/ds-2_4-UUGCCA_x.pdb.gz
MCSYM-DB/2_4/UUGCCG/
MCSYM-DB/2_4/UUGCCG/2_4-UUGCCG.mcs
MCSYM-DB/2_4/UUGCCG/ds-2_4-UUGCCG_x.pdb.gz
MCSYM-DB/2_4/UUGCGA/
MCSYM-DB/2_4/UUGCGA/2_4-UUGCGA.mcs
MCSYM-DB/2_4/UUGCGU/
MCSYM-DB/2_4/UUGCGU/2_4-UUGCGU.mcs
MCSYM-DB/2_4/UUGCGU/ds-2_4-UUGCGU_x.pdb.gz
MCSYM-DB/2_4/UUGCUA/
MCSYM-DB/2_4/UUGCUA/2_4-UUGCUA.mcs
MCSYM-DB/2_4/UUGCUA/ds-2_4-UUGCUA_x.pdb.gz
MCSYM-DB/2_4/UUGCUG/
MCSYM-DB/2_4/UUGCUG/2_4-UUGCUG.mcs
MCSYM-DB/2_4/UUGCUG/ds-2_4-UUGCUG_x.pdb.gz
MCSYM-DB/2_4/UUGCUU/
MCSYM-DB/2_4/UUGCUU/2_4-UUGCUU.mcs
MCSYM-DB/2_4/UUGCUU/ds-2_4-UUGCUU_x.pdb.gz
MCSYM-DB/2_4/UUGGAA/
MCSYM-DB/2_4/UUGGAA/2_4-UUGGAA.mcs
MCSYM-DB/2_4/UUGGAG/
MCSYM-DB/2_4/UUGGAG/2_4-UUGGAG.mcs
MCSYM-DB/2_4/UUGGAG/ds-2_4-UUGGAG_x.pdb.gz
MCSYM-DB/2_4/UUGGCA/
MCSYM-DB/2_4/UUGGCA/2_4-UUGGCA.mcs
MCSYM-DB/2_4/UUGGGA/
MCSYM-DB/2_4/UUGGGA/2_4-UUGGGA.mcs
MCSYM-DB/2_4/UUGGGA/ds-2_4-UUGGGA_x.pdb.gz
MCSYM-DB/2_4/UUGGGG/
MCSYM-DB/2_4/UUGGGG/2_4-UUGGGG.mcs
MCSYM-DB/2_4/UUGGUA/
MCSYM-DB/2_4/UUGGUA/2_4-UUGGUA.mcs
MCSYM-DB/2_4/UUGGUA/ds-2_4-UUGGUA_x.pdb.gz
MCSYM-DB/2_4/UUGGUG/
MCSYM-DB/2_4/UUGGUG/2_4-UUGGUG.mcs
MCSYM-DB/2_4/UUGGUU/
MCSYM-DB/2_4/UUGGUU/2_4-UUGGUU.mcs
MCSYM-DB/2_4/UUGGUU/ds-2_4-UUGGUU_x.pdb.gz
MCSYM-DB/2_4/UUGUAA/
MCSYM-DB/2_4/UUGUAA/2_4-UUGUAA.mcs
MCSYM-DB/2_4/UUGUAG/
MCSYM-DB/2_4/UUGUAG/2_4-UUGUAG.mcs
MCSYM-DB/2_4/UUGUAU/
MCSYM-DB/2_4/UUGUAU/2_4-UUGUAU.mcs
MCSYM-DB/2_4/UUGUCA/
MCSYM-DB/2_4/UUGUCA/2_4-UUGUCA.mcs
MCSYM-DB/2_4/UUGUCA/ds-2_4-UUGUCA_x.pdb.gz
MCSYM-DB/2_4/UUGUCG/
MCSYM-DB/2_4/UUGUCG/2_4-UUGUCG.mcs
MCSYM-DB/2_4/UUGUCG/ds-2_4-UUGUCG_x.pdb.gz
MCSYM-DB/2_4/UUGUGA/
MCSYM-DB/2_4/UUGUGA/2_4-UUGUGA.mcs
MCSYM-DB/2_4/UUGUGC/
MCSYM-DB/2_4/UUGUGC/2_4-UUGUGC.mcs
MCSYM-DB/2_4/UUGUGC/ds-2_4-UUGUGC_x.pdb.gz
MCSYM-DB/2_4/UUGUUA/
MCSYM-DB/2_4/UUGUUA/2_4-UUGUUA.mcs
MCSYM-DB/2_4/UUGUUA/ds-2_4-UUGUUA_x.pdb.gz
MCSYM-DB/2_4/UUGUUC/
MCSYM-DB/2_4/UUGUUC/2_4-UUGUUC.mcs
MCSYM-DB/2_4/UUGUUG/
MCSYM-DB/2_4/UUGUUG/2_4-UUGUUG.mcs
MCSYM-DB/2_4/UUGUUG/ds-2_4-UUGUUG_x.pdb.gz
MCSYM-DB/2_4/UUGUUU/
MCSYM-DB/2_4/UUGUUU/2_4-UUGUUU.mcs
MCSYM-DB/2_4/UUGUUU/ds-2_4-UUGUUU_x.pdb.gz
MCSYM-DB/2_4/UUUAAA/
MCSYM-DB/2_4/UUUAAA/2_4-UUUAAA.mcs
MCSYM-DB/2_4/UUUAAC/
MCSYM-DB/2_4/UUUAAC/2_4-UUUAAC.mcs
MCSYM-DB/2_4/UUUAAU/
MCSYM-DB/2_4/UUUAAU/2_4-UUUAAU.mcs
MCSYM-DB/2_4/UUUACA/
MCSYM-DB/2_4/UUUACA/2_4-UUUACA.mcs
MCSYM-DB/2_4/UUUAGG/
MCSYM-DB/2_4/UUUAGG/2_4-UUUAGG.mcs
MCSYM-DB/2_4/UUUAUA/
MCSYM-DB/2_4/UUUAUA/2_4-UUUAUA.mcs
MCSYM-DB/2_4/UUUAUA/ds-2_4-UUUAUA_x.pdb.gz
MCSYM-DB/2_4/UUUAUG/
MCSYM-DB/2_4/UUUAUG/2_4-UUUAUG.mcs
MCSYM-DB/2_4/UUUCAA/
MCSYM-DB/2_4/UUUCAA/2_4-UUUCAA.mcs
MCSYM-DB/2_4/UUUCAA/ds-2_4-UUUCAA_x.pdb.gz
MCSYM-DB/2_4/UUUCAG/
MCSYM-DB/2_4/UUUCAG/2_4-UUUCAG.mcs
MCSYM-DB/2_4/UUUCAU/
MCSYM-DB/2_4/UUUCAU/2_4-UUUCAU.mcs
MCSYM-DB/2_4/UUUCCA/
MCSYM-DB/2_4/UUUCCA/2_4-UUUCCA.mcs
MCSYM-DB/2_4/UUUCCA/ds-2_4-UUUCCA_x.pdb.gz
MCSYM-DB/2_4/UUUCCC/
MCSYM-DB/2_4/UUUCCC/2_4-UUUCCC.mcs
MCSYM-DB/2_4/UUUCCC/ds-2_4-UUUCCC_x.pdb.gz
MCSYM-DB/2_4/UUUCCU/
MCSYM-DB/2_4/UUUCCU/2_4-UUUCCU.mcs
MCSYM-DB/2_4/UUUCGA/
MCSYM-DB/2_4/UUUCGA/2_4-UUUCGA.mcs
MCSYM-DB/2_4/UUUCUA/
MCSYM-DB/2_4/UUUCUA/2_4-UUUCUA.mcs
MCSYM-DB/2_4/UUUCUC/
MCSYM-DB/2_4/UUUCUC/2_4-UUUCUC.mcs
MCSYM-DB/2_4/UUUCUC/ds-2_4-UUUCUC_x.pdb.gz
MCSYM-DB/2_4/UUUCUU/
MCSYM-DB/2_4/UUUCUU/2_4-UUUCUU.mcs
MCSYM-DB/2_4/UUUCUU/ds-2_4-UUUCUU_x.pdb.gz
MCSYM-DB/2_4/UUUGAA/
MCSYM-DB/2_4/UUUGAA/2_4-UUUGAA.mcs
MCSYM-DB/2_4/UUUGAG/
MCSYM-DB/2_4/UUUGAG/2_4-UUUGAG.mcs
MCSYM-DB/2_4/UUUGAU/
MCSYM-DB/2_4/UUUGAU/2_4-UUUGAU.mcs
MCSYM-DB/2_4/UUUGCA/
MCSYM-DB/2_4/UUUGCA/2_4-UUUGCA.mcs
MCSYM-DB/2_4/UUUGCA/ds-2_4-UUUGCA_x.pdb.gz
MCSYM-DB/2_4/UUUGCC/
MCSYM-DB/2_4/UUUGCC/2_4-UUUGCC.mcs
MCSYM-DB/2_4/UUUGCG/
MCSYM-DB/2_4/UUUGCG/2_4-UUUGCG.mcs
MCSYM-DB/2_4/UUUGCG/ds-2_4-UUUGCG_x.pdb.gz
MCSYM-DB/2_4/UUUGGC/
MCSYM-DB/2_4/UUUGGC/2_4-UUUGGC.mcs
MCSYM-DB/2_4/UUUGGC/ds-2_4-UUUGGC_x.pdb.gz
MCSYM-DB/2_4/UUUGGG/
MCSYM-DB/2_4/UUUGGG/2_4-UUUGGG.mcs
MCSYM-DB/2_4/UUUGGG/ds-2_4-UUUGGG_x.pdb.gz
MCSYM-DB/2_4/UUUGUA/
MCSYM-DB/2_4/UUUGUA/2_4-UUUGUA.mcs
MCSYM-DB/2_4/UUUGUC/
MCSYM-DB/2_4/UUUGUC/2_4-UUUGUC.mcs
MCSYM-DB/2_4/UUUGUG/
MCSYM-DB/2_4/UUUGUG/2_4-UUUGUG.mcs
MCSYM-DB/2_4/UUUGUG/ds-2_4-UUUGUG_x.pdb.gz
MCSYM-DB/2_4/UUUGUU/
MCSYM-DB/2_4/UUUGUU/2_4-UUUGUU.mcs
MCSYM-DB/2_4/UUUUAA/
MCSYM-DB/2_4/UUUUAA/2_4-UUUUAA.mcs
MCSYM-DB/2_4/UUUUAC/
MCSYM-DB/2_4/UUUUAC/2_4-UUUUAC.mcs
MCSYM-DB/2_4/UUUUAG/
MCSYM-DB/2_4/UUUUAG/2_4-UUUUAG.mcs
MCSYM-DB/2_4/UUUUAU/
MCSYM-DB/2_4/UUUUAU/2_4-UUUUAU.mcs
MCSYM-DB/2_4/UUUUCA/
MCSYM-DB/2_4/UUUUCA/2_4-UUUUCA.mcs
MCSYM-DB/2_4/UUUUCC/
MCSYM-DB/2_4/UUUUCC/2_4-UUUUCC.mcs
MCSYM-DB/2_4/UUUUCC/ds-2_4-UUUUCC_x.pdb.gz
MCSYM-DB/2_4/UUUUCG/
MCSYM-DB/2_4/UUUUCG/2_4-UUUUCG.mcs
MCSYM-DB/2_4/UUUUCG/ds-2_4-UUUUCG_x.pdb.gz
MCSYM-DB/2_4/UUUUCU/
MCSYM-DB/2_4/UUUUCU/2_4-UUUUCU.mcs
MCSYM-DB/2_4/UUUUCU/ds-2_4-UUUUCU_x.pdb.gz
MCSYM-DB/2_4/UUUUGA/
MCSYM-DB/2_4/UUUUGA/2_4-UUUUGA.mcs
MCSYM-DB/2_4/UUUUGC/
MCSYM-DB/2_4/UUUUGC/2_4-UUUUGC.mcs
MCSYM-DB/2_4/UUUUUA/
MCSYM-DB/2_4/UUUUUA/2_4-UUUUUA.mcs
MCSYM-DB/2_4/UUUUUA/ds-2_4-UUUUUA_x.pdb.gz
MCSYM-DB/2_4/UUUUUC/
MCSYM-DB/2_4/UUUUUC/2_4-UUUUUC.mcs
MCSYM-DB/2_4/UUUUUG/
MCSYM-DB/2_4/UUUUUG/2_4-UUUUUG.mcs
MCSYM-DB/2_4/UUUUUG/ds-2_4-UUUUUG_x.pdb.gz
MCSYM-DB/2_4/UUUUUU/
MCSYM-DB/2_4/UUUUUU/2_4-UUUUUU.mcs
MCSYM-DB/2_4/UUUUUU/ds-2_4-UUUUUU_x.pdb.gz
MCSYM-DB/2_4_/
MCSYM-DB/2_4_/CAUCGG/
MCSYM-DB/2_4_/CAUCGG/2_4_-CAUCGG.mcs
MCSYM-DB/2_4_/CAUCGG/ds-2_4_-CAUCGG_x.pdb.gz
MCSYM-DB/2_5/
MCSYM-DB/2_5/AAGAGAA/
MCSYM-DB/2_5/AAGAGAA/2_5-AAGAGAA.mcs
MCSYM-DB/2_5/AAGAGAA/ds-2_5-AAGAGAA_x.pdb.gz
MCSYM-DB/2_5/AAGGUCG/
MCSYM-DB/2_5/AAGGUCG/2_5-AAGGUCG.mcs
MCSYM-DB/2_5/AAGGUCG/ds-2_5-AAGGUCG_x.pdb.gz
MCSYM-DB/2_5/AAUCAAU/
MCSYM-DB/2_5/AAUCAAU/2_5-AAUCAAU.mcs
MCSYM-DB/2_5/AAUCAAU/ds-2_5-AAUCAAU_x.pdb.gz
MCSYM-DB/2_5/AAUCUCU/
MCSYM-DB/2_5/AAUCUCU/2_5-AAUCUCU.mcs
MCSYM-DB/2_5/AAUCUCU/ds-2_5-AAUCUCU_x.pdb.gz
MCSYM-DB/2_5/AAUGGUU/
MCSYM-DB/2_5/AAUGGUU/2_5-AAUGGUU.mcs
MCSYM-DB/2_5/AAUGGUU/ds-2_5-AAUGGUU_x.pdb.gz
MCSYM-DB/2_5/AAUGUAG/
MCSYM-DB/2_5/AAUGUAG/2_5-AAUGUAG.mcs
MCSYM-DB/2_5/AAUGUAG/ds-2_5-AAUGUAG_x.pdb.gz
MCSYM-DB/2_5/AAUUGUU/
MCSYM-DB/2_5/AAUUGUU/2_5-AAUUGUU.mcs
MCSYM-DB/2_5/AAUUGUU/ds-2_5-AAUUGUU_x.pdb.gz
MCSYM-DB/2_5/ACGAUAU/
MCSYM-DB/2_5/ACGAUAU/1U3K_model_1.pdb.gz
MCSYM-DB/2_5/ACGAUAU/2_5-ACGAUAU.mcs
MCSYM-DB/2_5/ACGGUAA/
MCSYM-DB/2_5/ACGGUAA/ds-2_5-ACGGUAA_x.pdb.gz
MCSYM-DB/2_5/AGAAUGU/
MCSYM-DB/2_5/AGAAUGU/2_5-AGAAUGU.mcs
MCSYM-DB/2_5/AGAAUGU/ds-2_5-AGAAUGU_x.pdb.gz
MCSYM-DB/2_5/AGCAAAC/
MCSYM-DB/2_5/AGCAAAC/2_5-AGCAAAC.mcs
MCSYM-DB/2_5/AGCAAAC/ds-2_5-AGCAAAC.pdb.gz
MCSYM-DB/2_5/AGCAAAC/ds-2_5-AGCAAAC_x.pdb.gz
MCSYM-DB/2_5/AGCACCA/
MCSYM-DB/2_5/AGCACCA/2_5-AGCACCA.mcs
MCSYM-DB/2_5/AGCACCA/ds-2_5-AGCACCA_x.pdb.gz
MCSYM-DB/2_5/AGCAGAG/
MCSYM-DB/2_5/AGCAGAG/2_5-AGCAGAG.mcs
MCSYM-DB/2_5/AGCAGAG/ds-2_5-AGCAGAG_x.pdb.gz
MCSYM-DB/2_5/AGCAUCA/
MCSYM-DB/2_5/AGCAUCA/2_5-AGCAUCA.mcs
MCSYM-DB/2_5/AGCAUCA/ds-2_5-AGCAUCA_x.pdb.gz
MCSYM-DB/2_5/AGCUUAU/
MCSYM-DB/2_5/AGCUUAU/2_5-AGCUUAU.mcs
MCSYM-DB/2_5/AGCUUAU/ds-2_5-AGCUUAU_x.pdb.gz
MCSYM-DB/2_5/AGCUUUU/
MCSYM-DB/2_5/AGCUUUU/2_5-AGCUUUU.mcs
MCSYM-DB/2_5/AGCUUUU/ds-2_5-AGCUUUU_x.pdb.gz
MCSYM-DB/2_5/AUAAACG/
MCSYM-DB/2_5/AUAAACG/2_5-AUAAACG.mcs
MCSYM-DB/2_5/AUAAACG/ds-2_5-AUAAACG_x.pdb.gz
MCSYM-DB/2_5/AUAAGUU/
MCSYM-DB/2_5/AUAAGUU/2_5-AUAAGUU.mcs
MCSYM-DB/2_5/AUAAGUU/ds-2_5-AUAAGUU_x.pdb.gz
MCSYM-DB/2_5/AUAAUGU/
MCSYM-DB/2_5/AUAAUGU/2_5-AUAAUGU.mcs
MCSYM-DB/2_5/AUAAUGU/ds-2_5-AUAAUGU_x.pdb.gz
MCSYM-DB/2_5/AUACCCU/
MCSYM-DB/2_5/AUACCCU/2_5-AUACCCU.mcs
MCSYM-DB/2_5/AUACCCU/ds-2_5-AUACCCU_x.pdb.gz
MCSYM-DB/2_5/AUAGAUG/
MCSYM-DB/2_5/AUAGAUG/2_5-AUAGAUG.mcs
MCSYM-DB/2_5/AUAGAUG/ds-2_5-AUAGAUG_x.pdb.gz
MCSYM-DB/2_5/AUAUUUU/
MCSYM-DB/2_5/AUAUUUU/2_5-AUAUUUU.mcs
MCSYM-DB/2_5/AUAUUUU/ds-2_5-AUAUUUU_x.pdb.gz
MCSYM-DB/2_5/AUUCUUU/
MCSYM-DB/2_5/AUUCUUU/2_5-AUUCUUU.mcs
MCSYM-DB/2_5/AUUCUUU/ds-2_5-AUUCUUU_x.pdb.gz
MCSYM-DB/2_5/CAAAACG/
MCSYM-DB/2_5/CAAAACG/2_5-CAAAACG.mcs
MCSYM-DB/2_5/CAAAACG/ds-2_5-CAAAACG_x.pdb.gz
MCSYM-DB/2_5/CAAAGAG/
MCSYM-DB/2_5/CAAAGAG/2_5-CAAAGAG.mcs
MCSYM-DB/2_5/CAAAGAG/ds-2_5-CAAAGAG_x.pdb.gz
MCSYM-DB/2_5/CAUAACG/
MCSYM-DB/2_5/CAUAACG/2_5-CAUAACG.mcs
MCSYM-DB/2_5/CAUAACG/ds-2_5-CAUAACG_x.pdb.gz
MCSYM-DB/2_5/CAUAGAG/
MCSYM-DB/2_5/CAUAGAG/2_5-CAUAGAG.mcs
MCSYM-DB/2_5/CAUAGAG/ds-2_5-CAUAGAG_x.pdb.gz
MCSYM-DB/2_5/CAUAUAC/
MCSYM-DB/2_5/CAUAUAC/2_5-CAUAUAC.mcs
MCSYM-DB/2_5/CAUAUAC/ds-2_5-CAUAUAC_x.pdb.gz
MCSYM-DB/2_5/CCCAUAG/
MCSYM-DB/2_5/CCCAUAG/2_5-CCCAUAG.mcs
MCSYM-DB/2_5/CCCAUAG/ds-2_5-CCCAUAG_x.pdb.gz
MCSYM-DB/2_5/CCCAUUG/
MCSYM-DB/2_5/CCCAUUG/2_5-CCCAUUG.mcs
MCSYM-DB/2_5/CCCAUUG/ds-2_5-CCCAUUG_x.pdb.gz
MCSYM-DB/2_5/CCGAACG/
MCSYM-DB/2_5/CCGAACG/2_5-CCGAACG.mcs
MCSYM-DB/2_5/CCGAACG/ds-2_5-CCGAACG_x.pdb.gz
MCSYM-DB/2_5/CCGAAUG/
MCSYM-DB/2_5/CCGAAUG/ds-2_5-CCGAAUG_x.pdb.gz
MCSYM-DB/2_5/CCGUGAG/
MCSYM-DB/2_5/CCGUGAG/2_5-CCGUGAG.mcs
MCSYM-DB/2_5/CCGUGAG/ds-2_5-CCGUGAG_x.pdb.gz
MCSYM-DB/2_5/CGCCAAG/
MCSYM-DB/2_5/CGCCAAG/2_5-CGCCAAG.mcs
MCSYM-DB/2_5/CGCCAAG/ds-2_5-CGCCAAG_x.pdb.gz
MCSYM-DB/2_5/CUAAAAA/
MCSYM-DB/2_5/CUAAAAA/2_5-CUAAAAA.mcs
MCSYM-DB/2_5/CUAAAAA/ds-2_5-CUAAAAA_x.pdb.gz
MCSYM-DB/2_5/CUAAAAG/
MCSYM-DB/2_5/CUAAAAG/2_5-CUAAAAG.mcs
MCSYM-DB/2_5/CUAAAAG/ds-2_5-CUAAAAG_x.pdb.gz
MCSYM-DB/2_5/CUAAAUG/
MCSYM-DB/2_5/CUAAAUG/2_5-CUAAAUG.mcs
MCSYM-DB/2_5/CUAAAUG/ds-2_5-CUAAAUG_x.pdb.gz
MCSYM-DB/2_5/CUAAUUG/
MCSYM-DB/2_5/CUAAUUG/2_5-CUAAUUG.mcs
MCSYM-DB/2_5/CUAAUUG/ds-2_5-CUAAUUG_x.pdb.gz
MCSYM-DB/2_5/CUAUCUG/
MCSYM-DB/2_5/CUAUCUG/2_5-CUAUCUG.mcs
MCSYM-DB/2_5/CUAUCUG/ds-2_5-CUAUCUG_x.pdb.gz
MCSYM-DB/2_5/CUGAACG/
MCSYM-DB/2_5/CUGAACG/2_5-CUGAACG.mcs
MCSYM-DB/2_5/CUGAACG/ds-2_5-CUGAACG_x.pdb.gz
MCSYM-DB/2_5/CUGCUCG/
MCSYM-DB/2_5/CUGCUCG/2_5-CUGCUCG.mcs
MCSYM-DB/2_5/CUGCUCG/ds-2_5-CUGCUCG_x.pdb.gz
MCSYM-DB/2_5/GAAACAA/
MCSYM-DB/2_5/GAAACAA/2_5-GAAACAA.mcs
MCSYM-DB/2_5/GAAACAA/ds-2_5-GAAACAA_x.pdb.gz
MCSYM-DB/2_5/GAUAUAC/
MCSYM-DB/2_5/GAUAUAC/2_5-GAUAUAC.mcs
MCSYM-DB/2_5/GAUAUAC/ds-2_5-GAUAUAC_x.pdb.gz
MCSYM-DB/2_5/GAUAUGC/
MCSYM-DB/2_5/GAUAUGC/2_5-GAUAUGC.mcs
MCSYM-DB/2_5/GAUAUGC/ds-2_5-GAUAUGC_x.pdb.gz
MCSYM-DB/2_5/GAUCUCC/
MCSYM-DB/2_5/GAUCUCC/2_5-GAUCUCC.mcs
MCSYM-DB/2_5/GAUCUCC/ds-2_5-GAUCUCC_x.pdb.gz
MCSYM-DB/2_5/GAUCUGC/
MCSYM-DB/2_5/GAUCUGC/2_5-GAUCUGC.mcs
MCSYM-DB/2_5/GAUCUGC/ds-2_5-GAUCUGC_x.pdb.gz
MCSYM-DB/2_5/GAUGUGU/
MCSYM-DB/2_5/GAUGUGU/2_5-GAUGUGU.mcs
MCSYM-DB/2_5/GAUGUGU/ds-2_5-GAUGUGU_x.pdb.gz
MCSYM-DB/2_5/GAUUCAC/
MCSYM-DB/2_5/GAUUCAC/2_5-GAUUCAC.mcs
MCSYM-DB/2_5/GAUUCAC/ds-2_5-GAUUCAC_x.pdb.gz
MCSYM-DB/2_5/GCGAUUU/
MCSYM-DB/2_5/GCGAUUU/2_5-GCGAUUU.mcs
MCSYM-DB/2_5/GCGAUUU/ds-2_5-GCGAUUU_x.pdb.gz
MCSYM-DB/2_5/GCGCUAU/
MCSYM-DB/2_5/GCGCUAU/2_5-GCGCUAU.mcs
MCSYM-DB/2_5/GCGCUAU/ds-2_5-GCGCUAU_x.pdb.gz
MCSYM-DB/2_5/GCGCUUC/
MCSYM-DB/2_5/GCGCUUC/2_5-GCGCUUC.mcs
MCSYM-DB/2_5/GCGCUUC/ds-2_5-GCGCUUC_x.pdb.gz
MCSYM-DB/2_5/GGCGUGU/
MCSYM-DB/2_5/GGCGUGU/2_5-GGCGUGU.mcs
MCSYM-DB/2_5/GGCGUGU/ds-2_5-GGCGUGU_x.pdb.gz
MCSYM-DB/2_5/GGUGAUA/
MCSYM-DB/2_5/GGUGAUA/2_5-GGUGAUA.mcs
MCSYM-DB/2_5/GGUGAUA/ds-2_5-GGUGAUA_x.pdb.gz
MCSYM-DB/2_5/GUAAAAA/
MCSYM-DB/2_5/GUAAAAA/2_5-GUAAAAA.mcs
MCSYM-DB/2_5/GUAAAAA/ds-2_5-GUAAAAA_x.pdb.gz
MCSYM-DB/2_5/GUAGUGC/
MCSYM-DB/2_5/GUAGUGC/2_5-GUAGUGC.mcs
MCSYM-DB/2_5/GUAGUGC/ds-2_5-GUAGUGC_x.pdb.gz
MCSYM-DB/2_5/GUAGUUC/
MCSYM-DB/2_5/GUAGUUC/2_5-GUAGUUC.mcs
MCSYM-DB/2_5/GUAGUUC/ds-2_5-GUAGUUC_x.pdb.gz
MCSYM-DB/2_5/UAUACCA/
MCSYM-DB/2_5/UAUACCA/2_5-UAUACCA.mcs
MCSYM-DB/2_5/UAUACCA/ds-2_5-UAUACCA_x.pdb.gz
MCSYM-DB/2_5/UAUAGCA/
MCSYM-DB/2_5/UAUAGCA/2_5-UAUAGCA.mcs
MCSYM-DB/2_5/UAUAGCA/ds-2_5-UAUAGCA_x.pdb.gz
MCSYM-DB/2_5/UAUUACA/
MCSYM-DB/2_5/UAUUACA/2_5-UAUUACA.mcs
MCSYM-DB/2_5/UAUUACA/ds-2_5-UAUUACA_x.pdb.gz
MCSYM-DB/2_5/UAUUCCU/
MCSYM-DB/2_5/UAUUCCU/2_5-UAUUCCU.mcs
MCSYM-DB/2_5/UAUUCCU/ds-2_5-UAUUCCU_x.pdb.gz
MCSYM-DB/2_5/UAUUUGG/
MCSYM-DB/2_5/UAUUUGG/2_5-UAUUUGG.mcs
MCSYM-DB/2_5/UAUUUGG/ds-2_5-UAUUUGG_x.pdb.gz
MCSYM-DB/2_5/UCAAAAA/
MCSYM-DB/2_5/UCAAAAA/2_5-UCAAAAA.mcs
MCSYM-DB/2_5/UCAAAAA/ds-2_5-UCAAAAA_x.pdb.gz
MCSYM-DB/2_5/UCCCCAA/
MCSYM-DB/2_5/UCCCCAA/ds-2_5-UCCCCAA_x.pdb.gz
MCSYM-DB/2_5/UCGCUUA/
MCSYM-DB/2_5/UCGCUUA/2_5-UCGCUUA.mcs
MCSYM-DB/2_5/UCGCUUA/ds-2_5-UCGCUUA_x.pdb.gz
MCSYM-DB/2_5/UCGGGAA/
MCSYM-DB/2_5/UCGGGAA/1Z2J_model_1.pdb.gz
MCSYM-DB/2_5/UCGGGAA/1ZC5_model_1.pdb.gz
MCSYM-DB/2_5/UCGGGAA/2_5-UCGGGAA.mcs
MCSYM-DB/2_5/UCGGGAA/ds-2_5-UCGGGAA_x.pdb.gz
MCSYM-DB/2_5/UCGGGCA/
MCSYM-DB/2_5/UCGGGCA/2_5-UCGGGCA.mcs
MCSYM-DB/2_5/UCGGGCA/ds-2_5-UCGGGCA_x.pdb.gz
MCSYM-DB/2_5/UCGUCUA/
MCSYM-DB/2_5/UCGUCUA/2_5-UCGUCUA.mcs
MCSYM-DB/2_5/UCGUCUA/ds-2_5-UCGUCUA_x.pdb.gz
MCSYM-DB/2_5/UCGUUUG/
MCSYM-DB/2_5/UCGUUUG/2_5-UCGUUUG.mcs
MCSYM-DB/2_5/UCGUUUG/ds-2_5-UCGUUUG_x.pdb.gz
MCSYM-DB/2_5/UGCCGGA/
MCSYM-DB/2_5/UGCCGGA/2_5-UGCCGGA.mcs
MCSYM-DB/2_5/UGCCGGA/ds-2_5-UGCCGGA_x.pdb.gz
MCSYM-DB/2_5/UGCGGCG/
MCSYM-DB/2_5/UGCGGCG/2_5-UGCGGCG.mcs
MCSYM-DB/2_5/UGCGGCG/ds-2_5-UGCGGCG_x.pdb.gz
MCSYM-DB/2_5/UGCUUGA/
MCSYM-DB/2_5/UGCUUGA/2_5-UGCUUGA.mcs
MCSYM-DB/2_5/UGCUUGA/ds-2_5-UGCUUGA_x.pdb.gz
MCSYM-DB/2_5/UGCUUUG/
MCSYM-DB/2_5/UGCUUUG/2_5-UGCUUUG.mcs
MCSYM-DB/2_5/UGCUUUG/ds-2_5-UGCUUUG_x.pdb.gz
MCSYM-DB/2_5/UGUAGUA/
MCSYM-DB/2_5/UGUAGUA/2_5-UGUAGUA.mcs
MCSYM-DB/2_5/UGUAGUA/ds-2_5-UGUAGUA_x.pdb.gz
MCSYM-DB/2_5/UGUUCUG/
MCSYM-DB/2_5/UGUUCUG/2_5-UGUUCUG.mcs
MCSYM-DB/2_5/UGUUCUG/ds-2_5-UGUUCUG_x.pdb.gz
MCSYM-DB/2_5/UUAAGGA/
MCSYM-DB/2_5/UUAAGGA/2_5-UUAAGGA.mcs
MCSYM-DB/2_5/UUAAGGA/ds-2_5-UUAAGGA_x.pdb.gz
MCSYM-DB/2_5/UUAAUAA/
MCSYM-DB/2_5/UUAAUAA/2_5-UUAAUAA.mcs
MCSYM-DB/2_5/UUAAUAA/ds-2_5-UUAAUAA_x.pdb.gz
MCSYM-DB/2_5/UUACAUG/
MCSYM-DB/2_5/UUACAUG/2_5-UUACAUG.mcs
MCSYM-DB/2_5/UUACAUG/ds-2_5-UUACAUG_x.pdb.gz
MCSYM-DB/2_5/UUACUCA/
MCSYM-DB/2_5/UUACUCA/2_5-UUACUCA.mcs
MCSYM-DB/2_5/UUACUCA/ds-2_5-UUACUCA_x.pdb.gz
MCSYM-DB/2_5/UUAGAUG/
MCSYM-DB/2_5/UUAGAUG/2_5-UUAGAUG.mcs
MCSYM-DB/2_5/UUAGAUG/ds-2_5-UUAGAUG_x.pdb.gz
MCSYM-DB/2_5/UUAGGAA/
MCSYM-DB/2_5/UUAGGAA/2_5-UUAGGAA.mcs
MCSYM-DB/2_5/UUAGGAA/ds-2_5-UUAGGAA_x.pdb.gz
MCSYM-DB/2_5/UUAGGGA/
MCSYM-DB/2_5/UUAGGGA/2_5-UUAGGGA.mcs
MCSYM-DB/2_5/UUAGGGA/ds-2_5-UUAGGGA_x.pdb.gz
MCSYM-DB/2_5/UUAGUUA/
MCSYM-DB/2_5/UUAGUUA/2_5-UUAGUUA.mcs
MCSYM-DB/2_5/UUAGUUA/ds-2_5-UUAGUUA_x.pdb.gz
MCSYM-DB/2_5/UUAUAUA/
MCSYM-DB/2_5/UUAUAUA/2_5-UUAUAUA.mcs
MCSYM-DB/2_5/UUAUAUA/ds-2_5-UUAUAUA_x.pdb.gz
MCSYM-DB/2_5/UUAUGAA/
MCSYM-DB/2_5/UUAUGAA/2_5-UUAUGAA.mcs
MCSYM-DB/2_5/UUAUGAA/ds-2_5-UUAUGAA_x.pdb.gz
MCSYM-DB/2_5/UUAUUCA/
MCSYM-DB/2_5/UUAUUCA/2_5-UUAUUCA.mcs
MCSYM-DB/2_5/UUAUUCA/ds-2_5-UUAUUCA_x.pdb.gz
MCSYM-DB/2_5/UUCGGAA/
MCSYM-DB/2_5/UUCGGAA/2_5-UUCGGAA.mcs
MCSYM-DB/2_5/UUCGGAA/ds-2_5-UUCGGAA_x.pdb.gz
MCSYM-DB/2_5/UUGGGGA/
MCSYM-DB/2_5/UUGGGGA/2_5-UUGGGGA.mcs
MCSYM-DB/2_5/UUGGGGA/ds-2_5-UUGGGGA_x.pdb.gz
MCSYM-DB/2_5/UUGUAUU/
MCSYM-DB/2_5/UUGUAUU/2_5-UUGUAUU.mcs
MCSYM-DB/2_5/UUGUAUU/ds-2_5-UUGUAUU_x.pdb.gz
MCSYM-DB/2_5/UUGUGUA/
MCSYM-DB/2_5/UUGUGUA/2_5-UUGUGUA.mcs
MCSYM-DB/2_5/UUGUGUA/ds-2_5-UUGUGUA_x.pdb.gz
MCSYM-DB/2_5/UUUGCUG/
MCSYM-DB/2_5/UUUGCUG/2_5-UUUGCUG.mcs
MCSYM-DB/2_5/UUUGCUG/ds-2_5-UUUGCUG_x.pdb.gz
MCSYM-DB/2_5/UUUUUUU/
MCSYM-DB/2_5/UUUUUUU/2_5-UUUUUUU.mcs
MCSYM-DB/2_5/UUUUUUU/ds-2_5-UUUUUUU_x.pdb.gz
MCSYM-DB/2__2/
MCSYM-DB/2__2/AAUU/
MCSYM-DB/3/
MCSYM-DB/3/AAC/
MCSYM-DB/3/AAC/3-AAC.mcs
MCSYM-DB/3/AAC/ss-3-AAC_x.pdb.gz
MCSYM-DB/3/AAU/
MCSYM-DB/3/AAU/3-AAU.mcs
MCSYM-DB/3/AAU/ss-3-AAU_x.pdb.gz
MCSYM-DB/3/AAUU/
MCSYM-DB/3/AAUU/3-AAUU.mcs
MCSYM-DB/3/AAUU/ss-3-AAUU_x.pdb.gz
MCSYM-DB/3/AGC/
MCSYM-DB/3/AGC/3-AGC.mcs
MCSYM-DB/3/AGC/ss-3-AGC_x.pdb.gz
MCSYM-DB/3/AUA/
MCSYM-DB/3/AUA/3-AUA.mcs
MCSYM-DB/3/AUA/ss-3-AUA_x.pdb.gz
MCSYM-DB/3/AUC/
MCSYM-DB/3/AUC/3-AUC.mcs
MCSYM-DB/3/AUC/ss-3-AUC_x.pdb.gz
MCSYM-DB/3/CAG/
MCSYM-DB/3/CAG/3-CAG.mcs
MCSYM-DB/3/CAG/ss-3-CAG_x.pdb.gz
MCSYM-DB/3/CCC/
MCSYM-DB/3/CCC/3-CCC.mcs
MCSYM-DB/3/CCC/ss-3-CCC_x.pdb.gz
MCSYM-DB/3/CCG/
MCSYM-DB/3/CCG/3-CCG.mcs
MCSYM-DB/3/CCG/ss-3-CCG_x.pdb.gz
MCSYM-DB/3/CGA/
MCSYM-DB/3/CGA/3-CGA.mcs
MCSYM-DB/3/CGA/ss-3-CGA_x.pdb.gz
MCSYM-DB/3/CGC/
MCSYM-DB/3/CGC/3-CGC.mcs
MCSYM-DB/3/CGC/ss-3-CGC_x.pdb.gz
MCSYM-DB/3/CGG/
MCSYM-DB/3/CGG/3-CGG.mcs
MCSYM-DB/3/CGG/ss-3-CGG_x.pdb.gz
MCSYM-DB/3/CUG/
MCSYM-DB/3/CUG/3-CUG.mcs
MCSYM-DB/3/CUG/ss-3-CUG_x.pdb.gz
MCSYM-DB/3/GAA/
MCSYM-DB/3/GAA/3-GAA.mcs
MCSYM-DB/3/GAA/ss-3-GAA_x.pdb.gz
MCSYM-DB/3/GCC/
MCSYM-DB/3/GCC/3-GCC.mcs
MCSYM-DB/3/GCC/ss-3-GCC_x.pdb.gz
MCSYM-DB/3/GCG/
MCSYM-DB/3/GCG/3-GCG.mcs
MCSYM-DB/3/GCG/ss-3-GCG_x.pdb.gz
MCSYM-DB/3/GGA/
MCSYM-DB/3/GGA/1BN0_model_1.pdb.gz
MCSYM-DB/3/GGA/1MY9_model_1.pdb.gz
MCSYM-DB/3/GGA/1U6P_model_1.pdb.gz
MCSYM-DB/3/GGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3/GGA/3-GGA.mcs
MCSYM-DB/3/GGA/ss-3-GGA_x.pdb.gz
MCSYM-DB/3/GGC/
MCSYM-DB/3/GGC/3-GGC.mcs
MCSYM-DB/3/GGC/ss-3-GGC_x.pdb.gz
MCSYM-DB/3/GUC/
MCSYM-DB/3/GUC/3-GUC.mcs
MCSYM-DB/3/GUC/ss-3-GUC_x.pdb.gz
MCSYM-DB/3/UAG/
MCSYM-DB/3/UAG/3-UAG.mcs
MCSYM-DB/3/UAG/ss-3-UAG_x.pdb.gz
MCSYM-DB/3/UCA/
MCSYM-DB/3/UCA/3-UCA.mcs
MCSYM-DB/3/UCA/ss-3-UCA_x.pdb.gz
MCSYM-DB/3/UCC/
MCSYM-DB/3/UCC/3-UCC.mcs
MCSYM-DB/3/UCC/ss-3-UCC_x.pdb.gz
MCSYM-DB/3/UCG/
MCSYM-DB/3/UCG/3-UCG.mcs
MCSYM-DB/3/UCG/ss-3-UCG_x.pdb.gz
MCSYM-DB/3/UCU/
MCSYM-DB/3/UCU/3-UCU.mcs
MCSYM-DB/3/UCU/ss-3-UCU_x.pdb.gz
MCSYM-DB/3/UGA/
MCSYM-DB/3/UGA/3-UGA.mcs
MCSYM-DB/3/UGA/ss-3-UGA_x.pdb.gz
MCSYM-DB/3/UGG/
MCSYM-DB/3/UGG/3-UGG.mcs
MCSYM-DB/3/UGG/ss-3-UGG_x.pdb.gz
MCSYM-DB/3/UUC/
MCSYM-DB/3/UUC/3-UUC.mcs
MCSYM-DB/3/UUC/ss-3-UUC_x.pdb.gz
MCSYM-DB/3_2/
MCSYM-DB/3_2/AAAAA/
MCSYM-DB/3_2/AAAAA/2AU4_model_1.pdb.gz
MCSYM-DB/3_2/AAAAA/3_2-AAAAA.mcs
MCSYM-DB/3_2/AAAAA/ds-3_2-AAAAA_x.pdb.gz
MCSYM-DB/3_2/AAAAC/
MCSYM-DB/3_2/AAAAC/3_2-AAAAC.mcs
MCSYM-DB/3_2/AAAAC/ds-3_2-AAAAC_x.pdb.gz
MCSYM-DB/3_2/AAAAG/
MCSYM-DB/3_2/AAAAG/3_2-AAAAG.mcs
MCSYM-DB/3_2/AAAAG/ds-3_2-AAAAG_x.pdb.gz
MCSYM-DB/3_2/AAAAU/
MCSYM-DB/3_2/AAAAU/1L1C_model_1.pdb.gz
MCSYM-DB/3_2/AAAAU/3_2-AAAAU.mcs
MCSYM-DB/3_2/AAAAU/ds-3_2-AAAAU_x.pdb.gz
MCSYM-DB/3_2/AAACA/
MCSYM-DB/3_2/AAACA/3_2-AAACA.mcs
MCSYM-DB/3_2/AAACA/ds-3_2-AAACA_x.pdb.gz
MCSYM-DB/3_2/AAACC/
MCSYM-DB/3_2/AAACC/1L2X_model_1.pdb.gz
MCSYM-DB/3_2/AAACC/2A43_model_1.pdb.gz
MCSYM-DB/3_2/AAACC/3_2-AAACC.mcs
MCSYM-DB/3_2/AAACC/ds-3_2-AAACC_x.pdb.gz
MCSYM-DB/3_2/AAACG/
MCSYM-DB/3_2/AAACG/3_2-AAACG.mcs
MCSYM-DB/3_2/AAACG/ds-3_2-AAACG_x.pdb.gz
MCSYM-DB/3_2/AAACU/
MCSYM-DB/3_2/AAACU/2FQN_model_1.pdb.gz
MCSYM-DB/3_2/AAACU/3_2-AAACU.mcs
MCSYM-DB/3_2/AAACU/ds-3_2-AAACU_x.pdb.gz
MCSYM-DB/3_2/AAAGA/
MCSYM-DB/3_2/AAAGA/1ULL_model_1.pdb.gz
MCSYM-DB/3_2/AAAGA/3_2-AAAGA.mcs
MCSYM-DB/3_2/AAAGA/ds-3_2-AAAGA_x.pdb.gz
MCSYM-DB/3_2/AAAGC/
MCSYM-DB/3_2/AAAGC/3_2-AAAGC.mcs
MCSYM-DB/3_2/AAAGC/ds-3_2-AAAGC_x.pdb.gz
MCSYM-DB/3_2/AAAGG/
MCSYM-DB/3_2/AAAGG/3_2-AAAGG.mcs
MCSYM-DB/3_2/AAAGG/ds-3_2-AAAGG_x.pdb.gz
MCSYM-DB/3_2/AAAGU/
MCSYM-DB/3_2/AAAGU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AAAGU/3_2-AAAGU.mcs
MCSYM-DB/3_2/AAAGU/ds-3_2-AAAGU_x.pdb.gz
MCSYM-DB/3_2/AAAUA/
MCSYM-DB/3_2/AAAUA/3_2-AAAUA.mcs
MCSYM-DB/3_2/AAAUA/ds-3_2-AAAUA_x.pdb.gz
MCSYM-DB/3_2/AAAUC/
MCSYM-DB/3_2/AAAUC/3_2-AAAUC.mcs
MCSYM-DB/3_2/AAAUC/ds-3_2-AAAUC_x.pdb.gz
MCSYM-DB/3_2/AAAUG/
MCSYM-DB/3_2/AAAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AAAUG/3_2-AAAUG.mcs
MCSYM-DB/3_2/AAAUG/ds-3_2-AAAUG_x.pdb.gz
MCSYM-DB/3_2/AAAUU/
MCSYM-DB/3_2/AAAUU/1J4Y_model_1.pdb.gz
MCSYM-DB/3_2/AAAUU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AAAUU/3_2-AAAUU.mcs
MCSYM-DB/3_2/AAAUU/ds-3_2-AAAUU_x.pdb.gz
MCSYM-DB/3_2/AACAA/
MCSYM-DB/3_2/AACAA/3_2-AACAA.mcs
MCSYM-DB/3_2/AACAA/ds-3_2-AACAA_x.pdb.gz
MCSYM-DB/3_2/AACAC/
MCSYM-DB/3_2/AACAC/3_2-AACAC.mcs
MCSYM-DB/3_2/AACAC/ds-3_2-AACAC_x.pdb.gz
MCSYM-DB/3_2/AACAG/
MCSYM-DB/3_2/AACAG/3_2-AACAG.mcs
MCSYM-DB/3_2/AACAG/ds-3_2-AACAG_x.pdb.gz
MCSYM-DB/3_2/AACAU/
MCSYM-DB/3_2/AACAU/3_2-AACAU.mcs
MCSYM-DB/3_2/AACAU/ds-3_2-AACAU_x.pdb.gz
MCSYM-DB/3_2/AACCA/
MCSYM-DB/3_2/AACCA/3_2-AACCA.mcs
MCSYM-DB/3_2/AACCA/ds-3_2-AACCA_x.pdb.gz
MCSYM-DB/3_2/AACCC/
MCSYM-DB/3_2/AACCC/3_2-AACCC.mcs
MCSYM-DB/3_2/AACCC/ds-3_2-AACCC_x.pdb.gz
MCSYM-DB/3_2/AACCG/
MCSYM-DB/3_2/AACCG/3_2-AACCG.mcs
MCSYM-DB/3_2/AACCG/ds-3_2-AACCG_x.pdb.gz
MCSYM-DB/3_2/AACCU/
MCSYM-DB/3_2/AACCU/3_2-AACCU.mcs
MCSYM-DB/3_2/AACCU/ds-3_2-AACCU_x.pdb.gz
MCSYM-DB/3_2/AACGA/
MCSYM-DB/3_2/AACGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AACGA/3_2-AACGA.mcs
MCSYM-DB/3_2/AACGA/ds-3_2-AACGA_x.pdb.gz
MCSYM-DB/3_2/AACGC/
MCSYM-DB/3_2/AACGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AACGC/3_2-AACGC.mcs
MCSYM-DB/3_2/AACGC/ds-3_2-AACGC_x.pdb.gz
MCSYM-DB/3_2/AACGG/
MCSYM-DB/3_2/AACGG/3_2-AACGG.mcs
MCSYM-DB/3_2/AACGG/ds-3_2-AACGG_x.pdb.gz
MCSYM-DB/3_2/AACGU/
MCSYM-DB/3_2/AACGU/1LMV_model_1.pdb.gz
MCSYM-DB/3_2/AACGU/1U6P_model_1.pdb.gz
MCSYM-DB/3_2/AACGU/3_2-AACGU.mcs
MCSYM-DB/3_2/AACGU/ds-3_2-AACGU_x.pdb.gz
MCSYM-DB/3_2/AACUA/
MCSYM-DB/3_2/AACUA/3_2-AACUA.mcs
MCSYM-DB/3_2/AACUA/ds-3_2-AACUA_x.pdb.gz
MCSYM-DB/3_2/AACUC/
MCSYM-DB/3_2/AACUC/3_2-AACUC.mcs
MCSYM-DB/3_2/AACUC/ds-3_2-AACUC_x.pdb.gz
MCSYM-DB/3_2/AACUG/
MCSYM-DB/3_2/AACUG/3_2-AACUG.mcs
MCSYM-DB/3_2/AACUG/ds-3_2-AACUG_x.pdb.gz
MCSYM-DB/3_2/AACUU/
MCSYM-DB/3_2/AACUU/3_2-AACUU.mcs
MCSYM-DB/3_2/AACUU/ds-3_2-AACUU_x.pdb.gz
MCSYM-DB/3_2/AAGAA/
MCSYM-DB/3_2/AAGAA/3_2-AAGAA.mcs
MCSYM-DB/3_2/AAGAA/ds-3_2-AAGAA_x.pdb.gz
MCSYM-DB/3_2/AAGAC/
MCSYM-DB/3_2/AAGAC/3_2-AAGAC.mcs
MCSYM-DB/3_2/AAGAC/ds-3_2-AAGAC_x.pdb.gz
MCSYM-DB/3_2/AAGAG/
MCSYM-DB/3_2/AAGAG/3_2-AAGAG.mcs
MCSYM-DB/3_2/AAGAG/ds-3_2-AAGAG_x.pdb.gz
MCSYM-DB/3_2/AAGAU/
MCSYM-DB/3_2/AAGAU/3_2-AAGAU.mcs
MCSYM-DB/3_2/AAGAU/ds-3_2-AAGAU_x.pdb.gz
MCSYM-DB/3_2/AAGCA/
MCSYM-DB/3_2/AAGCA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/AAGCA/1ZFV_model_1.pdb.gz
MCSYM-DB/3_2/AAGCA/2D18_model_1.pdb.gz
MCSYM-DB/3_2/AAGCA/2D1A_model_1.pdb.gz
MCSYM-DB/3_2/AAGCA/3_2-AAGCA.mcs
MCSYM-DB/3_2/AAGCA/ds-3_2-AAGCA_x.pdb.gz
MCSYM-DB/3_2/AAGCC/
MCSYM-DB/3_2/AAGCC/3_2-AAGCC.mcs
MCSYM-DB/3_2/AAGCC/ds-3_2-AAGCC_x.pdb.gz
MCSYM-DB/3_2/AAGCG/
MCSYM-DB/3_2/AAGCG/3_2-AAGCG.mcs
MCSYM-DB/3_2/AAGCG/ds-3_2-AAGCG_x.pdb.gz
MCSYM-DB/3_2/AAGCU/
MCSYM-DB/3_2/AAGCU/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/AAGCU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AAGCU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/AAGCU/3_2-AAGCU.mcs
MCSYM-DB/3_2/AAGCU/ds-3_2-AAGCU_x.pdb.gz
MCSYM-DB/3_2/AAGGA/
MCSYM-DB/3_2/AAGGA/3_2-AAGGA.mcs
MCSYM-DB/3_2/AAGGA/ds-3_2-AAGGA_x.pdb.gz
MCSYM-DB/3_2/AAGGC/
MCSYM-DB/3_2/AAGGC/3_2-AAGGC.mcs
MCSYM-DB/3_2/AAGGC/ds-3_2-AAGGC_x.pdb.gz
MCSYM-DB/3_2/AAGGG/
MCSYM-DB/3_2/AAGGG/3_2-AAGGG.mcs
MCSYM-DB/3_2/AAGGG/ds-3_2-AAGGG_x.pdb.gz
MCSYM-DB/3_2/AAGGU/
MCSYM-DB/3_2/AAGGU/3_2-AAGGU.mcs
MCSYM-DB/3_2/AAGGU/ds-3_2-AAGGU_x.pdb.gz
MCSYM-DB/3_2/AAGUA/
MCSYM-DB/3_2/AAGUA/1L8V_model_1.pdb.gz
MCSYM-DB/3_2/AAGUA/3_2-AAGUA.mcs
MCSYM-DB/3_2/AAGUA/ds-3_2-AAGUA_x.pdb.gz
MCSYM-DB/3_2/AAGUC/
MCSYM-DB/3_2/AAGUC/3_2-AAGUC.mcs
MCSYM-DB/3_2/AAGUC/ds-3_2-AAGUC_x.pdb.gz
MCSYM-DB/3_2/AAGUG/
MCSYM-DB/3_2/AAGUG/3_2-AAGUG.mcs
MCSYM-DB/3_2/AAGUG/ds-3_2-AAGUG_x.pdb.gz
MCSYM-DB/3_2/AAGUU/
MCSYM-DB/3_2/AAGUU/3_2-AAGUU.mcs
MCSYM-DB/3_2/AAGUU/ds-3_2-AAGUU_x.pdb.gz
MCSYM-DB/3_2/AAUAA/
MCSYM-DB/3_2/AAUAA/1IE1_model_1.pdb.gz
MCSYM-DB/3_2/AAUAA/3_2-AAUAA.mcs
MCSYM-DB/3_2/AAUAA/ds-3_2-AAUAA_x.pdb.gz
MCSYM-DB/3_2/AAUAC/
MCSYM-DB/3_2/AAUAC/3_2-AAUAC.mcs
MCSYM-DB/3_2/AAUAC/ds-3_2-AAUAC_x.pdb.gz
MCSYM-DB/3_2/AAUAG/
MCSYM-DB/3_2/AAUAG/1U8D_model_1.pdb.gz
MCSYM-DB/3_2/AAUAG/1Y26_model_1.pdb.gz
MCSYM-DB/3_2/AAUAG/1Y27_model_1.pdb.gz
MCSYM-DB/3_2/AAUAG/3_2-AAUAG.mcs
MCSYM-DB/3_2/AAUAG/ds-3_2-AAUAG_x.pdb.gz
MCSYM-DB/3_2/AAUAU/
MCSYM-DB/3_2/AAUAU/3_2-AAUAU.mcs
MCSYM-DB/3_2/AAUAU/ds-3_2-AAUAU_x.pdb.gz
MCSYM-DB/3_2/AAUCA/
MCSYM-DB/3_2/AAUCA/3_2-AAUCA.mcs
MCSYM-DB/3_2/AAUCA/ds-3_2-AAUCA_x.pdb.gz
MCSYM-DB/3_2/AAUCC/
MCSYM-DB/3_2/AAUCC/3_2-AAUCC.mcs
MCSYM-DB/3_2/AAUCC/ds-3_2-AAUCC_x.pdb.gz
MCSYM-DB/3_2/AAUCG/
MCSYM-DB/3_2/AAUCG/3_2-AAUCG.mcs
MCSYM-DB/3_2/AAUCG/ds-3_2-AAUCG_x.pdb.gz
MCSYM-DB/3_2/AAUCU/
MCSYM-DB/3_2/AAUCU/3_2-AAUCU.mcs
MCSYM-DB/3_2/AAUCU/ds-3_2-AAUCU_x.pdb.gz
MCSYM-DB/3_2/AAUGA/
MCSYM-DB/3_2/AAUGA/3_2-AAUGA.mcs
MCSYM-DB/3_2/AAUGA/ds-3_2-AAUGA_x.pdb.gz
MCSYM-DB/3_2/AAUGC/
MCSYM-DB/3_2/AAUGC/3_2-AAUGC.mcs
MCSYM-DB/3_2/AAUGC/ds-3_2-AAUGC_x.pdb.gz
MCSYM-DB/3_2/AAUGG/
MCSYM-DB/3_2/AAUGG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/AAUGG/3_2-AAUGG.mcs
MCSYM-DB/3_2/AAUGG/ds-3_2-AAUGG_x.pdb.gz
MCSYM-DB/3_2/AAUGU/
MCSYM-DB/3_2/AAUGU/3_2-AAUGU.mcs
MCSYM-DB/3_2/AAUGU/ds-3_2-AAUGU_x.pdb.gz
MCSYM-DB/3_2/AAUUA/
MCSYM-DB/3_2/AAUUA/3_2-AAUUA.mcs
MCSYM-DB/3_2/AAUUA/ds-3_2-AAUUA_x.pdb.gz
MCSYM-DB/3_2/AAUUC/
MCSYM-DB/3_2/AAUUC/3_2-AAUUC.mcs
MCSYM-DB/3_2/AAUUC/ds-3_2-AAUUC_x.pdb.gz
MCSYM-DB/3_2/AAUUG/
MCSYM-DB/3_2/AAUUG/3_2-AAUUG.mcs
MCSYM-DB/3_2/AAUUG/ds-3_2-AAUUG_x.pdb.gz
MCSYM-DB/3_2/AAUUU/
MCSYM-DB/3_2/AAUUU/3_2-AAUUU.mcs
MCSYM-DB/3_2/AAUUU/ds-3_2-AAUUU_x.pdb.gz
MCSYM-DB/3_2/ACAAA/
MCSYM-DB/3_2/ACAAA/3_2-ACAAA.mcs
MCSYM-DB/3_2/ACAAA/ds-3_2-ACAAA_x.pdb.gz
MCSYM-DB/3_2/ACAAC/
MCSYM-DB/3_2/ACAAC/3_2-ACAAC.mcs
MCSYM-DB/3_2/ACAAC/ds-3_2-ACAAC_x.pdb.gz
MCSYM-DB/3_2/ACAAG/
MCSYM-DB/3_2/ACAAG/3_2-ACAAG.mcs
MCSYM-DB/3_2/ACAAG/ds-3_2-ACAAG_x.pdb.gz
MCSYM-DB/3_2/ACAAU/
MCSYM-DB/3_2/ACAAU/3_2-ACAAU.mcs
MCSYM-DB/3_2/ACAAU/ds-3_2-ACAAU_x.pdb.gz
MCSYM-DB/3_2/ACACA/
MCSYM-DB/3_2/ACACA/3_2-ACACA.mcs
MCSYM-DB/3_2/ACACA/ds-3_2-ACACA_x.pdb.gz
MCSYM-DB/3_2/ACACC/
MCSYM-DB/3_2/ACACC/3_2-ACACC.mcs
MCSYM-DB/3_2/ACACC/ds-3_2-ACACC_x.pdb.gz
MCSYM-DB/3_2/ACACG/
MCSYM-DB/3_2/ACACG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACACG/3_2-ACACG.mcs
MCSYM-DB/3_2/ACACG/ds-3_2-ACACG_x.pdb.gz
MCSYM-DB/3_2/ACACU/
MCSYM-DB/3_2/ACACU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/ACACU/3_2-ACACU.mcs
MCSYM-DB/3_2/ACACU/ds-3_2-ACACU_x.pdb.gz
MCSYM-DB/3_2/ACAGA/
MCSYM-DB/3_2/ACAGA/3_2-ACAGA.mcs
MCSYM-DB/3_2/ACAGA/ds-3_2-ACAGA_x.pdb.gz
MCSYM-DB/3_2/ACAGC/
MCSYM-DB/3_2/ACAGC/3_2-ACAGC.mcs
MCSYM-DB/3_2/ACAGC/ds-3_2-ACAGC_x.pdb.gz
MCSYM-DB/3_2/ACAGG/
MCSYM-DB/3_2/ACAGG/3_2-ACAGG.mcs
MCSYM-DB/3_2/ACAGG/ds-3_2-ACAGG_x.pdb.gz
MCSYM-DB/3_2/ACAGU/
MCSYM-DB/3_2/ACAGU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACAGU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/ACAGU/3_2-ACAGU.mcs
MCSYM-DB/3_2/ACAGU/ds-3_2-ACAGU_x.pdb.gz
MCSYM-DB/3_2/ACAUA/
MCSYM-DB/3_2/ACAUA/3_2-ACAUA.mcs
MCSYM-DB/3_2/ACAUA/ds-3_2-ACAUA_x.pdb.gz
MCSYM-DB/3_2/ACAUC/
MCSYM-DB/3_2/ACAUC/3_2-ACAUC.mcs
MCSYM-DB/3_2/ACAUC/ds-3_2-ACAUC_x.pdb.gz
MCSYM-DB/3_2/ACAUG/
MCSYM-DB/3_2/ACAUG/3_2-ACAUG.mcs
MCSYM-DB/3_2/ACAUG/ds-3_2-ACAUG_x.pdb.gz
MCSYM-DB/3_2/ACAUU/
MCSYM-DB/3_2/ACAUU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACAUU/3_2-ACAUU.mcs
MCSYM-DB/3_2/ACAUU/ds-3_2-ACAUU_x.pdb.gz
MCSYM-DB/3_2/ACCAA/
MCSYM-DB/3_2/ACCAA/3_2-ACCAA.mcs
MCSYM-DB/3_2/ACCAA/ds-3_2-ACCAA_x.pdb.gz
MCSYM-DB/3_2/ACCAC/
MCSYM-DB/3_2/ACCAC/3_2-ACCAC.mcs
MCSYM-DB/3_2/ACCAC/ds-3_2-ACCAC_x.pdb.gz
MCSYM-DB/3_2/ACCAG/
MCSYM-DB/3_2/ACCAG/3_2-ACCAG.mcs
MCSYM-DB/3_2/ACCAG/ds-3_2-ACCAG_x.pdb.gz
MCSYM-DB/3_2/ACCAU/
MCSYM-DB/3_2/ACCAU/3_2-ACCAU.mcs
MCSYM-DB/3_2/ACCAU/ds-3_2-ACCAU_x.pdb.gz
MCSYM-DB/3_2/ACCCA/
MCSYM-DB/3_2/ACCCA/3_2-ACCCA.mcs
MCSYM-DB/3_2/ACCCA/ds-3_2-ACCCA_x.pdb.gz
MCSYM-DB/3_2/ACCCC/
MCSYM-DB/3_2/ACCCC/3_2-ACCCC.mcs
MCSYM-DB/3_2/ACCCC/ds-3_2-ACCCC_x.pdb.gz
MCSYM-DB/3_2/ACCCG/
MCSYM-DB/3_2/ACCCG/3_2-ACCCG.mcs
MCSYM-DB/3_2/ACCCG/ds-3_2-ACCCG_x.pdb.gz
MCSYM-DB/3_2/ACCCU/
MCSYM-DB/3_2/ACCCU/3_2-ACCCU.mcs
MCSYM-DB/3_2/ACCCU/ds-3_2-ACCCU_x.pdb.gz
MCSYM-DB/3_2/ACCGA/
MCSYM-DB/3_2/ACCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACCGA/3_2-ACCGA.mcs
MCSYM-DB/3_2/ACCGA/ds-3_2-ACCGA_x.pdb.gz
MCSYM-DB/3_2/ACCGC/
MCSYM-DB/3_2/ACCGC/3_2-ACCGC.mcs
MCSYM-DB/3_2/ACCGC/ds-3_2-ACCGC_x.pdb.gz
MCSYM-DB/3_2/ACCGG/
MCSYM-DB/3_2/ACCGG/3_2-ACCGG.mcs
MCSYM-DB/3_2/ACCGG/ds-3_2-ACCGG_x.pdb.gz
MCSYM-DB/3_2/ACCGU/
MCSYM-DB/3_2/ACCGU/3_2-ACCGU.mcs
MCSYM-DB/3_2/ACCGU/ds-3_2-ACCGU_x.pdb.gz
MCSYM-DB/3_2/ACCUA/
MCSYM-DB/3_2/ACCUA/3_2-ACCUA.mcs
MCSYM-DB/3_2/ACCUA/ds-3_2-ACCUA_x.pdb.gz
MCSYM-DB/3_2/ACCUC/
MCSYM-DB/3_2/ACCUC/3_2-ACCUC.mcs
MCSYM-DB/3_2/ACCUC/ds-3_2-ACCUC_x.pdb.gz
MCSYM-DB/3_2/ACCUG/
MCSYM-DB/3_2/ACCUG/3_2-ACCUG.mcs
MCSYM-DB/3_2/ACCUG/ds-3_2-ACCUG_x.pdb.gz
MCSYM-DB/3_2/ACCUU/
MCSYM-DB/3_2/ACCUU/3_2-ACCUU.mcs
MCSYM-DB/3_2/ACCUU/ds-3_2-ACCUU_x.pdb.gz
MCSYM-DB/3_2/ACGAA/
MCSYM-DB/3_2/ACGAA/3_2-ACGAA.mcs
MCSYM-DB/3_2/ACGAA/ds-3_2-ACGAA_x.pdb.gz
MCSYM-DB/3_2/ACGAC/
MCSYM-DB/3_2/ACGAC/3_2-ACGAC.mcs
MCSYM-DB/3_2/ACGAC/ds-3_2-ACGAC_x.pdb.gz
MCSYM-DB/3_2/ACGAG/
MCSYM-DB/3_2/ACGAG/3_2-ACGAG.mcs
MCSYM-DB/3_2/ACGAG/ds-3_2-ACGAG_x.pdb.gz
MCSYM-DB/3_2/ACGAU/
MCSYM-DB/3_2/ACGAU/1J1U_model_1.pdb.gz
MCSYM-DB/3_2/ACGAU/3_2-ACGAU.mcs
MCSYM-DB/3_2/ACGAU/ds-3_2-ACGAU_x.pdb.gz
MCSYM-DB/3_2/ACGCA/
MCSYM-DB/3_2/ACGCA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/ACGCA/3_2-ACGCA.mcs
MCSYM-DB/3_2/ACGCA/ds-3_2-ACGCA_x.pdb.gz
MCSYM-DB/3_2/ACGCC/
MCSYM-DB/3_2/ACGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACGCC/3_2-ACGCC.mcs
MCSYM-DB/3_2/ACGCC/ds-3_2-ACGCC_x.pdb.gz
MCSYM-DB/3_2/ACGCG/
MCSYM-DB/3_2/ACGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACGCG/3_2-ACGCG.mcs
MCSYM-DB/3_2/ACGCG/ds-3_2-ACGCG_x.pdb.gz
MCSYM-DB/3_2/ACGCU/
MCSYM-DB/3_2/ACGCU/1BVJ_model_1.pdb.gz
MCSYM-DB/3_2/ACGCU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/ACGCU/3_2-ACGCU.mcs
MCSYM-DB/3_2/ACGCU/ds-3_2-ACGCU.pdb.gz
MCSYM-DB/3_2/ACGCU/ds-3_2-ACGCU_x.pdb.gz
MCSYM-DB/3_2/ACGGA/
MCSYM-DB/3_2/ACGGA/3_2-ACGGA.mcs
MCSYM-DB/3_2/ACGGA/ds-3_2-ACGGA_x.pdb.gz
MCSYM-DB/3_2/ACGGC/
MCSYM-DB/3_2/ACGGC/3_2-ACGGC.mcs
MCSYM-DB/3_2/ACGGC/ds-3_2-ACGGC_x.pdb.gz
MCSYM-DB/3_2/ACGGG/
MCSYM-DB/3_2/ACGGG/3_2-ACGGG.mcs
MCSYM-DB/3_2/ACGGG/ds-3_2-ACGGG_x.pdb.gz
MCSYM-DB/3_2/ACGGU/
MCSYM-DB/3_2/ACGGU/1UUU_model_1.pdb.gz
MCSYM-DB/3_2/ACGGU/3_2-ACGGU.mcs
MCSYM-DB/3_2/ACGGU/ds-3_2-ACGGU_x.pdb.gz
MCSYM-DB/3_2/ACGUA/
MCSYM-DB/3_2/ACGUA/3_2-ACGUA.mcs
MCSYM-DB/3_2/ACGUA/ds-3_2-ACGUA_x.pdb.gz
MCSYM-DB/3_2/ACGUC/
MCSYM-DB/3_2/ACGUC/3_2-ACGUC.mcs
MCSYM-DB/3_2/ACGUC/ds-3_2-ACGUC_x.pdb.gz
MCSYM-DB/3_2/ACGUG/
MCSYM-DB/3_2/ACGUG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/ACGUG/3_2-ACGUG.mcs
MCSYM-DB/3_2/ACGUG/ds-3_2-ACGUG_x.pdb.gz
MCSYM-DB/3_2/ACGUU/
MCSYM-DB/3_2/ACGUU/3_2-ACGUU.mcs
MCSYM-DB/3_2/ACGUU/ds-3_2-ACGUU_x.pdb.gz
MCSYM-DB/3_2/ACUAA/
MCSYM-DB/3_2/ACUAA/3_2-ACUAA.mcs
MCSYM-DB/3_2/ACUAA/ds-3_2-ACUAA_x.pdb.gz
MCSYM-DB/3_2/ACUAC/
MCSYM-DB/3_2/ACUAC/3_2-ACUAC.mcs
MCSYM-DB/3_2/ACUAC/ds-3_2-ACUAC_x.pdb.gz
MCSYM-DB/3_2/ACUAG/
MCSYM-DB/3_2/ACUAG/3_2-ACUAG.mcs
MCSYM-DB/3_2/ACUAG/ds-3_2-ACUAG_x.pdb.gz
MCSYM-DB/3_2/ACUAU/
MCSYM-DB/3_2/ACUAU/3_2-ACUAU.mcs
MCSYM-DB/3_2/ACUAU/ds-3_2-ACUAU_x.pdb.gz
MCSYM-DB/3_2/ACUCA/
MCSYM-DB/3_2/ACUCA/3_2-ACUCA.mcs
MCSYM-DB/3_2/ACUCA/ds-3_2-ACUCA_x.pdb.gz
MCSYM-DB/3_2/ACUCC/
MCSYM-DB/3_2/ACUCC/3_2-ACUCC.mcs
MCSYM-DB/3_2/ACUCC/ds-3_2-ACUCC_x.pdb.gz
MCSYM-DB/3_2/ACUCG/
MCSYM-DB/3_2/ACUCG/3_2-ACUCG.mcs
MCSYM-DB/3_2/ACUCG/ds-3_2-ACUCG_x.pdb.gz
MCSYM-DB/3_2/ACUCU/
MCSYM-DB/3_2/ACUCU/3_2-ACUCU.mcs
MCSYM-DB/3_2/ACUCU/ds-3_2-ACUCU_x.pdb.gz
MCSYM-DB/3_2/ACUGA/
MCSYM-DB/3_2/ACUGA/3_2-ACUGA.mcs
MCSYM-DB/3_2/ACUGA/ds-3_2-ACUGA_x.pdb.gz
MCSYM-DB/3_2/ACUGC/
MCSYM-DB/3_2/ACUGC/3_2-ACUGC.mcs
MCSYM-DB/3_2/ACUGC/ds-3_2-ACUGC_x.pdb.gz
MCSYM-DB/3_2/ACUGG/
MCSYM-DB/3_2/ACUGG/1ELH_model_1.pdb.gz
MCSYM-DB/3_2/ACUGG/3_2-ACUGG.mcs
MCSYM-DB/3_2/ACUGG/ds-3_2-ACUGG_x.pdb.gz
MCSYM-DB/3_2/ACUGU/
MCSYM-DB/3_2/ACUGU/3_2-ACUGU.mcs
MCSYM-DB/3_2/ACUGU/ds-3_2-ACUGU_x.pdb.gz
MCSYM-DB/3_2/ACUUA/
MCSYM-DB/3_2/ACUUA/3_2-ACUUA.mcs
MCSYM-DB/3_2/ACUUA/ds-3_2-ACUUA_x.pdb.gz
MCSYM-DB/3_2/ACUUC/
MCSYM-DB/3_2/ACUUC/3_2-ACUUC.mcs
MCSYM-DB/3_2/ACUUC/ds-3_2-ACUUC_x.pdb.gz
MCSYM-DB/3_2/ACUUG/
MCSYM-DB/3_2/ACUUG/3_2-ACUUG.mcs
MCSYM-DB/3_2/ACUUG/ds-3_2-ACUUG_x.pdb.gz
MCSYM-DB/3_2/ACUUU/
MCSYM-DB/3_2/ACUUU/3_2-ACUUU.mcs
MCSYM-DB/3_2/ACUUU/ds-3_2-ACUUU_x.pdb.gz
MCSYM-DB/3_2/AGAAA/
MCSYM-DB/3_2/AGAAA/3_2-AGAAA.mcs
MCSYM-DB/3_2/AGAAA/ds-3_2-AGAAA_x.pdb.gz
MCSYM-DB/3_2/AGAAC/
MCSYM-DB/3_2/AGAAC/3_2-AGAAC.mcs
MCSYM-DB/3_2/AGAAC/ds-3_2-AGAAC_x.pdb.gz
MCSYM-DB/3_2/AGAAG/
MCSYM-DB/3_2/AGAAG/3_2-AGAAG.mcs
MCSYM-DB/3_2/AGAAG/ds-3_2-AGAAG_x.pdb.gz
MCSYM-DB/3_2/AGAAU/
MCSYM-DB/3_2/AGAAU/3_2-AGAAU.mcs
MCSYM-DB/3_2/AGAAU/ds-3_2-AGAAU_x.pdb.gz
MCSYM-DB/3_2/AGACA/
MCSYM-DB/3_2/AGACA/3_2-AGACA.mcs
MCSYM-DB/3_2/AGACA/ds-3_2-AGACA_x.pdb.gz
MCSYM-DB/3_2/AGACC/
MCSYM-DB/3_2/AGACC/3_2-AGACC.mcs
MCSYM-DB/3_2/AGACC/ds-3_2-AGACC_x.pdb.gz
MCSYM-DB/3_2/AGACG/
MCSYM-DB/3_2/AGACG/3_2-AGACG.mcs
MCSYM-DB/3_2/AGACG/ds-3_2-AGACG_x.pdb.gz
MCSYM-DB/3_2/AGACU/
MCSYM-DB/3_2/AGACU/1XSG_model_1.pdb.gz
MCSYM-DB/3_2/AGACU/3_2-AGACU.mcs
MCSYM-DB/3_2/AGACU/ds-3_2-AGACU_x.pdb.gz
MCSYM-DB/3_2/AGAGA/
MCSYM-DB/3_2/AGAGA/2BTE_model_1.pdb.gz
MCSYM-DB/3_2/AGAGA/3_2-AGAGA.mcs
MCSYM-DB/3_2/AGAGA/ds-3_2-AGAGA_x.pdb.gz
MCSYM-DB/3_2/AGAGC/
MCSYM-DB/3_2/AGAGC/3_2-AGAGC.mcs
MCSYM-DB/3_2/AGAGC/ds-3_2-AGAGC_x.pdb.gz
MCSYM-DB/3_2/AGAGG/
MCSYM-DB/3_2/AGAGG/3_2-AGAGG.mcs
MCSYM-DB/3_2/AGAGG/ds-3_2-AGAGG_x.pdb.gz
MCSYM-DB/3_2/AGAGU/
MCSYM-DB/3_2/AGAGU/3_2-AGAGU.mcs
MCSYM-DB/3_2/AGAGU/ds-3_2-AGAGU_x.pdb.gz
MCSYM-DB/3_2/AGAUA/
MCSYM-DB/3_2/AGAUA/3_2-AGAUA.mcs
MCSYM-DB/3_2/AGAUA/ds-3_2-AGAUA_x.pdb.gz
MCSYM-DB/3_2/AGAUC/
MCSYM-DB/3_2/AGAUC/3_2-AGAUC.mcs
MCSYM-DB/3_2/AGAUC/ds-3_2-AGAUC_x.pdb.gz
MCSYM-DB/3_2/AGAUG/
MCSYM-DB/3_2/AGAUG/1AM0_model_1.pdb.gz
MCSYM-DB/3_2/AGAUG/3_2-AGAUG.mcs
MCSYM-DB/3_2/AGAUG/ds-3_2-AGAUG_x.pdb.gz
MCSYM-DB/3_2/AGAUU/
MCSYM-DB/3_2/AGAUU/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/AGAUU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGAUU/3_2-AGAUU.mcs
MCSYM-DB/3_2/AGAUU/ds-3_2-AGAUU_x.pdb.gz
MCSYM-DB/3_2/AGCAA/
MCSYM-DB/3_2/AGCAA/3_2-AGCAA.mcs
MCSYM-DB/3_2/AGCAA/ds-3_2-AGCAA_x.pdb.gz
MCSYM-DB/3_2/AGCAC/
MCSYM-DB/3_2/AGCAC/3_2-AGCAC.mcs
MCSYM-DB/3_2/AGCAC/ds-3_2-AGCAC_x.pdb.gz
MCSYM-DB/3_2/AGCAG/
MCSYM-DB/3_2/AGCAG/3_2-AGCAG.mcs
MCSYM-DB/3_2/AGCAG/ds-3_2-AGCAG_x.pdb.gz
MCSYM-DB/3_2/AGCAU/
MCSYM-DB/3_2/AGCAU/3_2-AGCAU.mcs
MCSYM-DB/3_2/AGCAU/ds-3_2-AGCAU_x.pdb.gz
MCSYM-DB/3_2/AGCCA/
MCSYM-DB/3_2/AGCCA/3_2-AGCCA.mcs
MCSYM-DB/3_2/AGCCA/ds-3_2-AGCCA_x.pdb.gz
MCSYM-DB/3_2/AGCCC/
MCSYM-DB/3_2/AGCCC/3_2-AGCCC.mcs
MCSYM-DB/3_2/AGCCC/ds-3_2-AGCCC_x.pdb.gz
MCSYM-DB/3_2/AGCCG/
MCSYM-DB/3_2/AGCCG/3_2-AGCCG.mcs
MCSYM-DB/3_2/AGCCG/ds-3_2-AGCCG_x.pdb.gz
MCSYM-DB/3_2/AGCCU/
MCSYM-DB/3_2/AGCCU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGCCU/3_2-AGCCU.mcs
MCSYM-DB/3_2/AGCCU/ds-3_2-AGCCU_x.pdb.gz
MCSYM-DB/3_2/AGCGA/
MCSYM-DB/3_2/AGCGA/3_2-AGCGA.mcs
MCSYM-DB/3_2/AGCGA/ds-3_2-AGCGA_x.pdb.gz
MCSYM-DB/3_2/AGCGC/
MCSYM-DB/3_2/AGCGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGCGC/3_2-AGCGC.mcs
MCSYM-DB/3_2/AGCGC/ds-3_2-AGCGC_x.pdb.gz
MCSYM-DB/3_2/AGCGG/
MCSYM-DB/3_2/AGCGG/1U9S_model_1.pdb.gz
MCSYM-DB/3_2/AGCGG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGCGG/3_2-AGCGG.mcs
MCSYM-DB/3_2/AGCGG/ds-3_2-AGCGG_x.pdb.gz
MCSYM-DB/3_2/AGCGU/
MCSYM-DB/3_2/AGCGU/1L8V_model_1.pdb.gz
MCSYM-DB/3_2/AGCGU/3_2-AGCGU.mcs
MCSYM-DB/3_2/AGCGU/ds-3_2-AGCGU_x.pdb.gz
MCSYM-DB/3_2/AGCUA/
MCSYM-DB/3_2/AGCUA/3_2-AGCUA.mcs
MCSYM-DB/3_2/AGCUA/ds-3_2-AGCUA_x.pdb.gz
MCSYM-DB/3_2/AGCUC/
MCSYM-DB/3_2/AGCUC/3_2-AGCUC.mcs
MCSYM-DB/3_2/AGCUC/ds-3_2-AGCUC_x.pdb.gz
MCSYM-DB/3_2/AGCUG/
MCSYM-DB/3_2/AGCUG/3_2-AGCUG.mcs
MCSYM-DB/3_2/AGCUG/ds-3_2-AGCUG_x.pdb.gz
MCSYM-DB/3_2/AGCUU/
MCSYM-DB/3_2/AGCUU/3_2-AGCUU.mcs
MCSYM-DB/3_2/AGCUU/ds-3_2-AGCUU_x.pdb.gz
MCSYM-DB/3_2/AGGAA/
MCSYM-DB/3_2/AGGAA/3_2-AGGAA.mcs
MCSYM-DB/3_2/AGGAA/ds-3_2-AGGAA_x.pdb.gz
MCSYM-DB/3_2/AGGAC/
MCSYM-DB/3_2/AGGAC/3_2-AGGAC.mcs
MCSYM-DB/3_2/AGGAC/ds-3_2-AGGAC_x.pdb.gz
MCSYM-DB/3_2/AGGAG/
MCSYM-DB/3_2/AGGAG/3_2-AGGAG.mcs
MCSYM-DB/3_2/AGGAG/ds-3_2-AGGAG_x.pdb.gz
MCSYM-DB/3_2/AGGAU/
MCSYM-DB/3_2/AGGAU/3_2-AGGAU.mcs
MCSYM-DB/3_2/AGGAU/ds-3_2-AGGAU_x.pdb.gz
MCSYM-DB/3_2/AGGCA/
MCSYM-DB/3_2/AGGCA/3_2-AGGCA.mcs
MCSYM-DB/3_2/AGGCA/ds-3_2-AGGCA_x.pdb.gz
MCSYM-DB/3_2/AGGCC/
MCSYM-DB/3_2/AGGCC/3_2-AGGCC.mcs
MCSYM-DB/3_2/AGGCC/ds-3_2-AGGCC_x.pdb.gz
MCSYM-DB/3_2/GCGC/
MCSYM-DB/3_2/AGGCG/
MCSYM-DB/3_2/AGGCG/1BN0_model_1.pdb.gz
MCSYM-DB/3_2/AGGCG/3_2-AGGCG.mcs
MCSYM-DB/3_2/AGGCG/ds-3_2-AGGCG_x.pdb.gz
MCSYM-DB/3_2/AGGCU/
MCSYM-DB/3_2/AGGCU/1M5L_model_1.pdb.gz
MCSYM-DB/3_2/AGGCU/2ES5_model_1.pdb.gz
MCSYM-DB/3_2/AGGCU/3_2-AGGCU.mcs
MCSYM-DB/3_2/AGGCU/ds-3_2-AGGCU_x.pdb.gz
MCSYM-DB/3_2/AGGGA/
MCSYM-DB/3_2/AGGGA/3_2-AGGGA.mcs
MCSYM-DB/3_2/AGGGA/ds-3_2-AGGGA_x.pdb.gz
MCSYM-DB/3_2/AGGGC/
MCSYM-DB/3_2/AGGGC/3_2-AGGGC.mcs
MCSYM-DB/3_2/AGGGC/ds-3_2-AGGGC_x.pdb.gz
MCSYM-DB/3_2/AGGGG/
MCSYM-DB/3_2/AGGGG/2GM0_model_1.pdb.gz
MCSYM-DB/3_2/AGGGG/3_2-AGGGG.mcs
MCSYM-DB/3_2/AGGGG/ds-3_2-AGGGG_x.pdb.gz
MCSYM-DB/3_2/AGGGU/
MCSYM-DB/3_2/AGGGU/3_2-AGGGU.mcs
MCSYM-DB/3_2/AGGGU/ds-3_2-AGGGU_x.pdb.gz
MCSYM-DB/3_2/AGGUA/
MCSYM-DB/3_2/AGGUA/3_2-AGGUA.mcs
MCSYM-DB/3_2/AGGUA/ds-3_2-AGGUA_x.pdb.gz
MCSYM-DB/3_2/AGGUC/
MCSYM-DB/3_2/AGGUC/3_2-AGGUC.mcs
MCSYM-DB/3_2/AGGUC/ds-3_2-AGGUC_x.pdb.gz
MCSYM-DB/3_2/AGGUG/
MCSYM-DB/3_2/AGGUG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGGUG/3_2-AGGUG.mcs
MCSYM-DB/3_2/AGGUG/ds-3_2-AGGUG_x.pdb.gz
MCSYM-DB/3_2/AGGUU/
MCSYM-DB/3_2/AGGUU/3_2-AGGUU.mcs
MCSYM-DB/3_2/AGGUU/ds-3_2-AGGUU_x.pdb.gz
MCSYM-DB/3_2/AGUAA/
MCSYM-DB/3_2/AGUAA/1F84_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1FQZ_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1IE1_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1JBR_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1JBT_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1P5N_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1P5O_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1Q93_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1Q96_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1QWB_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/AGUAA/3_2-AGUAA.mcs
MCSYM-DB/3_2/AGUAA/ds-3_2-AGUAA.pdb.gz
MCSYM-DB/3_2/AGUAA/ds-3_2-AGUAA_x.pdb.gz
MCSYM-DB/3_2/AGUAC/
MCSYM-DB/3_2/AGUAC/3_2-AGUAC.mcs
MCSYM-DB/3_2/AGUAC/ds-3_2-AGUAC_x.pdb.gz
MCSYM-DB/3_2/AGUAG/
MCSYM-DB/3_2/AGUAG/3_2-AGUAG.mcs
MCSYM-DB/3_2/AGUAG/ds-3_2-AGUAG_x.pdb.gz
MCSYM-DB/3_2/AGUAU/
MCSYM-DB/3_2/AGUAU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AGUAU/3_2-AGUAU.mcs
MCSYM-DB/3_2/AGUAU/ds-3_2-AGUAU_x.pdb.gz
MCSYM-DB/3_2/AGUCA/
MCSYM-DB/3_2/AGUCA/3_2-AGUCA.mcs
MCSYM-DB/3_2/AGUCA/ds-3_2-AGUCA_x.pdb.gz
MCSYM-DB/3_2/AGUCC/
MCSYM-DB/3_2/AGUCC/3_2-AGUCC.mcs
MCSYM-DB/3_2/AGUCC/ds-3_2-AGUCC_x.pdb.gz
MCSYM-DB/3_2/AGUCG/
MCSYM-DB/3_2/AGUCG/3_2-AGUCG.mcs
MCSYM-DB/3_2/AGUCG/ds-3_2-AGUCG_x.pdb.gz
MCSYM-DB/3_2/AGUCU/
MCSYM-DB/3_2/AGUCU/3_2-AGUCU.mcs
MCSYM-DB/3_2/AGUCU/ds-3_2-AGUCU_x.pdb.gz
MCSYM-DB/3_2/AGUGA/
MCSYM-DB/3_2/AGUGA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/AGUGA/3_2-AGUGA.mcs
MCSYM-DB/3_2/AGUGA/ds-3_2-AGUGA_x.pdb.gz
MCSYM-DB/3_2/AGUGC/
MCSYM-DB/3_2/AGUGC/3_2-AGUGC.mcs
MCSYM-DB/3_2/AGUGC/ds-3_2-AGUGC_x.pdb.gz
MCSYM-DB/3_2/AGUGG/
MCSYM-DB/3_2/AGUGG/1KOD_model_1.pdb.gz
MCSYM-DB/3_2/AGUGG/3_2-AGUGG.mcs
MCSYM-DB/3_2/AGUGG/ds-3_2-AGUGG_x.pdb.gz
MCSYM-DB/3_2/AGUGU/
MCSYM-DB/3_2/AGUGU/3_2-AGUGU.mcs
MCSYM-DB/3_2/AGUGU/ds-3_2-AGUGU_x.pdb.gz
MCSYM-DB/3_2/AGUUA/
MCSYM-DB/3_2/AGUUA/3_2-AGUUA.mcs
MCSYM-DB/3_2/AGUUA/ds-3_2-AGUUA_x.pdb.gz
MCSYM-DB/3_2/AGUUC/
MCSYM-DB/3_2/AGUUC/3_2-AGUUC.mcs
MCSYM-DB/3_2/AGUUC/ds-3_2-AGUUC_x.pdb.gz
MCSYM-DB/3_2/AGUUG/
MCSYM-DB/3_2/AGUUG/3_2-AGUUG.mcs
MCSYM-DB/3_2/AGUUG/ds-3_2-AGUUG_x.pdb.gz
MCSYM-DB/3_2/AGUUU/
MCSYM-DB/3_2/AGUUU/3_2-AGUUU.mcs
MCSYM-DB/3_2/AGUUU/ds-3_2-AGUUU_x.pdb.gz
MCSYM-DB/3_2/AUAAA/
MCSYM-DB/3_2/AUAAA/1B36_model_1.pdb.gz
MCSYM-DB/3_2/AUAAA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/AUAAA/3_2-AUAAA.mcs
MCSYM-DB/3_2/AUAAA/ds-3_2-AUAAA_x.pdb.gz
MCSYM-DB/3_2/AUAAC/
MCSYM-DB/3_2/AUAAC/3_2-AUAAC.mcs
MCSYM-DB/3_2/AUAAC/ds-3_2-AUAAC_x.pdb.gz
MCSYM-DB/3_2/AUAAG/
MCSYM-DB/3_2/AUAAG/3_2-AUAAG.mcs
MCSYM-DB/3_2/AUAAG/ds-3_2-AUAAG_x.pdb.gz
MCSYM-DB/3_2/AUAAU/
MCSYM-DB/3_2/AUAAU/3_2-AUAAU.mcs
MCSYM-DB/3_2/AUAAU/ds-3_2-AUAAU_x.pdb.gz
MCSYM-DB/3_2/AUACA/
MCSYM-DB/3_2/AUACA/3_2-AUACA.mcs
MCSYM-DB/3_2/AUACA/ds-3_2-AUACA_x.pdb.gz
MCSYM-DB/3_2/AUACC/
MCSYM-DB/3_2/AUACC/3_2-AUACC.mcs
MCSYM-DB/3_2/AUACC/ds-3_2-AUACC_x.pdb.gz
MCSYM-DB/3_2/AUACG/
MCSYM-DB/3_2/AUACG/3_2-AUACG.mcs
MCSYM-DB/3_2/AUACG/ds-3_2-AUACG_x.pdb.gz
MCSYM-DB/3_2/AUACU/
MCSYM-DB/3_2/AUACU/3_2-AUACU.mcs
MCSYM-DB/3_2/AUACU/ds-3_2-AUACU_x.pdb.gz
MCSYM-DB/3_2/AUAGA/
MCSYM-DB/3_2/AUAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AUAGA/3_2-AUAGA.mcs
MCSYM-DB/3_2/AUAGA/ds-3_2-AUAGA_x.pdb.gz
MCSYM-DB/3_2/AUAGC/
MCSYM-DB/3_2/AUAGC/3_2-AUAGC.mcs
MCSYM-DB/3_2/AUAGC/ds-3_2-AUAGC_x.pdb.gz
MCSYM-DB/3_2/AUAGG/
MCSYM-DB/3_2/AUAGG/3_2-AUAGG.mcs
MCSYM-DB/3_2/AUAGG/ds-3_2-AUAGG_x.pdb.gz
MCSYM-DB/3_2/AUAGU/
MCSYM-DB/3_2/AUAGU/3_2-AUAGU.mcs
MCSYM-DB/3_2/AUAGU/ds-3_2-AUAGU_x.pdb.gz
MCSYM-DB/3_2/AUAUA/
MCSYM-DB/3_2/AUAUA/3_2-AUAUA.mcs
MCSYM-DB/3_2/AUAUA/ds-3_2-AUAUA_x.pdb.gz
MCSYM-DB/3_2/AUAUC/
MCSYM-DB/3_2/AUAUC/3_2-AUAUC.mcs
MCSYM-DB/3_2/AUAUC/ds-3_2-AUAUC_x.pdb.gz
MCSYM-DB/3_2/AUAUG/
MCSYM-DB/3_2/AUAUG/3_2-AUAUG.mcs
MCSYM-DB/3_2/AUAUG/ds-3_2-AUAUG_x.pdb.gz
MCSYM-DB/3_2/AUAUU/
MCSYM-DB/3_2/AUAUU/3_2-AUAUU.mcs
MCSYM-DB/3_2/AUAUU/ds-3_2-AUAUU_x.pdb
MCSYM-DB/3_2/AUAUU/ds-3_2-AUAUU_x.pdb.gz
MCSYM-DB/3_2/AUCAA/
MCSYM-DB/3_2/AUCAA/3_2-AUCAA.mcs
MCSYM-DB/3_2/AUCAA/ds-3_2-AUCAA_x.pdb.gz
MCSYM-DB/3_2/AUCAC/
MCSYM-DB/3_2/AUCAC/3_2-AUCAC.mcs
MCSYM-DB/3_2/AUCAC/ds-3_2-AUCAC_x.pdb.gz
MCSYM-DB/3_2/AUCAG/
MCSYM-DB/3_2/AUCAG/3_2-AUCAG.mcs
MCSYM-DB/3_2/AUCAG/ds-3_2-AUCAG_x.pdb.gz
MCSYM-DB/3_2/AUCAU/
MCSYM-DB/3_2/AUCAU/3_2-AUCAU.mcs
MCSYM-DB/3_2/AUCAU/ds-3_2-AUCAU_x.pdb.gz
MCSYM-DB/3_2/AUCCA/
MCSYM-DB/3_2/AUCCA/3_2-AUCCA.mcs
MCSYM-DB/3_2/AUCCA/ds-3_2-AUCCA_x.pdb.gz
MCSYM-DB/3_2/AUCCC/
MCSYM-DB/3_2/AUCCC/3_2-AUCCC.mcs
MCSYM-DB/3_2/AUCCC/ds-3_2-AUCCC_x.pdb.gz
MCSYM-DB/3_2/AUCCG/
MCSYM-DB/3_2/AUCCG/3_2-AUCCG.mcs
MCSYM-DB/3_2/AUCCG/ds-3_2-AUCCG_x.pdb.gz
MCSYM-DB/3_2/AUCCU/
MCSYM-DB/3_2/AUCCU/3_2-AUCCU.mcs
MCSYM-DB/3_2/AUCCU/ds-3_2-AUCCU_x.pdb.gz
MCSYM-DB/3_2/AUCGA/
MCSYM-DB/3_2/AUCGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/AUCGA/3_2-AUCGA.mcs
MCSYM-DB/3_2/AUCGA/ds-3_2-AUCGA_x.pdb.gz
MCSYM-DB/3_2/AUCGC/
MCSYM-DB/3_2/AUCGC/3_2-AUCGC.mcs
MCSYM-DB/3_2/AUCGC/ds-3_2-AUCGC_x.pdb.gz
MCSYM-DB/3_2/AUCGG/
MCSYM-DB/3_2/AUCGG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AUCGG/3_2-AUCGG.mcs
MCSYM-DB/3_2/AUCGG/ds-3_2-AUCGG_x.pdb.gz
MCSYM-DB/3_2/AUCGU/
MCSYM-DB/3_2/AUCGU/2TPK_model_1.pdb.gz
MCSYM-DB/3_2/AUCGU/3_2-AUCGU.mcs
MCSYM-DB/3_2/AUCGU/ds-3_2-AUCGU_x.pdb.gz
MCSYM-DB/3_2/AUCUA/
MCSYM-DB/3_2/AUCUA/3_2-AUCUA.mcs
MCSYM-DB/3_2/AUCUA/ds-3_2-AUCUA_x.pdb.gz
MCSYM-DB/3_2/AUCUC/
MCSYM-DB/3_2/AUCUC/3_2-AUCUC.mcs
MCSYM-DB/3_2/AUCUC/ds-3_2-AUCUC_x.pdb.gz
MCSYM-DB/3_2/AUCUG/
MCSYM-DB/3_2/AUCUG/3_2-AUCUG.mcs
MCSYM-DB/3_2/AUCUG/ds-3_2-AUCUG_x.pdb.gz
MCSYM-DB/3_2/AUCUU/
MCSYM-DB/3_2/AUCUU/3_2-AUCUU.mcs
MCSYM-DB/3_2/AUCUU/ds-3_2-AUCUU_x.pdb.gz
MCSYM-DB/3_2/AUGAA/
MCSYM-DB/3_2/AUGAA/3_2-AUGAA.mcs
MCSYM-DB/3_2/AUGAA/ds-3_2-AUGAA_x.pdb.gz
MCSYM-DB/3_2/AUGAC/
MCSYM-DB/3_2/AUGAC/1KP7_model_1.pdb.gz
MCSYM-DB/3_2/AUGAC/3_2-AUGAC.mcs
MCSYM-DB/3_2/AUGAC/ds-3_2-AUGAC_x.pdb.gz
MCSYM-DB/3_2/AUGAG/
MCSYM-DB/3_2/AUGAG/3_2-AUGAG.mcs
MCSYM-DB/3_2/AUGAG/ds-3_2-AUGAG_x.pdb.gz
MCSYM-DB/3_2/AUGAU/
MCSYM-DB/3_2/AUGAU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/AUGAU/3_2-AUGAU.mcs
MCSYM-DB/3_2/AUGAU/ds-3_2-AUGAU_x.pdb.gz
MCSYM-DB/3_2/AUGCA/
MCSYM-DB/3_2/AUGCA/3_2-AUGCA.mcs
MCSYM-DB/3_2/AUGCA/ds-3_2-AUGCA_x.pdb.gz
MCSYM-DB/3_2/AUGCC/
MCSYM-DB/3_2/AUGCC/1SYZ_model_1.pdb.gz
MCSYM-DB/3_2/AUGCC/1XHP_model_1.pdb.gz
MCSYM-DB/3_2/AUGCC/3_2-AUGCC.mcs
MCSYM-DB/3_2/AUGCC/ds-3_2-AUGCC_x.pdb.gz
MCSYM-DB/3_2/AUGCG/
MCSYM-DB/3_2/AUGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AUGCG/3_2-AUGCG.mcs
MCSYM-DB/3_2/AUGCG/ds-3_2-AUGCG_x.pdb.gz
MCSYM-DB/3_2/AUGCU/
MCSYM-DB/3_2/AUGCU/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/1KXK_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/1L8V_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/1S03_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/2ADT_model_1.pdb.gz
MCSYM-DB/3_2/AUGCU/3_2-AUGCU.mcs
MCSYM-DB/3_2/AUGCU/ds-3_2-AUGCU.pdb.gz
MCSYM-DB/3_2/AUGCU/ds-3_2-AUGCU_x.pdb.gz
MCSYM-DB/3_2/AUGGA/
MCSYM-DB/3_2/AUGGA/3_2-AUGGA.mcs
MCSYM-DB/3_2/AUGGA/ds-3_2-AUGGA_x.pdb.gz
MCSYM-DB/3_2/AUGGC/
MCSYM-DB/3_2/AUGGC/3_2-AUGGC.mcs
MCSYM-DB/3_2/AUGGC/ds-3_2-AUGGC_x.pdb.gz
MCSYM-DB/3_2/AUGGG/
MCSYM-DB/3_2/AUGGG/3_2-AUGGG.mcs
MCSYM-DB/3_2/AUGGG/ds-3_2-AUGGG_x.pdb.gz
MCSYM-DB/3_2/AUGGU/
MCSYM-DB/3_2/AUGGU/3_2-AUGGU.mcs
MCSYM-DB/3_2/AUGGU/ds-3_2-AUGGU_x.pdb.gz
MCSYM-DB/3_2/AUGUA/
MCSYM-DB/3_2/AUGUA/3_2-AUGUA.mcs
MCSYM-DB/3_2/AUGUA/ds-3_2-AUGUA_x.pdb.gz
MCSYM-DB/3_2/AUGUC/
MCSYM-DB/3_2/AUGUC/3_2-AUGUC.mcs
MCSYM-DB/3_2/AUGUC/ds-3_2-AUGUC_x.pdb.gz
MCSYM-DB/3_2/AUGUG/
MCSYM-DB/3_2/AUGUG/3_2-AUGUG.mcs
MCSYM-DB/3_2/AUGUG/ds-3_2-AUGUG_x.pdb.gz
MCSYM-DB/3_2/AUGUU/
MCSYM-DB/3_2/AUGUU/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/AUGUU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/AUGUU/3_2-AUGUU.mcs
MCSYM-DB/3_2/AUGUU/ds-3_2-AUGUU_x.pdb.gz
MCSYM-DB/3_2/AUUAA/
MCSYM-DB/3_2/AUUAA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/AUUAA/3_2-AUUAA.mcs
MCSYM-DB/3_2/AUUAA/ds-3_2-AUUAA_x.pdb.gz
MCSYM-DB/3_2/AUUAC/
MCSYM-DB/3_2/AUUAC/3_2-AUUAC.mcs
MCSYM-DB/3_2/AUUAC/ds-3_2-AUUAC_x.pdb.gz
MCSYM-DB/3_2/AUUAG/
MCSYM-DB/3_2/AUUAG/3_2-AUUAG.mcs
MCSYM-DB/3_2/AUUAG/ds-3_2-AUUAG_x.pdb.gz
MCSYM-DB/3_2/AUUAU/
MCSYM-DB/3_2/AUUAU/3_2-AUUAU.mcs
MCSYM-DB/3_2/AUUAU/ds-3_2-AUUAU_x.pdb.gz
MCSYM-DB/3_2/AUUCA/
MCSYM-DB/3_2/AUUCA/3_2-AUUCA.mcs
MCSYM-DB/3_2/AUUCA/ds-3_2-AUUCA_x.pdb.gz
MCSYM-DB/3_2/AUUCC/
MCSYM-DB/3_2/AUUCC/3_2-AUUCC.mcs
MCSYM-DB/3_2/AUUCC/ds-3_2-AUUCC_x.pdb.gz
MCSYM-DB/3_2/AUUCG/
MCSYM-DB/3_2/AUUCG/3_2-AUUCG.mcs
MCSYM-DB/3_2/AUUCG/ds-3_2-AUUCG_x.pdb.gz
MCSYM-DB/3_2/AUUCU/
MCSYM-DB/3_2/AUUCU/3_2-AUUCU.mcs
MCSYM-DB/3_2/AUUCU/ds-3_2-AUUCU_x.pdb.gz
MCSYM-DB/3_2/AUUGA/
MCSYM-DB/3_2/AUUGA/3_2-AUUGA.mcs
MCSYM-DB/3_2/AUUGA/ds-3_2-AUUGA_x.pdb.gz
MCSYM-DB/3_2/AUUGC/
MCSYM-DB/3_2/AUUGC/3_2-AUUGC.mcs
MCSYM-DB/3_2/AUUGC/ds-3_2-AUUGC_x.pdb.gz
MCSYM-DB/3_2/AUUGG/
MCSYM-DB/3_2/AUUGG/3_2-AUUGG.mcs
MCSYM-DB/3_2/AUUGG/ds-3_2-AUUGG_x.pdb.gz
MCSYM-DB/3_2/AUUGU/
MCSYM-DB/3_2/AUUGU/3_2-AUUGU.mcs
MCSYM-DB/3_2/AUUGU/ds-3_2-AUUGU_x.pdb.gz
MCSYM-DB/3_2/AUUUA/
MCSYM-DB/3_2/AUUUA/3_2-AUUUA.mcs
MCSYM-DB/3_2/AUUUA/ds-3_2-AUUUA_x.pdb.gz
MCSYM-DB/3_2/AUUUC/
MCSYM-DB/3_2/AUUUC/3_2-AUUUC.mcs
MCSYM-DB/3_2/AUUUC/ds-3_2-AUUUC_x.pdb.gz
MCSYM-DB/3_2/AUUUG/
MCSYM-DB/3_2/AUUUG/3_2-AUUUG.mcs
MCSYM-DB/3_2/AUUUG/ds-3_2-AUUUG_x.pdb.gz
MCSYM-DB/3_2/AUUUU/
MCSYM-DB/3_2/AUUUU/3_2-AUUUU.mcs
MCSYM-DB/3_2/AUUUU/ds-3_2-AUUUU_x.pdb.gz
MCSYM-DB/3_2/CAAAA/
MCSYM-DB/3_2/CAAAA/3_2-CAAAA.mcs
MCSYM-DB/3_2/CAAAA/ds-3_2-CAAAA_x.pdb.gz
MCSYM-DB/3_2/CAAAC/
MCSYM-DB/3_2/CAAAC/3_2-CAAAC.mcs
MCSYM-DB/3_2/CAAAC/ds-3_2-CAAAC_x.pdb.gz
MCSYM-DB/3_2/CAAAG/
MCSYM-DB/3_2/CAAAG/1H3E_model_1.pdb.gz
MCSYM-DB/3_2/CAAAG/3_2-CAAAG.mcs
MCSYM-DB/3_2/CAAAG/ds-3_2-CAAAG_x.pdb.gz
MCSYM-DB/3_2/CAAAU/
MCSYM-DB/3_2/CAAAU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CAAAU/3_2-CAAAU.mcs
MCSYM-DB/3_2/CAAAU/ds-3_2-CAAAU_x.pdb.gz
MCSYM-DB/3_2/CAACA/
MCSYM-DB/3_2/CAACA/3_2-CAACA.mcs
MCSYM-DB/3_2/CAACA/ds-3_2-CAACA_x.pdb.gz
MCSYM-DB/3_2/CAACC/
MCSYM-DB/3_2/CAACC/3_2-CAACC.mcs
MCSYM-DB/3_2/CAACC/ds-3_2-CAACC_x.pdb.gz
MCSYM-DB/3_2/CAACG/
MCSYM-DB/3_2/CAACG/1KP7_model_1.pdb.gz
MCSYM-DB/3_2/CAACG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CAACG/3_2-CAACG.mcs
MCSYM-DB/3_2/CAACG/ds-3_2-CAACG_x.pdb.gz
MCSYM-DB/3_2/CAACU/
MCSYM-DB/3_2/CAACU/3_2-CAACU.mcs
MCSYM-DB/3_2/CAACU/ds-3_2-CAACU_x.pdb.gz
MCSYM-DB/3_2/CAAGA/
MCSYM-DB/3_2/CAAGA/3_2-CAAGA.mcs
MCSYM-DB/3_2/CAAGA/ds-3_2-CAAGA_x.pdb.gz
MCSYM-DB/3_2/CAAGC/
MCSYM-DB/3_2/CAAGC/3_2-CAAGC.mcs
MCSYM-DB/3_2/CAAGC/ds-3_2-CAAGC_x.pdb.gz
MCSYM-DB/3_2/CAAGG/
MCSYM-DB/3_2/CAAGG/3_2-CAAGG.mcs
MCSYM-DB/3_2/CAAGG/ds-3_2-CAAGG_x.pdb.gz
MCSYM-DB/3_2/CAAGU/
MCSYM-DB/3_2/CAAGU/3_2-CAAGU.mcs
MCSYM-DB/3_2/CAAGU/ds-3_2-CAAGU_x.pdb.gz
MCSYM-DB/3_2/CAAUA/
MCSYM-DB/3_2/CAAUA/3_2-CAAUA.mcs
MCSYM-DB/3_2/CAAUA/ds-3_2-CAAUA_x.pdb.gz
MCSYM-DB/3_2/CAAUC/
MCSYM-DB/3_2/CAAUC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CAAUC/3_2-CAAUC.mcs
MCSYM-DB/3_2/CAAUC/ds-3_2-CAAUC_x.pdb.gz
MCSYM-DB/3_2/CAAUG/
MCSYM-DB/3_2/CAAUG/1S03_model_1.pdb.gz
MCSYM-DB/3_2/CAAUG/3_2-CAAUG.mcs
MCSYM-DB/3_2/CAAUG/ds-3_2-CAAUG_x.pdb.gz
MCSYM-DB/3_2/CAAUU/
MCSYM-DB/3_2/CAAUU/3_2-CAAUU.mcs
MCSYM-DB/3_2/CAAUU/ds-3_2-CAAUU_x.pdb.gz
MCSYM-DB/3_2/CACAA/
MCSYM-DB/3_2/CACAA/3_2-CACAA.mcs
MCSYM-DB/3_2/CACAA/ds-3_2-CACAA_x.pdb.gz
MCSYM-DB/3_2/CACAC/
MCSYM-DB/3_2/CACAC/3_2-CACAC.mcs
MCSYM-DB/3_2/CACAC/ds-3_2-CACAC_x.pdb.gz
MCSYM-DB/3_2/CACAG/
MCSYM-DB/3_2/CACAG/3_2-CACAG.mcs
MCSYM-DB/3_2/CACAG/ds-3_2-CACAG_x.pdb.gz
MCSYM-DB/3_2/CACAU/
MCSYM-DB/3_2/CACAU/3_2-CACAU.mcs
MCSYM-DB/3_2/CACAU/ds-3_2-CACAU_x.pdb.gz
MCSYM-DB/3_2/CACCA/
MCSYM-DB/3_2/CACCA/3_2-CACCA.mcs
MCSYM-DB/3_2/CACCA/ds-3_2-CACCA_x.pdb.gz
MCSYM-DB/3_2/CACCC/
MCSYM-DB/3_2/CACCC/3_2-CACCC.mcs
MCSYM-DB/3_2/CACCC/ds-3_2-CACCC_x.pdb.gz
MCSYM-DB/3_2/CACCG/
MCSYM-DB/3_2/CACCG/3_2-CACCG.mcs
MCSYM-DB/3_2/CACCG/ds-3_2-CACCG_x.pdb.gz
MCSYM-DB/3_2/CACCU/
MCSYM-DB/3_2/CACCU/3_2-CACCU.mcs
MCSYM-DB/3_2/CACCU/ds-3_2-CACCU_x.pdb.gz
MCSYM-DB/3_2/CACGA/
MCSYM-DB/3_2/CACGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CACGA/3_2-CACGA.mcs
MCSYM-DB/3_2/CACGA/ds-3_2-CACGA_x.pdb.gz
MCSYM-DB/3_2/CACGC/
MCSYM-DB/3_2/CACGC/3_2-CACGC.mcs
MCSYM-DB/3_2/CACGC/ds-3_2-CACGC_x.pdb.gz
MCSYM-DB/3_2/CACGG/
MCSYM-DB/3_2/CACGG/1D0U_model_1.pdb.gz
MCSYM-DB/3_2/CACGG/1TOB_model_1.pdb.gz
MCSYM-DB/3_2/CACGG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CACGG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CACGG/3_2-CACGG.mcs
MCSYM-DB/3_2/CACGG/6MSF_model_1.pdb.gz
MCSYM-DB/3_2/CACGG/ds-3_2-CACGG_x.pdb.gz
MCSYM-DB/3_2/CACGU/
MCSYM-DB/3_2/CACGU/3_2-CACGU.mcs
MCSYM-DB/3_2/CACGU/ds-3_2-CACGU_x.pdb.gz
MCSYM-DB/3_2/CACUA/
MCSYM-DB/3_2/CACUA/3_2-CACUA.mcs
MCSYM-DB/3_2/CACUA/ds-3_2-CACUA_x.pdb.gz
MCSYM-DB/3_2/CACUC/
MCSYM-DB/3_2/CACUC/3_2-CACUC.mcs
MCSYM-DB/3_2/CACUC/ds-3_2-CACUC_x.pdb.gz
MCSYM-DB/3_2/CACUG/
MCSYM-DB/3_2/CACUG/3_2-CACUG.mcs
MCSYM-DB/3_2/CACUG/ds-3_2-CACUG_x.pdb.gz
MCSYM-DB/3_2/CACUU/
MCSYM-DB/3_2/CACUU/3_2-CACUU.mcs
MCSYM-DB/3_2/CACUU/ds-3_2-CACUU_x.pdb.gz
MCSYM-DB/3_2/CAGAA/
MCSYM-DB/3_2/CAGAA/3_2-CAGAA.mcs
MCSYM-DB/3_2/CAGAA/ds-3_2-CAGAA_x.pdb.gz
MCSYM-DB/3_2/CAGAC/
MCSYM-DB/3_2/CAGAC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CAGAC/3_2-CAGAC.mcs
MCSYM-DB/3_2/CAGAC/ds-3_2-CAGAC_x.pdb.gz
MCSYM-DB/3_2/CAGAG/
MCSYM-DB/3_2/CAGAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CAGAG/3_2-CAGAG.mcs
MCSYM-DB/3_2/CAGAG/ds-3_2-CAGAG_x.pdb.gz
MCSYM-DB/3_2/CAGAU/
MCSYM-DB/3_2/CAGAU/3_2-CAGAU.mcs
MCSYM-DB/3_2/CAGAU/ds-3_2-CAGAU_x.pdb.gz
MCSYM-DB/3_2/CAGCA/
MCSYM-DB/3_2/CAGCA/3_2-CAGCA.mcs
MCSYM-DB/3_2/CAGCA/ds-3_2-CAGCA_x.pdb.gz
MCSYM-DB/3_2/CAGCC/
MCSYM-DB/3_2/CAGCC/3_2-CAGCC.mcs
MCSYM-DB/3_2/CAGCC/ds-3_2-CAGCC_x.pdb.gz
MCSYM-DB/3_2/CAGCG/
MCSYM-DB/3_2/CAGCG/1K2G_model_1.pdb.gz
MCSYM-DB/3_2/CAGCG/1QC8_model_1.pdb.gz
MCSYM-DB/3_2/CAGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CAGCG/3_2-CAGCG.mcs
MCSYM-DB/3_2/CAGCG/ds-3_2-CAGCG_x.pdb.gz
MCSYM-DB/3_2/CAGCU/
MCSYM-DB/3_2/CAGCU/3_2-CAGCU.mcs
MCSYM-DB/3_2/CAGCU/ds-3_2-CAGCU_x.pdb.gz
MCSYM-DB/3_2/CAGGA/
MCSYM-DB/3_2/CAGGA/3_2-CAGGA.mcs
MCSYM-DB/3_2/CAGGA/ds-3_2-CAGGA_x.pdb.gz
MCSYM-DB/3_2/CAGGC/
MCSYM-DB/3_2/CAGGC/3_2-CAGGC.mcs
MCSYM-DB/3_2/CAGGC/ds-3_2-CAGGC_x.pdb.gz
MCSYM-DB/3_2/CAGGG/
MCSYM-DB/3_2/CAGGG/1M5L_model_1.pdb.gz
MCSYM-DB/3_2/CAGGG/3_2-CAGGG.mcs
MCSYM-DB/3_2/CAGGG/ds-3_2-CAGGG_x.pdb.gz
MCSYM-DB/3_2/CAGGU/
MCSYM-DB/3_2/CAGGU/3_2-CAGGU.mcs
MCSYM-DB/3_2/CAGGU/ds-3_2-CAGGU_x.pdb.gz
MCSYM-DB/3_2/CAGUA/
MCSYM-DB/3_2/CAGUA/3_2-CAGUA.mcs
MCSYM-DB/3_2/CAGUA/ds-3_2-CAGUA_x.pdb.gz
MCSYM-DB/3_2/CAGUC/
MCSYM-DB/3_2/CAGUC/1CQ5_model_1.pdb.gz
MCSYM-DB/3_2/CAGUC/3_2-CAGUC.mcs
MCSYM-DB/3_2/CAGUC/ds-3_2-CAGUC_x.pdb.gz
MCSYM-DB/3_2/CAGUG/
MCSYM-DB/3_2/CAGUG/3_2-CAGUG.mcs
MCSYM-DB/3_2/CAGUG/ds-3_2-CAGUG_x.pdb.gz
MCSYM-DB/3_2/CAGUU/
MCSYM-DB/3_2/CAGUU/3_2-CAGUU.mcs
MCSYM-DB/3_2/CAGUU/ds-3_2-CAGUU_x.pdb.gz
MCSYM-DB/3_2/CAUAA/
MCSYM-DB/3_2/CAUAA/3_2-CAUAA.mcs
MCSYM-DB/3_2/CAUAA/ds-3_2-CAUAA_x.pdb.gz
MCSYM-DB/3_2/CAUAC/
MCSYM-DB/3_2/CAUAC/3_2-CAUAC.mcs
MCSYM-DB/3_2/CAUAC/ds-3_2-CAUAC_x.pdb.gz
MCSYM-DB/3_2/CAUAG/
MCSYM-DB/3_2/CAUAG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CAUAG/3_2-CAUAG.mcs
MCSYM-DB/3_2/CAUAG/ds-3_2-CAUAG_x.pdb.gz
MCSYM-DB/3_2/CAUAU/
MCSYM-DB/3_2/CAUAU/3_2-CAUAU.mcs
MCSYM-DB/3_2/CAUAU/ds-3_2-CAUAU_x.pdb.gz
MCSYM-DB/3_2/CAUCA/
MCSYM-DB/3_2/CAUCA/3_2-CAUCA.mcs
MCSYM-DB/3_2/CAUCA/ds-3_2-CAUCA_x.pdb.gz
MCSYM-DB/3_2/CAUCC/
MCSYM-DB/3_2/CAUCC/3_2-CAUCC.mcs
MCSYM-DB/3_2/CAUCC/ds-3_2-CAUCC_x.pdb.gz
MCSYM-DB/3_2/CAUCG/
MCSYM-DB/3_2/CAUCG/3_2-CAUCG.mcs
MCSYM-DB/3_2/CAUCG/ds-3_2-CAUCG_x.pdb.gz
MCSYM-DB/3_2/CAUCU/
MCSYM-DB/3_2/CAUCU/3_2-CAUCU.mcs
MCSYM-DB/3_2/CAUCU/ds-3_2-CAUCU_x.pdb.gz
MCSYM-DB/3_2/CAUGA/
MCSYM-DB/3_2/CAUGA/3_2-CAUGA.mcs
MCSYM-DB/3_2/CAUGA/ds-3_2-CAUGA_x.pdb.gz
MCSYM-DB/3_2/CAUGC/
MCSYM-DB/3_2/CAUGC/3_2-CAUGC.mcs
MCSYM-DB/3_2/CAUGC/ds-3_2-CAUGC_x.pdb.gz
MCSYM-DB/3_2/CAUGG/
MCSYM-DB/3_2/CAUGG/3_2-CAUGG.mcs
MCSYM-DB/3_2/CAUGG/ds-3_2-CAUGG_x.pdb.gz
MCSYM-DB/3_2/CAUGU/
MCSYM-DB/3_2/CAUGU/3_2-CAUGU.mcs
MCSYM-DB/3_2/CAUGU/ds-3_2-CAUGU_x.pdb.gz
MCSYM-DB/3_2/CAUUA/
MCSYM-DB/3_2/CAUUA/3_2-CAUUA.mcs
MCSYM-DB/3_2/CAUUA/ds-3_2-CAUUA_x.pdb.gz
MCSYM-DB/3_2/CAUUC/
MCSYM-DB/3_2/CAUUC/3_2-CAUUC.mcs
MCSYM-DB/3_2/CAUUC/ds-3_2-CAUUC_x.pdb.gz
MCSYM-DB/3_2/CAUUG/
MCSYM-DB/3_2/CAUUG/3_2-CAUUG.mcs
MCSYM-DB/3_2/CAUUG/ds-3_2-CAUUG_x.pdb.gz
MCSYM-DB/3_2/CAUUU/
MCSYM-DB/3_2/CAUUU/3_2-CAUUU.mcs
MCSYM-DB/3_2/CAUUU/ds-3_2-CAUUU_x.pdb.gz
MCSYM-DB/3_2/CCAAA/
MCSYM-DB/3_2/CCAAA/3_2-CCAAA.mcs
MCSYM-DB/3_2/CCAAA/ds-3_2-CCAAA_x.pdb.gz
MCSYM-DB/3_2/CCAAC/
MCSYM-DB/3_2/CCAAC/3_2-CCAAC.mcs
MCSYM-DB/3_2/CCAAC/ds-3_2-CCAAC_x.pdb.gz
MCSYM-DB/3_2/CCAAG/
MCSYM-DB/3_2/CCAAG/3_2-CCAAG.mcs
MCSYM-DB/3_2/CCAAG/ds-3_2-CCAAG_x.pdb.gz
MCSYM-DB/3_2/CCAAU/
MCSYM-DB/3_2/CCAAU/3_2-CCAAU.mcs
MCSYM-DB/3_2/CCAAU/ds-3_2-CCAAU_x.pdb.gz
MCSYM-DB/3_2/CCACA/
MCSYM-DB/3_2/CCACA/3_2-CCACA.mcs
MCSYM-DB/3_2/CCACA/ds-3_2-CCACA_x.pdb.gz
MCSYM-DB/3_2/CCACC/
MCSYM-DB/3_2/CCACC/3_2-CCACC.mcs
MCSYM-DB/3_2/CCACC/ds-3_2-CCACC_x.pdb.gz
MCSYM-DB/3_2/CCACG/
MCSYM-DB/3_2/CCACG/3_2-CCACG.mcs
MCSYM-DB/3_2/CCACG/ds-3_2-CCACG_x.pdb.gz
MCSYM-DB/3_2/CCACU/
MCSYM-DB/3_2/CCACU/3_2-CCACU.mcs
MCSYM-DB/3_2/CCACU/ds-3_2-CCACU_x.pdb.gz
MCSYM-DB/3_2/CCAGA/
MCSYM-DB/3_2/CCAGA/3_2-CCAGA.mcs
MCSYM-DB/3_2/CCAGA/ds-3_2-CCAGA_x.pdb.gz
MCSYM-DB/3_2/CCAGC/
MCSYM-DB/3_2/CCAGC/3_2-CCAGC.mcs
MCSYM-DB/3_2/CCAGC/ds-3_2-CCAGC_x.pdb.gz
MCSYM-DB/3_2/CCAGG/
MCSYM-DB/3_2/CCAGG/3_2-CCAGG.mcs
MCSYM-DB/3_2/CCAGG/ds-3_2-CCAGG_x.pdb.gz
MCSYM-DB/3_2/CCAGU/
MCSYM-DB/3_2/CCAGU/3_2-CCAGU.mcs
MCSYM-DB/3_2/CCAGU/ds-3_2-CCAGU_x.pdb.gz
MCSYM-DB/3_2/CCAUA/
MCSYM-DB/3_2/CCAUA/3_2-CCAUA.mcs
MCSYM-DB/3_2/CCAUA/ds-3_2-CCAUA_x.pdb.gz
MCSYM-DB/3_2/CCAUC/
MCSYM-DB/3_2/CCAUC/3_2-CCAUC.mcs
MCSYM-DB/3_2/CCAUC/ds-3_2-CCAUC_x.pdb.gz
MCSYM-DB/3_2/CCAUG/
MCSYM-DB/3_2/CCAUG/1DDY_model_1.pdb.gz
MCSYM-DB/3_2/CCAUG/3_2-CCAUG.mcs
MCSYM-DB/3_2/CCAUG/ds-3_2-CCAUG_x.pdb
MCSYM-DB/3_2/CCAUG/ds-3_2-CCAUG_x.pdb.gz
MCSYM-DB/3_2/CCAUU/
MCSYM-DB/3_2/CCAUU/3_2-CCAUU.mcs
MCSYM-DB/3_2/CCAUU/ds-3_2-CCAUU_x.pdb.gz
MCSYM-DB/3_2/CCCAA/
MCSYM-DB/3_2/CCCAA/3_2-CCCAA.mcs
MCSYM-DB/3_2/CCCAA/ds-3_2-CCCAA_x.pdb.gz
MCSYM-DB/3_2/CCCAC/
MCSYM-DB/3_2/CCCAC/3_2-CCCAC.mcs
MCSYM-DB/3_2/CCCAC/ds-3_2-CCCAC_x.pdb.gz
MCSYM-DB/3_2/CCCAG/
MCSYM-DB/3_2/CCCAG/3_2-CCCAG.mcs
MCSYM-DB/3_2/CCCAG/ds-3_2-CCCAG_x.pdb.gz
MCSYM-DB/3_2/CCCAU/
MCSYM-DB/3_2/CCCAU/3_2-CCCAU.mcs
MCSYM-DB/3_2/CCCAU/ds-3_2-CCCAU_x.pdb.gz
MCSYM-DB/3_2/CCCCA/
MCSYM-DB/3_2/CCCCA/3_2-CCCCA.mcs
MCSYM-DB/3_2/CCCCA/ds-3_2-CCCCA_x.pdb.gz
MCSYM-DB/3_2/CCCCC/
MCSYM-DB/3_2/CCCCC/3_2-CCCCC.mcs
MCSYM-DB/3_2/CCCCC/ds-3_2-CCCCC_x.pdb.gz
MCSYM-DB/3_2/CCCCG/
MCSYM-DB/3_2/CCCCG/3_2-CCCCG.mcs
MCSYM-DB/3_2/CCCCG/ds-3_2-CCCCG_x.pdb.gz
MCSYM-DB/3_2/CCCCU/
MCSYM-DB/3_2/CCCCU/3_2-CCCCU.mcs
MCSYM-DB/3_2/CCCCU/ds-3_2-CCCCU_x.pdb.gz
MCSYM-DB/3_2/CCCGA/
MCSYM-DB/3_2/CCCGA/3_2-CCCGA.mcs
MCSYM-DB/3_2/CCCGA/ds-3_2-CCCGA_x.pdb.gz
MCSYM-DB/3_2/CCCGC/
MCSYM-DB/3_2/CCCGC/3_2-CCCGC.mcs
MCSYM-DB/3_2/CCCGC/ds-3_2-CCCGC_x.pdb.gz
MCSYM-DB/3_2/CCCGG/
MCSYM-DB/3_2/CCCGG/1G1X_model_1.pdb.gz
MCSYM-DB/3_2/CCCGG/1KUQ_model_1.pdb.gz
MCSYM-DB/3_2/CCCGG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CCCGG/3_2-CCCGG.mcs
MCSYM-DB/3_2/CCCGG/ds-3_2-CCCGG_x.pdb.gz
MCSYM-DB/3_2/CCCGU/
MCSYM-DB/3_2/CCCGU/3_2-CCCGU.mcs
MCSYM-DB/3_2/CCCGU/ds-3_2-CCCGU_x.pdb.gz
MCSYM-DB/3_2/CCCUA/
MCSYM-DB/3_2/CCCUA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CCCUA/3_2-CCCUA.mcs
MCSYM-DB/3_2/CCCUA/ds-3_2-CCCUA_x.pdb.gz
MCSYM-DB/3_2/CCCUC/
MCSYM-DB/3_2/CCCUC/3_2-CCCUC.mcs
MCSYM-DB/3_2/CCCUC/ds-3_2-CCCUC_x.pdb.gz
MCSYM-DB/3_2/CCCUG/
MCSYM-DB/3_2/CCCUG/3_2-CCCUG.mcs
MCSYM-DB/3_2/CCCUG/ds-3_2-CCCUG_x.pdb.gz
MCSYM-DB/3_2/CCCUU/
MCSYM-DB/3_2/CCCUU/3_2-CCCUU.mcs
MCSYM-DB/3_2/CCCUU/ds-3_2-CCCUU_x.pdb.gz
MCSYM-DB/3_2/CCGAA/
MCSYM-DB/3_2/CCGAA/3_2-CCGAA.mcs
MCSYM-DB/3_2/CCGAA/ds-3_2-CCGAA_x.pdb.gz
MCSYM-DB/3_2/CCGAC/
MCSYM-DB/3_2/CCGAC/3_2-CCGAC.mcs
MCSYM-DB/3_2/CCGAC/ds-3_2-CCGAC_x.pdb.gz
MCSYM-DB/3_2/CCGAG/
MCSYM-DB/3_2/CCGAG/3_2-CCGAG.mcs
MCSYM-DB/3_2/CCGAG/ds-3_2-CCGAG_x.pdb.gz
MCSYM-DB/3_2/CCGAU/
MCSYM-DB/3_2/CCGAU/3_2-CCGAU.mcs
MCSYM-DB/3_2/CCGAU/ds-3_2-CCGAU_x.pdb.gz
MCSYM-DB/3_2/CCGCA/
MCSYM-DB/3_2/CCGCA/3_2-CCGCA.mcs
MCSYM-DB/3_2/CCGCA/ds-3_2-CCGCA_x.pdb.gz
MCSYM-DB/3_2/CCGCC/
MCSYM-DB/3_2/CCGCC/3_2-CCGCC.mcs
MCSYM-DB/3_2/CCGCC/ds-3_2-CCGCC_x.pdb.gz
MCSYM-DB/3_2/CCGCG/
MCSYM-DB/3_2/CCGCG/3_2-CCGCG.mcs
MCSYM-DB/3_2/CCGCG/ds-3_2-CCGCG_x.pdb.gz
MCSYM-DB/3_2/CCGCU/
MCSYM-DB/3_2/CCGCU/3_2-CCGCU.mcs
MCSYM-DB/3_2/CCGCU/ds-3_2-CCGCU_x.pdb.gz
MCSYM-DB/3_2/CCGGA/
MCSYM-DB/3_2/CCGGA/3_2-CCGGA.mcs
MCSYM-DB/3_2/CCGGA/ds-3_2-CCGGA_x.pdb.gz
MCSYM-DB/3_2/CCGGC/
MCSYM-DB/3_2/CCGGC/3_2-CCGGC.mcs
MCSYM-DB/3_2/CCGGC/ds-3_2-CCGGC_x.pdb.gz
MCSYM-DB/3_2/CCGGG/
MCSYM-DB/3_2/CCGGG/1KAJ_model_1.pdb.gz
MCSYM-DB/3_2/CCGGG/3_2-CCGGG.mcs
MCSYM-DB/3_2/CCGGG/ds-3_2-CCGGG_x.pdb.gz
MCSYM-DB/3_2/CCGGU/
MCSYM-DB/3_2/CCGGU/3_2-CCGGU.mcs
MCSYM-DB/3_2/CCGGU/ds-3_2-CCGGU_x.pdb.gz
MCSYM-DB/3_2/CCGUA/
MCSYM-DB/3_2/CCGUA/3_2-CCGUA.mcs
MCSYM-DB/3_2/CCGUA/ds-3_2-CCGUA_x.pdb.gz
MCSYM-DB/3_2/CCGUC/
MCSYM-DB/3_2/CCGUC/3_2-CCGUC.mcs
MCSYM-DB/3_2/CCGUC/ds-3_2-CCGUC_x.pdb.gz
MCSYM-DB/3_2/CCGUG/
MCSYM-DB/3_2/CCGUG/3_2-CCGUG.mcs
MCSYM-DB/3_2/CCGUG/ds-3_2-CCGUG_x.pdb.gz
MCSYM-DB/3_2/CCGUU/
MCSYM-DB/3_2/CCGUU/3_2-CCGUU.mcs
MCSYM-DB/3_2/CCGUU/ds-3_2-CCGUU_x.pdb.gz
MCSYM-DB/3_2/CCUAA/
MCSYM-DB/3_2/CCUAA/3_2-CCUAA.mcs
MCSYM-DB/3_2/CCUAA/ds-3_2-CCUAA_x.pdb.gz
MCSYM-DB/3_2/CCUAC/
MCSYM-DB/3_2/CCUAC/3_2-CCUAC.mcs
MCSYM-DB/3_2/CCUAC/ds-3_2-CCUAC_x.pdb.gz
MCSYM-DB/3_2/CCUAG/
MCSYM-DB/3_2/CCUAG/1P5O_model_1.pdb.gz
MCSYM-DB/3_2/CCUAG/3_2-CCUAG.mcs
MCSYM-DB/3_2/CCUAG/ds-3_2-CCUAG_x.pdb.gz
MCSYM-DB/3_2/CCUAU/
MCSYM-DB/3_2/CCUAU/3_2-CCUAU.mcs
MCSYM-DB/3_2/CCUAU/ds-3_2-CCUAU_x.pdb.gz
MCSYM-DB/3_2/CCUCA/
MCSYM-DB/3_2/CCUCA/3_2-CCUCA.mcs
MCSYM-DB/3_2/CCUCA/ds-3_2-CCUCA_x.pdb.gz
MCSYM-DB/3_2/CCUCC/
MCSYM-DB/3_2/CCUCC/3_2-CCUCC.mcs
MCSYM-DB/3_2/CCUCC/ds-3_2-CCUCC_x.pdb.gz
MCSYM-DB/3_2/CCUCG/
MCSYM-DB/3_2/CCUCG/3_2-CCUCG.mcs
MCSYM-DB/3_2/CCUCG/ds-3_2-CCUCG_x.pdb.gz
MCSYM-DB/3_2/CCUCU/
MCSYM-DB/3_2/CCUCU/3_2-CCUCU.mcs
MCSYM-DB/3_2/CCUCU/ds-3_2-CCUCU_x.pdb.gz
MCSYM-DB/3_2/CCUGA/
MCSYM-DB/3_2/CCUGA/3_2-CCUGA.mcs
MCSYM-DB/3_2/CCUGA/ds-3_2-CCUGA_x.pdb.gz
MCSYM-DB/3_2/CCUGC/
MCSYM-DB/3_2/CCUGC/3_2-CCUGC.mcs
MCSYM-DB/3_2/CCUGC/ds-3_2-CCUGC_x.pdb.gz
MCSYM-DB/3_2/CCUGG/
MCSYM-DB/3_2/CCUGG/3_2-CCUGG.mcs
MCSYM-DB/3_2/CCUGG/ds-3_2-CCUGG_x.pdb.gz
MCSYM-DB/3_2/CCUGU/
MCSYM-DB/3_2/CCUGU/3_2-CCUGU.mcs
MCSYM-DB/3_2/CCUGU/ds-3_2-CCUGU_x.pdb.gz
MCSYM-DB/3_2/CCUUA/
MCSYM-DB/3_2/CCUUA/3_2-CCUUA.mcs
MCSYM-DB/3_2/CCUUA/ds-3_2-CCUUA_x.pdb.gz
MCSYM-DB/3_2/CCUUC/
MCSYM-DB/3_2/CCUUC/3_2-CCUUC.mcs
MCSYM-DB/3_2/CCUUC/ds-3_2-CCUUC_x.pdb.gz
MCSYM-DB/3_2/CCUUG/
MCSYM-DB/3_2/CCUUG/3_2-CCUUG.mcs
MCSYM-DB/3_2/CCUUG/ds-3_2-CCUUG_x.pdb.gz
MCSYM-DB/3_2/CCUUU/
MCSYM-DB/3_2/CCUUU/3_2-CCUUU.mcs
MCSYM-DB/3_2/CCUUU/ds-3_2-CCUUU_x.pdb.gz
MCSYM-DB/3_2/CGAAA/
MCSYM-DB/3_2/CGAAA/3_2-CGAAA.mcs
MCSYM-DB/3_2/CGAAA/ds-3_2-CGAAA_x.pdb.gz
MCSYM-DB/3_2/CGAAC/
MCSYM-DB/3_2/CGAAC/3_2-CGAAC.mcs
MCSYM-DB/3_2/CGAAC/ds-3_2-CGAAC_x.pdb.gz
MCSYM-DB/3_2/CGAAG/
MCSYM-DB/3_2/CGAAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CGAAG/3_2-CGAAG.mcs
MCSYM-DB/3_2/CGAAG/ds-3_2-CGAAG_x.pdb.gz
MCSYM-DB/3_2/CGAAU/
MCSYM-DB/3_2/CGAAU/1DDY_model_1.pdb.gz
MCSYM-DB/3_2/CGAAU/1ET4_model_1.pdb.gz
MCSYM-DB/3_2/CGAAU/3_2-CGAAU.mcs
MCSYM-DB/3_2/CGAAU/ds-3_2-CGAAU_x.pdb.gz
MCSYM-DB/3_2/CGACA/
MCSYM-DB/3_2/CGACA/3_2-CGACA.mcs
MCSYM-DB/3_2/CGACA/ds-3_2-CGACA_x.pdb.gz
MCSYM-DB/3_2/CGACC/
MCSYM-DB/3_2/CGACC/3_2-CGACC.mcs
MCSYM-DB/3_2/CGACC/ds-3_2-CGACC_x.pdb.gz
MCSYM-DB/3_2/CGACG/
MCSYM-DB/3_2/CGACG/3_2-CGACG.mcs
MCSYM-DB/3_2/CGACG/ds-3_2-CGACG_x.pdb.gz
MCSYM-DB/3_2/CGACU/
MCSYM-DB/3_2/CGACU/3_2-CGACU.mcs
MCSYM-DB/3_2/CGACU/ds-3_2-CGACU_x.pdb.gz
MCSYM-DB/3_2/CGAGA/
MCSYM-DB/3_2/CGAGA/3_2-CGAGA.mcs
MCSYM-DB/3_2/CGAGA/ds-3_2-CGAGA_x.pdb.gz
MCSYM-DB/3_2/CGAGC/
MCSYM-DB/3_2/CGAGC/3_2-CGAGC.mcs
MCSYM-DB/3_2/CGAGC/ds-3_2-CGAGC_x.pdb.gz
MCSYM-DB/3_2/CGAGG/
MCSYM-DB/3_2/CGAGG/3_2-CGAGG.mcs
MCSYM-DB/3_2/CGAGG/ds-3_2-CGAGG_x.pdb.gz
MCSYM-DB/3_2/CGAGU/
MCSYM-DB/3_2/CGAGU/3_2-CGAGU.mcs
MCSYM-DB/3_2/CGAGU/ds-3_2-CGAGU_x.pdb.gz
MCSYM-DB/3_2/CGAUA/
MCSYM-DB/3_2/CGAUA/3_2-CGAUA.mcs
MCSYM-DB/3_2/CGAUA/ds-3_2-CGAUA_x.pdb.gz
MCSYM-DB/3_2/CGAUC/
MCSYM-DB/3_2/CGAUC/3_2-CGAUC.mcs
MCSYM-DB/3_2/CGAUC/ds-3_2-CGAUC_x.pdb.gz
MCSYM-DB/3_2/CGAUG/
MCSYM-DB/3_2/CGAUG/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/CGAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CGAUG/3_2-CGAUG.mcs
MCSYM-DB/3_2/CGAUG/ds-3_2-CGAUG_x.pdb.gz
MCSYM-DB/3_2/CGAUU/
MCSYM-DB/3_2/CGAUU/3_2-CGAUU.mcs
MCSYM-DB/3_2/CGAUU/ds-3_2-CGAUU_x.pdb.gz
MCSYM-DB/3_2/CGCAA/
MCSYM-DB/3_2/CGCAA/3_2-CGCAA.mcs
MCSYM-DB/3_2/CGCAA/ds-3_2-CGCAA_x.pdb.gz
MCSYM-DB/3_2/CGCAC/
MCSYM-DB/3_2/CGCAC/3_2-CGCAC.mcs
MCSYM-DB/3_2/CGCAC/ds-3_2-CGCAC_x.pdb.gz
MCSYM-DB/3_2/CGCAG/
MCSYM-DB/3_2/CGCAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CGCAG/3_2-CGCAG.mcs
MCSYM-DB/3_2/CGCAG/ds-3_2-CGCAG_x.pdb.gz
MCSYM-DB/3_2/CGCAU/
MCSYM-DB/3_2/CGCAU/3_2-CGCAU.mcs
MCSYM-DB/3_2/CGCAU/ds-3_2-CGCAU_x.pdb.gz
MCSYM-DB/3_2/CGCCA/
MCSYM-DB/3_2/CGCCA/3_2-CGCCA.mcs
MCSYM-DB/3_2/CGCCA/ds-3_2-CGCCA_x.pdb.gz
MCSYM-DB/3_2/CGCCC/
MCSYM-DB/3_2/CGCCC/3_2-CGCCC.mcs
MCSYM-DB/3_2/CGCCC/ds-3_2-CGCCC_x.pdb.gz
MCSYM-DB/3_2/CGCCG/
MCSYM-DB/3_2/CGCCG/3_2-CGCCG.mcs
MCSYM-DB/3_2/CGCCG/ds-3_2-CGCCG_x.pdb.gz
MCSYM-DB/3_2/CGCCU/
MCSYM-DB/3_2/CGCCU/3_2-CGCCU.mcs
MCSYM-DB/3_2/CGCCU/ds-3_2-CGCCU_x.pdb.gz
MCSYM-DB/3_2/CGCGA/
MCSYM-DB/3_2/CGCGA/3_2-CGCGA.mcs
MCSYM-DB/3_2/CGCGA/ds-3_2-CGCGA_x.pdb.gz
MCSYM-DB/3_2/CGCGC/
MCSYM-DB/3_2/CGCGC/3_2-CGCGC.mcs
MCSYM-DB/3_2/CGCGC/ds-3_2-CGCGC_x.pdb.gz
MCSYM-DB/3_2/CGCGG/
MCSYM-DB/3_2/CGCGG/1GKW_model_1.pdb.gz
MCSYM-DB/3_2/CGCGG/1K2G_model_1.pdb.gz
MCSYM-DB/3_2/CGCGG/1NTA_model_1.pdb.gz
MCSYM-DB/3_2/CGCGG/3_2-CGCGG.mcs
MCSYM-DB/3_2/CGCGG/ds-3_2-CGCGG_x.pdb.gz
MCSYM-DB/3_2/CGCGU/
MCSYM-DB/3_2/CGCGU/3_2-CGCGU.mcs
MCSYM-DB/3_2/CGCGU/ds-3_2-CGCGU_x.pdb.gz
MCSYM-DB/3_2/CGCUA/
MCSYM-DB/3_2/CGCUA/3_2-CGCUA.mcs
MCSYM-DB/3_2/CGCUA/ds-3_2-CGCUA_x.pdb.gz
MCSYM-DB/3_2/CGCUC/
MCSYM-DB/3_2/CGCUC/3_2-CGCUC.mcs
MCSYM-DB/3_2/CGCUC/ds-3_2-CGCUC_x.pdb.gz
MCSYM-DB/3_2/CGCUG/
MCSYM-DB/3_2/CGCUG/3_2-CGCUG.mcs
MCSYM-DB/3_2/CGCUG/ds-3_2-CGCUG_x.pdb.gz
MCSYM-DB/3_2/CGCUU/
MCSYM-DB/3_2/CGCUU/3_2-CGCUU.mcs
MCSYM-DB/3_2/CGCUU/ds-3_2-CGCUU_x.pdb.gz
MCSYM-DB/3_2/CGGAA/
MCSYM-DB/3_2/CGGAA/3_2-CGGAA.mcs
MCSYM-DB/3_2/CGGAA/ds-3_2-CGGAA_x.pdb.gz
MCSYM-DB/3_2/CGGAC/
MCSYM-DB/3_2/CGGAC/3_2-CGGAC.mcs
MCSYM-DB/3_2/CGGAC/ds-3_2-CGGAC_x.pdb.gz
MCSYM-DB/3_2/CGGAG/
MCSYM-DB/3_2/CGGAG/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/CGGAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CGGAG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CGGAG/3_2-CGGAG.mcs
MCSYM-DB/3_2/CGGAG/ds-3_2-CGGAG_x.pdb.gz
MCSYM-DB/3_2/CGGAU/
MCSYM-DB/3_2/CGGAU/3_2-CGGAU.mcs
MCSYM-DB/3_2/CGGAU/ds-3_2-CGGAU_x.pdb.gz
MCSYM-DB/3_2/CGGCA/
MCSYM-DB/3_2/CGGCA/3_2-CGGCA.mcs
MCSYM-DB/3_2/CGGCA/ds-3_2-CGGCA_x.pdb.gz
MCSYM-DB/3_2/CGGCC/
MCSYM-DB/3_2/CGGCC/3_2-CGGCC.mcs
MCSYM-DB/3_2/CGGCC/ds-3_2-CGGCC_x.pdb.gz
MCSYM-DB/3_2/CGGCG/
MCSYM-DB/3_2/CGGCG/1Z43_model_1.pdb.gz
MCSYM-DB/3_2/CGGCG/3_2-CGGCG.mcs
MCSYM-DB/3_2/CGGCG/ds-3_2-CGGCG_x.pdb.gz
MCSYM-DB/3_2/CGGCU/
MCSYM-DB/3_2/CGGCU/3_2-CGGCU.mcs
MCSYM-DB/3_2/CGGCU/ds-3_2-CGGCU_x.pdb.gz
MCSYM-DB/3_2/CGGGA/
MCSYM-DB/3_2/CGGGA/3_2-CGGGA.mcs
MCSYM-DB/3_2/CGGGA/ds-3_2-CGGGA_x.pdb.gz
MCSYM-DB/3_2/CGGGC/
MCSYM-DB/3_2/CGGGC/3_2-CGGGC.mcs
MCSYM-DB/3_2/CGGGC/ds-3_2-CGGGC_x.pdb.gz
MCSYM-DB/3_2/CGGGG/
MCSYM-DB/3_2/CGGGG/3_2-CGGGG.mcs
MCSYM-DB/3_2/CGGGG/ds-3_2-CGGGG_x.pdb.gz
MCSYM-DB/3_2/CGGGU/
MCSYM-DB/3_2/CGGGU/3_2-CGGGU.mcs
MCSYM-DB/3_2/CGGGU/ds-3_2-CGGGU_x.pdb.gz
MCSYM-DB/3_2/CGGUA/
MCSYM-DB/3_2/CGGUA/3_2-CGGUA.mcs
MCSYM-DB/3_2/CGGUA/ds-3_2-CGGUA_x.pdb.gz
MCSYM-DB/3_2/CGGUC/
MCSYM-DB/3_2/CGGUC/3_2-CGGUC.mcs
MCSYM-DB/3_2/CGGUC/ds-3_2-CGGUC_x.pdb.gz
MCSYM-DB/3_2/CGGUG/
MCSYM-DB/3_2/CGGUG/3_2-CGGUG.mcs
MCSYM-DB/3_2/CGGUG/ds-3_2-CGGUG_x.pdb.gz
MCSYM-DB/3_2/CGGUU/
MCSYM-DB/3_2/CGGUU/3_2-CGGUU.mcs
MCSYM-DB/3_2/CGGUU/ds-3_2-CGGUU_x.pdb.gz
MCSYM-DB/3_2/CGUAA/
MCSYM-DB/3_2/CGUAA/3_2-CGUAA.mcs
MCSYM-DB/3_2/CGUAA/ds-3_2-CGUAA_x.pdb.gz
MCSYM-DB/3_2/CGUAC/
MCSYM-DB/3_2/CGUAC/3_2-CGUAC.mcs
MCSYM-DB/3_2/CGUAC/ds-3_2-CGUAC_x.pdb.gz
MCSYM-DB/3_2/CGUAG/
MCSYM-DB/3_2/CGUAG/1F5U_model_1.pdb.gz
MCSYM-DB/3_2/CGUAG/3_2-CGUAG.mcs
MCSYM-DB/3_2/CGUAG/ds-3_2-CGUAG_x.pdb.gz
MCSYM-DB/3_2/CGUAU/
MCSYM-DB/3_2/CGUAU/3_2-CGUAU.mcs
MCSYM-DB/3_2/CGUAU/ds-3_2-CGUAU_x.pdb.gz
MCSYM-DB/3_2/CGUCA/
MCSYM-DB/3_2/CGUCA/3_2-CGUCA.mcs
MCSYM-DB/3_2/CGUCA/ds-3_2-CGUCA_x.pdb.gz
MCSYM-DB/3_2/CGUCC/
MCSYM-DB/3_2/CGUCC/3_2-CGUCC.mcs
MCSYM-DB/3_2/CGUCC/ds-3_2-CGUCC_x.pdb.gz
MCSYM-DB/3_2/CGUCG/
MCSYM-DB/3_2/CGUCG/3_2-CGUCG.mcs
MCSYM-DB/3_2/CGUCG/ds-3_2-CGUCG_x.pdb.gz
MCSYM-DB/3_2/CGUCU/
MCSYM-DB/3_2/CGUCU/3_2-CGUCU.mcs
MCSYM-DB/3_2/CGUCU/ds-3_2-CGUCU_x.pdb.gz
MCSYM-DB/3_2/CGUGA/
MCSYM-DB/3_2/CGUGA/3_2-CGUGA.mcs
MCSYM-DB/3_2/CGUGA/ds-3_2-CGUGA_x.pdb.gz
MCSYM-DB/3_2/CGUGC/
MCSYM-DB/3_2/CGUGC/3_2-CGUGC.mcs
MCSYM-DB/3_2/CGUGC/ds-3_2-CGUGC_x.pdb.gz
MCSYM-DB/3_2/CGUGG/
MCSYM-DB/3_2/CGUGG/3_2-CGUGG.mcs
MCSYM-DB/3_2/CGUGG/ds-3_2-CGUGG_x.pdb.gz
MCSYM-DB/3_2/CGUGU/
MCSYM-DB/3_2/CGUGU/3_2-CGUGU.mcs
MCSYM-DB/3_2/CGUGU/ds-3_2-CGUGU_x.pdb.gz
MCSYM-DB/3_2/CGUUA/
MCSYM-DB/3_2/CGUUA/3_2-CGUUA.mcs
MCSYM-DB/3_2/CGUUA/ds-3_2-CGUUA_x.pdb.gz
MCSYM-DB/3_2/CGUUC/
MCSYM-DB/3_2/CGUUC/3_2-CGUUC.mcs
MCSYM-DB/3_2/CGUUC/ds-3_2-CGUUC_x.pdb.gz
MCSYM-DB/3_2/CGUUG/
MCSYM-DB/3_2/CGUUG/3_2-CGUUG.mcs
MCSYM-DB/3_2/CGUUG/ds-3_2-CGUUG_x.pdb.gz
MCSYM-DB/3_2/CGUUU/
MCSYM-DB/3_2/CGUUU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CGUUU/3_2-CGUUU.mcs
MCSYM-DB/3_2/CGUUU/ds-3_2-CGUUU_x.pdb.gz
MCSYM-DB/3_2/CUAAA/
MCSYM-DB/3_2/CUAAA/3_2-CUAAA.mcs
MCSYM-DB/3_2/CUAAA/ds-3_2-CUAAA_x.pdb.gz
MCSYM-DB/3_2/CUAAC/
MCSYM-DB/3_2/CUAAC/3_2-CUAAC.mcs
MCSYM-DB/3_2/CUAAC/ds-3_2-CUAAC_x.pdb.gz
MCSYM-DB/3_2/CUAAG/
MCSYM-DB/3_2/CUAAG/3_2-CUAAG.mcs
MCSYM-DB/3_2/CUAAG/ds-3_2-CUAAG_x.pdb.gz
MCSYM-DB/3_2/CUAAU/
MCSYM-DB/3_2/CUAAU/3_2-CUAAU.mcs
MCSYM-DB/3_2/CUAAU/ds-3_2-CUAAU_x.pdb.gz
MCSYM-DB/3_2/CUACA/
MCSYM-DB/3_2/CUACA/3_2-CUACA.mcs
MCSYM-DB/3_2/CUACA/ds-3_2-CUACA_x.pdb.gz
MCSYM-DB/3_2/CUACC/
MCSYM-DB/3_2/CUACC/3_2-CUACC.mcs
MCSYM-DB/3_2/CUACC/ds-3_2-CUACC_x.pdb.gz
MCSYM-DB/3_2/CUACG/
MCSYM-DB/3_2/CUACG/3_2-CUACG.mcs
MCSYM-DB/3_2/CUACG/ds-3_2-CUACG_x.pdb.gz
MCSYM-DB/3_2/CUACU/
MCSYM-DB/3_2/CUACU/3_2-CUACU.mcs
MCSYM-DB/3_2/CUACU/ds-3_2-CUACU_x.pdb.gz
MCSYM-DB/3_2/CUAGA/
MCSYM-DB/3_2/CUAGA/3_2-CUAGA.mcs
MCSYM-DB/3_2/CUAGA/ds-3_2-CUAGA_x.pdb.gz
MCSYM-DB/3_2/CUAGC/
MCSYM-DB/3_2/CUAGC/3_2-CUAGC.mcs
MCSYM-DB/3_2/CUAGC/ds-3_2-CUAGC_x.pdb.gz
MCSYM-DB/3_2/CUAGG/
MCSYM-DB/3_2/CUAGG/3_2-CUAGG.mcs
MCSYM-DB/3_2/CUAGG/ds-3_2-CUAGG_x.pdb.gz
MCSYM-DB/3_2/CUAGU/
MCSYM-DB/3_2/CUAGU/3_2-CUAGU.mcs
MCSYM-DB/3_2/CUAGU/ds-3_2-CUAGU_x.pdb.gz
MCSYM-DB/3_2/CUAUA/
MCSYM-DB/3_2/CUAUA/3_2-CUAUA.mcs
MCSYM-DB/3_2/CUAUA/ds-3_2-CUAUA_x.pdb.gz
MCSYM-DB/3_2/CUAUC/
MCSYM-DB/3_2/CUAUC/3_2-CUAUC.mcs
MCSYM-DB/3_2/CUAUC/ds-3_2-CUAUC_x.pdb.gz
MCSYM-DB/3_2/CUAUG/
MCSYM-DB/3_2/CUAUG/3_2-CUAUG.mcs
MCSYM-DB/3_2/CUAUG/ds-3_2-CUAUG.pdb.gz
MCSYM-DB/3_2/CUAUG/ds-3_2-CUAUG_x.pdb.gz
MCSYM-DB/3_2/CUAUU/
MCSYM-DB/3_2/CUAUU/3_2-CUAUU.mcs
MCSYM-DB/3_2/CUAUU/ds-3_2-CUAUU_x.pdb.gz
MCSYM-DB/3_2/CUCAA/
MCSYM-DB/3_2/CUCAA/3_2-CUCAA.mcs
MCSYM-DB/3_2/CUCAA/ds-3_2-CUCAA_x.pdb.gz
MCSYM-DB/3_2/CUCAC/
MCSYM-DB/3_2/CUCAC/3_2-CUCAC.mcs
MCSYM-DB/3_2/CUCAC/ds-3_2-CUCAC_x.pdb.gz
MCSYM-DB/3_2/CUCAG/
MCSYM-DB/3_2/CUCAG/3_2-CUCAG.mcs
MCSYM-DB/3_2/CUCAG/ds-3_2-CUCAG_x.pdb.gz
MCSYM-DB/3_2/CUCAU/
MCSYM-DB/3_2/CUCAU/3_2-CUCAU.mcs
MCSYM-DB/3_2/CUCAU/ds-3_2-CUCAU_x.pdb.gz
MCSYM-DB/3_2/CUCCA/
MCSYM-DB/3_2/CUCCA/3_2-CUCCA.mcs
MCSYM-DB/3_2/CUCCA/ds-3_2-CUCCA_x.pdb.gz
MCSYM-DB/3_2/CUCCC/
MCSYM-DB/3_2/CUCCC/3_2-CUCCC.mcs
MCSYM-DB/3_2/CUCCC/ds-3_2-CUCCC_x.pdb.gz
MCSYM-DB/3_2/CUCCG/
MCSYM-DB/3_2/CUCCG/3_2-CUCCG.mcs
MCSYM-DB/3_2/CUCCG/ds-3_2-CUCCG_x.pdb.gz
MCSYM-DB/3_2/CUCCU/
MCSYM-DB/3_2/CUCCU/3_2-CUCCU.mcs
MCSYM-DB/3_2/CUCCU/ds-3_2-CUCCU_x.pdb.gz
MCSYM-DB/3_2/CUCGA/
MCSYM-DB/3_2/CUCGA/3_2-CUCGA.mcs
MCSYM-DB/3_2/CUCGA/ds-3_2-CUCGA_x.pdb.gz
MCSYM-DB/3_2/CUCGC/
MCSYM-DB/3_2/CUCGC/1A60_model_1.pdb.gz
MCSYM-DB/3_2/CUCGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/CUCGC/3_2-CUCGC.mcs
MCSYM-DB/3_2/CUCGC/ds-3_2-CUCGC_x.pdb.gz
MCSYM-DB/3_2/CUCGG/
MCSYM-DB/3_2/CUCGG/1XSH_model_1.pdb.gz
MCSYM-DB/3_2/CUCGG/3_2-CUCGG.mcs
MCSYM-DB/3_2/CUCGG/ds-3_2-CUCGG.pdb.gz
MCSYM-DB/3_2/CUCGG/ds-3_2-CUCGG_x.pdb.gz
MCSYM-DB/3_2/CUCGU/
MCSYM-DB/3_2/CUCGU/3_2-CUCGU.mcs
MCSYM-DB/3_2/CUCGU/ds-3_2-CUCGU_x.pdb.gz
MCSYM-DB/3_2/CUCUA/
MCSYM-DB/3_2/CUCUA/3_2-CUCUA.mcs
MCSYM-DB/3_2/CUCUA/ds-3_2-CUCUA_x.pdb.gz
MCSYM-DB/3_2/CUCUC/
MCSYM-DB/3_2/CUCUC/3_2-CUCUC.mcs
MCSYM-DB/3_2/CUCUC/ds-3_2-CUCUC_x.pdb.gz
MCSYM-DB/3_2/CUCUG/
MCSYM-DB/3_2/CUCUG/1UUD_model_1.pdb.gz
MCSYM-DB/3_2/CUCUG/3_2-CUCUG.mcs
MCSYM-DB/3_2/CUCUG/ds-3_2-CUCUG_x.pdb.gz
MCSYM-DB/3_2/CUCUU/
MCSYM-DB/3_2/CUCUU/3_2-CUCUU.mcs
MCSYM-DB/3_2/CUCUU/ds-3_2-CUCUU_x.pdb.gz
MCSYM-DB/3_2/CUGAA/
MCSYM-DB/3_2/CUGAA/3_2-CUGAA.mcs
MCSYM-DB/3_2/CUGAA/ds-3_2-CUGAA_x.pdb.gz
MCSYM-DB/3_2/CUGAC/
MCSYM-DB/3_2/CUGAC/3_2-CUGAC.mcs
MCSYM-DB/3_2/CUGAC/ds-3_2-CUGAC_x.pdb.gz
MCSYM-DB/3_2/CUGAG/
MCSYM-DB/3_2/CUGAG/3_2-CUGAG.mcs
MCSYM-DB/3_2/CUGAG/ds-3_2-CUGAG_x.pdb.gz
MCSYM-DB/3_2/CUGAU/
MCSYM-DB/3_2/CUGAU/3_2-CUGAU.mcs
MCSYM-DB/3_2/CUGAU/ds-3_2-CUGAU_x.pdb.gz
MCSYM-DB/3_2/CUGCA/
MCSYM-DB/3_2/CUGCA/3_2-CUGCA.mcs
MCSYM-DB/3_2/CUGCA/ds-3_2-CUGCA_x.pdb.gz
MCSYM-DB/3_2/CUGCC/
MCSYM-DB/3_2/CUGCC/3_2-CUGCC.mcs
MCSYM-DB/3_2/CUGCC/ds-3_2-CUGCC_x.pdb.gz
MCSYM-DB/3_2/CUGCG/
MCSYM-DB/3_2/CUGCG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/CUGCG/3_2-CUGCG.mcs
MCSYM-DB/3_2/CUGCG/ds-3_2-CUGCG_x.pdb.gz
MCSYM-DB/3_2/CUGCU/
MCSYM-DB/3_2/CUGCU/3_2-CUGCU.mcs
MCSYM-DB/3_2/CUGCU/ds-3_2-CUGCU_x.pdb.gz
MCSYM-DB/3_2/CUGGA/
MCSYM-DB/3_2/CUGGA/3_2-CUGGA.mcs
MCSYM-DB/3_2/CUGGA/ds-3_2-CUGGA_x.pdb.gz
MCSYM-DB/3_2/CUGGC/
MCSYM-DB/3_2/CUGGC/3_2-CUGGC.mcs
MCSYM-DB/3_2/CUGGC/ds-3_2-CUGGC_x.pdb.gz
MCSYM-DB/3_2/CUGGG/
MCSYM-DB/3_2/CUGGG/3_2-CUGGG.mcs
MCSYM-DB/3_2/CUGGG/ds-3_2-CUGGG_x.pdb.gz
MCSYM-DB/3_2/CUGGU/
MCSYM-DB/3_2/CUGGU/3_2-CUGGU.mcs
MCSYM-DB/3_2/CUGGU/ds-3_2-CUGGU_x.pdb.gz
MCSYM-DB/3_2/CUGUA/
MCSYM-DB/3_2/CUGUA/3_2-CUGUA.mcs
MCSYM-DB/3_2/CUGUA/ds-3_2-CUGUA_x.pdb.gz
MCSYM-DB/3_2/CUGUC/
MCSYM-DB/3_2/CUGUC/3_2-CUGUC.mcs
MCSYM-DB/3_2/CUGUC/ds-3_2-CUGUC_x.pdb.gz
MCSYM-DB/3_2/CUGUG/
MCSYM-DB/3_2/CUGUG/3_2-CUGUG.mcs
MCSYM-DB/3_2/CUGUG/ds-3_2-CUGUG_x.pdb.gz
MCSYM-DB/3_2/CUGUU/
MCSYM-DB/3_2/CUGUU/3_2-CUGUU.mcs
MCSYM-DB/3_2/CUGUU/ds-3_2-CUGUU_x.pdb.gz
MCSYM-DB/3_2/CUUAA/
MCSYM-DB/3_2/CUUAA/3_2-CUUAA.mcs
MCSYM-DB/3_2/CUUAA/ds-3_2-CUUAA_x.pdb.gz
MCSYM-DB/3_2/CUUAC/
MCSYM-DB/3_2/CUUAC/3_2-CUUAC.mcs
MCSYM-DB/3_2/CUUAC/ds-3_2-CUUAC_x.pdb.gz
MCSYM-DB/3_2/CUUAG/
MCSYM-DB/3_2/CUUAG/1M82_model_1.pdb.gz
MCSYM-DB/3_2/CUUAG/3_2-CUUAG.mcs
MCSYM-DB/3_2/CUUAG/ds-3_2-CUUAG_x.pdb.gz
MCSYM-DB/3_2/CUUAU/
MCSYM-DB/3_2/CUUAU/3_2-CUUAU.mcs
MCSYM-DB/3_2/CUUAU/ds-3_2-CUUAU_x.pdb.gz
MCSYM-DB/3_2/CUUCA/
MCSYM-DB/3_2/CUUCA/3_2-CUUCA.mcs
MCSYM-DB/3_2/CUUCA/ds-3_2-CUUCA_x.pdb.gz
MCSYM-DB/3_2/CUUCC/
MCSYM-DB/3_2/CUUCC/3_2-CUUCC.mcs
MCSYM-DB/3_2/CUUCC/ds-3_2-CUUCC_x.pdb.gz
MCSYM-DB/3_2/CUUCG/
MCSYM-DB/3_2/CUUCG/3_2-CUUCG.mcs
MCSYM-DB/3_2/CUUCG/ds-3_2-CUUCG_x.pdb.gz
MCSYM-DB/3_2/CUUCU/
MCSYM-DB/3_2/CUUCU/3_2-CUUCU.mcs
MCSYM-DB/3_2/CUUCU/ds-3_2-CUUCU_x.pdb.gz
MCSYM-DB/3_2/CUUGA/
MCSYM-DB/3_2/CUUGA/3_2-CUUGA.mcs
MCSYM-DB/3_2/CUUGA/ds-3_2-CUUGA_x.pdb.gz
MCSYM-DB/3_2/CUUGC/
MCSYM-DB/3_2/CUUGC/3_2-CUUGC.mcs
MCSYM-DB/3_2/CUUGC/ds-3_2-CUUGC_x.pdb.gz
MCSYM-DB/3_2/CUUGG/
MCSYM-DB/3_2/CUUGG/1G70_model_1.pdb.gz
MCSYM-DB/3_2/CUUGG/3_2-CUUGG.mcs
MCSYM-DB/3_2/CUUGG/ds-3_2-CUUGG_x.pdb.gz
MCSYM-DB/3_2/CUUGU/
MCSYM-DB/3_2/CUUGU/3_2-CUUGU.mcs
MCSYM-DB/3_2/CUUGU/ds-3_2-CUUGU_x.pdb.gz
MCSYM-DB/3_2/CUUUA/
MCSYM-DB/3_2/CUUUA/3_2-CUUUA.mcs
MCSYM-DB/3_2/CUUUA/ds-3_2-CUUUA_x.pdb.gz
MCSYM-DB/3_2/CUUUC/
MCSYM-DB/3_2/CUUUC/3_2-CUUUC.mcs
MCSYM-DB/3_2/CUUUC/ds-3_2-CUUUC_x.pdb.gz
MCSYM-DB/3_2/CUUUG/
MCSYM-DB/3_2/CUUUG/3_2-CUUUG.mcs
MCSYM-DB/3_2/CUUUG/ds-3_2-CUUUG_x.pdb.gz
MCSYM-DB/3_2/CUUUU/
MCSYM-DB/3_2/CUUUU/3_2-CUUUU.mcs
MCSYM-DB/3_2/CUUUU/ds-3_2-CUUUU_x.pdb.gz
MCSYM-DB/3_2/GAAAA/
MCSYM-DB/3_2/GAAAA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GAAAA/3_2-GAAAA.mcs
MCSYM-DB/3_2/GAAAA/ds-3_2-GAAAA_x.pdb.gz
MCSYM-DB/3_2/GAAAC/
MCSYM-DB/3_2/GAAAC/2GM0_model_1.pdb.gz
MCSYM-DB/3_2/GAAAC/3_2-GAAAC.mcs
MCSYM-DB/3_2/GAAAC/ds-3_2-GAAAC_x.pdb.gz
MCSYM-DB/3_2/GAAAG/
MCSYM-DB/3_2/GAAAG/3_2-GAAAG.mcs
MCSYM-DB/3_2/GAAAG/ds-3_2-GAAAG_x.pdb.gz
MCSYM-DB/3_2/GAAAU/
MCSYM-DB/3_2/GAAAU/3_2-GAAAU.mcs
MCSYM-DB/3_2/GAAAU/ds-3_2-GAAAU_x.pdb.gz
MCSYM-DB/3_2/GAACA/
MCSYM-DB/3_2/GAACA/3_2-GAACA.mcs
MCSYM-DB/3_2/GAACA/ds-3_2-GAACA_x.pdb.gz
MCSYM-DB/3_2/GAACC/
MCSYM-DB/3_2/GAACC/3_2-GAACC.mcs
MCSYM-DB/3_2/GAACC/ds-3_2-GAACC_x.pdb.gz
MCSYM-DB/3_2/GAACG/
MCSYM-DB/3_2/GAACG/3_2-GAACG.mcs
MCSYM-DB/3_2/GAACG/ds-3_2-GAACG_x.pdb.gz
MCSYM-DB/3_2/GAACU/
MCSYM-DB/3_2/GAACU/3_2-GAACU.mcs
MCSYM-DB/3_2/GAACU/ds-3_2-GAACU_x.pdb.gz
MCSYM-DB/3_2/GAAGA/
MCSYM-DB/3_2/GAAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GAAGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GAAGA/3_2-GAAGA.mcs
MCSYM-DB/3_2/GAAGA/ds-3_2-GAAGA_x.pdb.gz
MCSYM-DB/3_2/GAAGC/
MCSYM-DB/3_2/GAAGC/3_2-GAAGC.mcs
MCSYM-DB/3_2/GAAGC/ds-3_2-GAAGC_x.pdb.gz
MCSYM-DB/3_2/GAAGG/
MCSYM-DB/3_2/GAAGG/3_2-GAAGG.mcs
MCSYM-DB/3_2/GAAGG/ds-3_2-GAAGG_x.pdb.gz
MCSYM-DB/3_2/GAAGU/
MCSYM-DB/3_2/GAAGU/3_2-GAAGU.mcs
MCSYM-DB/3_2/GAAGU/ds-3_2-GAAGU_x.pdb.gz
MCSYM-DB/3_2/GAAUA/
MCSYM-DB/3_2/GAAUA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/GAAUA/1ZFV_model_1.pdb.gz
MCSYM-DB/3_2/GAAUA/3_2-GAAUA.mcs
MCSYM-DB/3_2/GAAUA/ds-3_2-GAAUA_x.pdb.gz
MCSYM-DB/3_2/GAAUC/
MCSYM-DB/3_2/GAAUC/3_2-GAAUC.mcs
MCSYM-DB/3_2/GAAUC/ds-3_2-GAAUC_x.pdb.gz
MCSYM-DB/3_2/GAAUG/
MCSYM-DB/3_2/GAAUG/1J1U_model_1.pdb.gz
MCSYM-DB/3_2/GAAUG/3_2-GAAUG.mcs
MCSYM-DB/3_2/GAAUG/ds-3_2-GAAUG_x.pdb.gz
MCSYM-DB/3_2/GAAUU/
MCSYM-DB/3_2/GAAUU/3_2-GAAUU.mcs
MCSYM-DB/3_2/GAAUU/ds-3_2-GAAUU_x.pdb.gz
MCSYM-DB/3_2/GACAA/
MCSYM-DB/3_2/GACAA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/GACAA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GACAA/3_2-GACAA.mcs
MCSYM-DB/3_2/GACAA/ds-3_2-GACAA_x.pdb.gz
MCSYM-DB/3_2/GACAC/
MCSYM-DB/3_2/GACAC/3_2-GACAC.mcs
MCSYM-DB/3_2/GACAC/ds-3_2-GACAC_x.pdb.gz
MCSYM-DB/3_2/GACAG/
MCSYM-DB/3_2/GACAG/3_2-GACAG.mcs
MCSYM-DB/3_2/GACAG/ds-3_2-GACAG_x.pdb.gz
MCSYM-DB/3_2/GACAU/
MCSYM-DB/3_2/GACAU/3_2-GACAU.mcs
MCSYM-DB/3_2/GACAU/ds-3_2-GACAU_x.pdb.gz
MCSYM-DB/3_2/GACCA/
MCSYM-DB/3_2/GACCA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GACCA/3_2-GACCA.mcs
MCSYM-DB/3_2/GACCA/ds-3_2-GACCA_x.pdb.gz
MCSYM-DB/3_2/GACCC/
MCSYM-DB/3_2/GACCC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GACCC/3_2-GACCC.mcs
MCSYM-DB/3_2/GACCC/ds-3_2-GACCC_x.pdb.gz
MCSYM-DB/3_2/GACCG/
MCSYM-DB/3_2/GACCG/3_2-GACCG.mcs
MCSYM-DB/3_2/GACCG/ds-3_2-GACCG_x.pdb.gz
MCSYM-DB/3_2/GACCU/
MCSYM-DB/3_2/GACCU/3_2-GACCU.mcs
MCSYM-DB/3_2/GACCU/ds-3_2-GACCU_x.pdb.gz
MCSYM-DB/3_2/GACGA/
MCSYM-DB/3_2/GACGA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/GACGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GACGA/3_2-GACGA.mcs
MCSYM-DB/3_2/GACGA/ds-3_2-GACGA_x.pdb.gz
MCSYM-DB/3_2/GACGC/
MCSYM-DB/3_2/GACGC/1CSL_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1DUQ_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1EBR_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1G70_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1I9F_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1U9S_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/1XSG_model_1.pdb.gz
MCSYM-DB/3_2/GACGC/3_2-GACGC.mcs
MCSYM-DB/3_2/GACGC/ds-3_2-GACGC_x.pdb.gz
MCSYM-DB/3_2/GACGG/
MCSYM-DB/3_2/GACGG/2BTE_model_1.pdb.gz
MCSYM-DB/3_2/GACGG/3_2-GACGG.mcs
MCSYM-DB/3_2/GACGG/ds-3_2-GACGG_x.pdb.gz
MCSYM-DB/3_2/GACGU/
MCSYM-DB/3_2/GACGU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GACGU/3_2-GACGU.mcs
MCSYM-DB/3_2/GACGU/ds-3_2-GACGU_x.pdb.gz
MCSYM-DB/3_2/GACUA/
MCSYM-DB/3_2/GACUA/3_2-GACUA.mcs
MCSYM-DB/3_2/GACUA/ds-3_2-GACUA_x.pdb.gz
MCSYM-DB/3_2/GACUC/
MCSYM-DB/3_2/GACUC/3_2-GACUC.mcs
MCSYM-DB/3_2/GACUC/ds-3_2-GACUC_x.pdb.gz
MCSYM-DB/3_2/GACUG/
MCSYM-DB/3_2/GACUG/3_2-GACUG.mcs
MCSYM-DB/3_2/GACUG/ds-3_2-GACUG_x.pdb.gz
MCSYM-DB/3_2/GACUU/
MCSYM-DB/3_2/GACUU/3_2-GACUU.mcs
MCSYM-DB/3_2/GACUU/ds-3_2-GACUU_x.pdb.gz
MCSYM-DB/3_2/GAGAA/
MCSYM-DB/3_2/GAGAA/3_2-GAGAA.mcs
MCSYM-DB/3_2/GAGAA/ds-3_2-GAGAA_x.pdb.gz
MCSYM-DB/3_2/GAGAC/
MCSYM-DB/3_2/GAGAC/1XJR_model_1.pdb.gz
MCSYM-DB/3_2/GAGAC/3_2-GAGAC.mcs
MCSYM-DB/3_2/GAGAC/ds-3_2-GAGAC_x.pdb.gz
MCSYM-DB/3_2/GAGAG/
MCSYM-DB/3_2/GAGAG/3_2-GAGAG.mcs
MCSYM-DB/3_2/GAGAG/ds-3_2-GAGAG_x.pdb.gz
MCSYM-DB/3_2/GAGAU/
MCSYM-DB/3_2/GAGAU/3_2-GAGAU.mcs
MCSYM-DB/3_2/GAGAU/ds-3_2-GAGAU_x.pdb.gz
MCSYM-DB/3_2/GAGCA/
MCSYM-DB/3_2/GAGCA/3_2-GAGCA.mcs
MCSYM-DB/3_2/GAGCA/5MSF_model_1.pdb.gz
MCSYM-DB/3_2/GAGCA/ds-3_2-GAGCA_x.pdb.gz
MCSYM-DB/3_2/GAGCC/
MCSYM-DB/3_2/GAGCC/1K8S_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/1NC0_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/1SLP_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/1ZDK_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/2BNY_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/2C4Y_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/2C4Z_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/2C50_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/2C51_model_1.pdb.gz
MCSYM-DB/3_2/GAGCC/3_2-GAGCC.mcs
MCSYM-DB/3_2/GAGCC/ds-3_2-GAGCC_x.pdb.gz
MCSYM-DB/3_2/GAGCG/
MCSYM-DB/3_2/GAGCG/3_2-GAGCG.mcs
MCSYM-DB/3_2/GAGCG/ds-3_2-GAGCG_x.pdb.gz
MCSYM-DB/3_2/GAGCU/
MCSYM-DB/3_2/GAGCU/3_2-GAGCU.mcs
MCSYM-DB/3_2/GAGCU/ds-3_2-GAGCU_x.pdb.gz
MCSYM-DB/3_2/GAGGA/
MCSYM-DB/3_2/GAGGA/3_2-GAGGA.mcs
MCSYM-DB/3_2/GAGGA/ds-3_2-GAGGA_x.pdb.gz
MCSYM-DB/3_2/GAGGC/
MCSYM-DB/3_2/GAGGC/3_2-GAGGC.mcs
MCSYM-DB/3_2/GAGGC/ds-3_2-GAGGC_x.pdb.gz
MCSYM-DB/3_2/GAGGG/
MCSYM-DB/3_2/GAGGG/3_2-GAGGG.mcs
MCSYM-DB/3_2/GAGGG/ds-3_2-GAGGG_x.pdb.gz
MCSYM-DB/3_2/GAGGU/
MCSYM-DB/3_2/GAGGU/3_2-GAGGU.mcs
MCSYM-DB/3_2/GAGGU/ds-3_2-GAGGU_x.pdb.gz
MCSYM-DB/3_2/GAGUA/
MCSYM-DB/3_2/GAGUA/3_2-GAGUA.mcs
MCSYM-DB/3_2/GAGUA/ds-3_2-GAGUA_x.pdb.gz
MCSYM-DB/3_2/GAGUC/
MCSYM-DB/3_2/GAGUC/1Y39_model_1.pdb.gz
MCSYM-DB/3_2/GAGUC/3_2-GAGUC.mcs
MCSYM-DB/3_2/GAGUC/ds-3_2-GAGUC_x.pdb.gz
MCSYM-DB/3_2/GAGUG/
MCSYM-DB/3_2/GAGUG/1G1X_model_1.pdb.gz
MCSYM-DB/3_2/GAGUG/1KUQ_model_1.pdb.gz
MCSYM-DB/3_2/GAGUG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GAGUG/3_2-GAGUG.mcs
MCSYM-DB/3_2/GAGUG/ds-3_2-GAGUG_x.pdb.gz
MCSYM-DB/3_2/GAGUU/
MCSYM-DB/3_2/GAGUU/3_2-GAGUU.mcs
MCSYM-DB/3_2/GAGUU/ds-3_2-GAGUU_x.pdb.gz
MCSYM-DB/3_2/GAUAA/
MCSYM-DB/3_2/GAUAA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GAUAA/3_2-GAUAA.mcs
MCSYM-DB/3_2/GAUAA/ds-3_2-GAUAA_x.pdb.gz
MCSYM-DB/3_2/GAUAC/
MCSYM-DB/3_2/GAUAC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GAUAC/3_2-GAUAC.mcs
MCSYM-DB/3_2/GAUAC/ds-3_2-GAUAC_x.pdb.gz
MCSYM-DB/3_2/GAUAG/
MCSYM-DB/3_2/GAUAG/3_2-GAUAG.mcs
MCSYM-DB/3_2/GAUAG/ds-3_2-GAUAG_x.pdb.gz
MCSYM-DB/3_2/GAUAU/
MCSYM-DB/3_2/GAUAU/3_2-GAUAU.mcs
MCSYM-DB/3_2/GAUAU/ds-3_2-GAUAU_x.pdb.gz
MCSYM-DB/3_2/GAUCA/
MCSYM-DB/3_2/GAUCA/3_2-GAUCA.mcs
MCSYM-DB/3_2/GAUCA/ds-3_2-GAUCA_x.pdb.gz
MCSYM-DB/3_2/GAUCC/
MCSYM-DB/3_2/GAUCC/3_2-GAUCC.mcs
MCSYM-DB/3_2/GAUCC/ds-3_2-GAUCC_x.pdb.gz
MCSYM-DB/3_2/GAUCG/
MCSYM-DB/3_2/GAUCG/3_2-GAUCG.mcs
MCSYM-DB/3_2/GAUCG/ds-3_2-GAUCG_x.pdb.gz
MCSYM-DB/3_2/GAUCU/
MCSYM-DB/3_2/GAUCU/3_2-GAUCU.mcs
MCSYM-DB/3_2/GAUCU/ds-3_2-GAUCU_x.pdb.gz
MCSYM-DB/3_2/GAUGA/
MCSYM-DB/3_2/GAUGA/3_2-GAUGA.mcs
MCSYM-DB/3_2/GAUGA/ds-3_2-GAUGA_x.pdb.gz
MCSYM-DB/3_2/GAUGC/
MCSYM-DB/3_2/GAUGC/3_2-GAUGC.mcs
MCSYM-DB/3_2/GAUGC/ds-3_2-GAUGC_x.pdb.gz
MCSYM-DB/3_2/GAUGG/
MCSYM-DB/3_2/GAUGG/3_2-GAUGG.mcs
MCSYM-DB/3_2/GAUGG/ds-3_2-GAUGG_x.pdb.gz
MCSYM-DB/3_2/GAUGU/
MCSYM-DB/3_2/GAUGU/3_2-GAUGU.mcs
MCSYM-DB/3_2/GAUGU/ds-3_2-GAUGU_x.pdb.gz
MCSYM-DB/3_2/GAUUA/
MCSYM-DB/3_2/GAUUA/3_2-GAUUA.mcs
MCSYM-DB/3_2/GAUUA/ds-3_2-GAUUA_x.pdb.gz
MCSYM-DB/3_2/GAUUC/
MCSYM-DB/3_2/GAUUC/3_2-GAUUC.mcs
MCSYM-DB/3_2/GAUUC/ds-3_2-GAUUC_x.pdb.gz
MCSYM-DB/3_2/GAUUG/
MCSYM-DB/3_2/GAUUG/3_2-GAUUG.mcs
MCSYM-DB/3_2/GAUUG/ds-3_2-GAUUG_x.pdb.gz
MCSYM-DB/3_2/GAUUU/
MCSYM-DB/3_2/GAUUU/3_2-GAUUU.mcs
MCSYM-DB/3_2/GAUUU/ds-3_2-GAUUU_x.pdb.gz
MCSYM-DB/3_2/GCAAA/
MCSYM-DB/3_2/GCAAA/3_2-GCAAA.mcs
MCSYM-DB/3_2/GCAAA/ds-3_2-GCAAA_x.pdb.gz
MCSYM-DB/3_2/GCAAC/
MCSYM-DB/3_2/GCAAC/3_2-GCAAC.mcs
MCSYM-DB/3_2/GCAAC/ds-3_2-GCAAC_x.pdb.gz
MCSYM-DB/3_2/GCAAG/
MCSYM-DB/3_2/GCAAG/3_2-GCAAG.mcs
MCSYM-DB/3_2/GCAAG/ds-3_2-GCAAG_x.pdb.gz
MCSYM-DB/3_2/GCAAU/
MCSYM-DB/3_2/GCAAU/3_2-GCAAU.mcs
MCSYM-DB/3_2/GCAAU/ds-3_2-GCAAU_x.pdb.gz
MCSYM-DB/3_2/GCACA/
MCSYM-DB/3_2/GCACA/3_2-GCACA.mcs
MCSYM-DB/3_2/GCACA/ds-3_2-GCACA_x.pdb.gz
MCSYM-DB/3_2/GCACC/
MCSYM-DB/3_2/GCACC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GCACC/3_2-GCACC.mcs
MCSYM-DB/3_2/GCACC/ds-3_2-GCACC_x.pdb.gz
MCSYM-DB/3_2/GCACG/
MCSYM-DB/3_2/GCACG/3_2-GCACG.mcs
MCSYM-DB/3_2/GCACG/ds-3_2-GCACG_x.pdb.gz
MCSYM-DB/3_2/GCACU/
MCSYM-DB/3_2/GCACU/3_2-GCACU.mcs
MCSYM-DB/3_2/GCACU/ds-3_2-GCACU_x.pdb.gz
MCSYM-DB/3_2/GCAGA/
MCSYM-DB/3_2/GCAGA/3_2-GCAGA.mcs
MCSYM-DB/3_2/GCAGA/ds-3_2-GCAGA_x.pdb.gz
MCSYM-DB/3_2/GCAGC/
MCSYM-DB/3_2/GCAGC/3_2-GCAGC.mcs
MCSYM-DB/3_2/GCAGC/ds-3_2-GCAGC_x.pdb.gz
MCSYM-DB/3_2/GCAGG/
MCSYM-DB/3_2/GCAGG/3_2-GCAGG.mcs
MCSYM-DB/3_2/GCAGG/ds-3_2-GCAGG_x.pdb.gz
MCSYM-DB/3_2/GCAGU/
MCSYM-DB/3_2/GCAGU/3_2-GCAGU.mcs
MCSYM-DB/3_2/GCAGU/ds-3_2-GCAGU_x.pdb.gz
MCSYM-DB/3_2/GCAUA/
MCSYM-DB/3_2/GCAUA/3_2-GCAUA.mcs
MCSYM-DB/3_2/GCAUA/ds-3_2-GCAUA_x.pdb.gz
MCSYM-DB/3_2/GCAUC/
MCSYM-DB/3_2/GCAUC/2B6G_model_1.pdb.gz
MCSYM-DB/3_2/GCAUC/2ES5_model_1.pdb.gz
MCSYM-DB/3_2/GCAUC/3_2-GCAUC.mcs
MCSYM-DB/3_2/GCAUC/ds-3_2-GCAUC_x.pdb.gz
MCSYM-DB/3_2/GCAUG/
MCSYM-DB/3_2/GCAUG/3_2-GCAUG.mcs
MCSYM-DB/3_2/GCAUG/ds-3_2-GCAUG_x.pdb.gz
MCSYM-DB/3_2/GCAUU/
MCSYM-DB/3_2/GCAUU/3_2-GCAUU.mcs
MCSYM-DB/3_2/GCAUU/ds-3_2-GCAUU_x.pdb.gz
MCSYM-DB/3_2/GCCAA/
MCSYM-DB/3_2/GCCAA/3_2-GCCAA.mcs
MCSYM-DB/3_2/GCCAA/ds-3_2-GCCAA_x.pdb.gz
MCSYM-DB/3_2/GCCAC/
MCSYM-DB/3_2/GCCAC/3_2-GCCAC.mcs
MCSYM-DB/3_2/GCCAC/ds-3_2-GCCAC_x.pdb.gz
MCSYM-DB/3_2/GCCAG/
MCSYM-DB/3_2/GCCAG/3_2-GCCAG.mcs
MCSYM-DB/3_2/GCCAG/ds-3_2-GCCAG_x.pdb.gz
MCSYM-DB/3_2/GCCAU/
MCSYM-DB/3_2/GCCAU/3_2-GCCAU.mcs
MCSYM-DB/3_2/GCCAU/ds-3_2-GCCAU_x.pdb.gz
MCSYM-DB/3_2/GCCCA/
MCSYM-DB/3_2/GCCCA/3_2-GCCCA.mcs
MCSYM-DB/3_2/GCCCA/ds-3_2-GCCCA_x.pdb.gz
MCSYM-DB/3_2/GCCCC/
MCSYM-DB/3_2/GCCCC/3_2-GCCCC.mcs
MCSYM-DB/3_2/GCCCC/ds-3_2-GCCCC_x.pdb.gz
MCSYM-DB/3_2/GCCCG/
MCSYM-DB/3_2/GCCCG/3_2-GCCCG.mcs
MCSYM-DB/3_2/GCCCG/ds-3_2-GCCCG_x.pdb.gz
MCSYM-DB/3_2/GCCCU/
MCSYM-DB/3_2/GCCCU/3_2-GCCCU.mcs
MCSYM-DB/3_2/GCCCU/ds-3_2-GCCCU_x.pdb.gz
MCSYM-DB/3_2/GCCGA/
MCSYM-DB/3_2/GCCGA/3_2-GCCGA.mcs
MCSYM-DB/3_2/GCCGA/ds-3_2-GCCGA_x.pdb.gz
MCSYM-DB/3_2/GCCGC/
MCSYM-DB/3_2/GCCGC/3_2-GCCGC.mcs
MCSYM-DB/3_2/GCCGC/ds-3_2-GCCGC_x.pdb.gz
MCSYM-DB/3_2/GCCGG/
MCSYM-DB/3_2/GCCGG/3_2-GCCGG.mcs
MCSYM-DB/3_2/GCCGG/ds-3_2-GCCGG_x.pdb.gz
MCSYM-DB/3_2/GCCGU/
MCSYM-DB/3_2/GCCGU/3_2-GCCGU.mcs
MCSYM-DB/3_2/GCCGU/ds-3_2-GCCGU_x.pdb.gz
MCSYM-DB/3_2/GCCUA/
MCSYM-DB/3_2/GCCUA/3_2-GCCUA.mcs
MCSYM-DB/3_2/GCCUA/ds-3_2-GCCUA_x.pdb.gz
MCSYM-DB/3_2/GCCUC/
MCSYM-DB/3_2/GCCUC/3_2-GCCUC.mcs
MCSYM-DB/3_2/GCCUC/ds-3_2-GCCUC_x.pdb.gz
MCSYM-DB/3_2/GCCUG/
MCSYM-DB/3_2/GCCUG/3_2-GCCUG.mcs
MCSYM-DB/3_2/GCCUG/ds-3_2-GCCUG_x.pdb.gz
MCSYM-DB/3_2/GCCUU/
MCSYM-DB/3_2/GCCUU/3_2-GCCUU.mcs
MCSYM-DB/3_2/GCCUU/ds-3_2-GCCUU_x.pdb.gz
MCSYM-DB/3_2/GCGAA/
MCSYM-DB/3_2/GCGAA/3_2-GCGAA.mcs
MCSYM-DB/3_2/GCGAA/ds-3_2-GCGAA_x.pdb.gz
MCSYM-DB/3_2/GCGAC/
MCSYM-DB/3_2/GCGAC/3_2-GCGAC.mcs
MCSYM-DB/3_2/GCGAC/ds-3_2-GCGAC_x.pdb.gz
MCSYM-DB/3_2/GCGAG/
MCSYM-DB/3_2/GCGAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GCGAG/3_2-GCGAG.mcs
MCSYM-DB/3_2/GCGAG/ds-3_2-GCGAG_x.pdb.gz
MCSYM-DB/3_2/GCGAU/
MCSYM-DB/3_2/GCGAU/3_2-GCGAU.mcs
MCSYM-DB/3_2/GCGAU/ds-3_2-GCGAU_x.pdb.gz
MCSYM-DB/3_2/GCGCA/
MCSYM-DB/3_2/GCGCA/3_2-GCGCA.mcs
MCSYM-DB/3_2/GCGCA/ds-3_2-GCGCA_x.pdb.gz
MCSYM-DB/3_2/GCGCC/
MCSYM-DB/3_2/GCGCC/1KUO_model_1.pdb.gz
MCSYM-DB/3_2/GCGCC/1S03_model_1.pdb.gz
MCSYM-DB/3_2/GCGCC/3_2-GCGCC.mcs
MCSYM-DB/3_2/GCGCC/ds-3_2-GCGCC_x.pdb.gz
MCSYM-DB/3_2/GCGCG/
MCSYM-DB/3_2/GCGCG/2GM0_model_1.pdb.gz
MCSYM-DB/3_2/GCGCG/3_2-GCGCG.mcs
MCSYM-DB/3_2/GCGCG/ds-3_2-GCGCG_x.pdb.gz
MCSYM-DB/3_2/GCGCU/
MCSYM-DB/3_2/GCGCU/3_2-GCGCU.mcs
MCSYM-DB/3_2/GCGCU/ds-3_2-GCGCU_x.pdb.gz
MCSYM-DB/3_2/GCGGA/
MCSYM-DB/3_2/GCGGA/3_2-GCGGA.mcs
MCSYM-DB/3_2/GCGGA/ds-3_2-GCGGA_x.pdb.gz
MCSYM-DB/3_2/GCGGC/
MCSYM-DB/3_2/GCGGC/3_2-GCGGC.mcs
MCSYM-DB/3_2/GCGGC/ds-3_2-GCGGC_x.pdb.gz
MCSYM-DB/3_2/GCGGG/
MCSYM-DB/3_2/GCGGG/3_2-GCGGG.mcs
MCSYM-DB/3_2/GCGGG/ds-3_2-GCGGG_x.pdb.gz
MCSYM-DB/3_2/GCGGU/
MCSYM-DB/3_2/GCGGU/3_2-GCGGU.mcs
MCSYM-DB/3_2/GCGGU/ds-3_2-GCGGU_x.pdb.gz
MCSYM-DB/3_2/GCGUA/
MCSYM-DB/3_2/GCGUA/3_2-GCGUA.mcs
MCSYM-DB/3_2/GCGUA/ds-3_2-GCGUA_x.pdb.gz
MCSYM-DB/3_2/GCGUC/
MCSYM-DB/3_2/GCGUC/3_2-GCGUC.mcs
MCSYM-DB/3_2/GCGUC/ds-3_2-GCGUC_x.pdb.gz
MCSYM-DB/3_2/GCGUG/
MCSYM-DB/3_2/GCGUG/3_2-GCGUG.mcs
MCSYM-DB/3_2/GCGUG/ds-3_2-GCGUG_x.pdb.gz
MCSYM-DB/3_2/GCGUU/
MCSYM-DB/3_2/GCGUU/3_2-GCGUU.mcs
MCSYM-DB/3_2/GCGUU/ds-3_2-GCGUU_x.pdb.gz
MCSYM-DB/3_2/GCUAA/
MCSYM-DB/3_2/GCUAA/3_2-GCUAA.mcs
MCSYM-DB/3_2/GCUAA/ds-3_2-GCUAA_x.pdb.gz
MCSYM-DB/3_2/GCUAC/
MCSYM-DB/3_2/GCUAC/1NBR_model_1.pdb.gz
MCSYM-DB/3_2/GCUAC/3_2-GCUAC.mcs
MCSYM-DB/3_2/GCUAC/ds-3_2-GCUAC.pdb.gz
MCSYM-DB/3_2/GCUAC/ds-3_2-GCUAC_x.pdb.gz
MCSYM-DB/3_2/GCUAG/
MCSYM-DB/3_2/GCUAG/2FK6_model_1.pdb.gz
MCSYM-DB/3_2/GCUAG/3_2-GCUAG.mcs
MCSYM-DB/3_2/GCUAG/ds-3_2-GCUAG_x.pdb.gz
MCSYM-DB/3_2/GCUAU/
MCSYM-DB/3_2/GCUAU/3_2-GCUAU.mcs
MCSYM-DB/3_2/GCUAU/ds-3_2-GCUAU_x.pdb.gz
MCSYM-DB/3_2/GCUCA/
MCSYM-DB/3_2/GCUCA/3_2-GCUCA.mcs
MCSYM-DB/3_2/GCUCA/ds-3_2-GCUCA_x.pdb.gz
MCSYM-DB/3_2/GCUCC/
MCSYM-DB/3_2/GCUCC/3_2-GCUCC.mcs
MCSYM-DB/3_2/GCUCC/ds-3_2-GCUCC_x.pdb.gz
MCSYM-DB/3_2/GCUCG/
MCSYM-DB/3_2/GCUCG/3_2-GCUCG.mcs
MCSYM-DB/3_2/GCUCG/ds-3_2-GCUCG_x.pdb.gz
MCSYM-DB/3_2/GCUCU/
MCSYM-DB/3_2/GCUCU/3_2-GCUCU.mcs
MCSYM-DB/3_2/GCUCU/ds-3_2-GCUCU_x.pdb.gz
MCSYM-DB/3_2/GCUGA/
MCSYM-DB/3_2/GCUGA/3_2-GCUGA.mcs
MCSYM-DB/3_2/GCUGA/ds-3_2-GCUGA_x.pdb.gz
MCSYM-DB/3_2/GCUGC/
MCSYM-DB/3_2/GCUGC/3_2-GCUGC.mcs
MCSYM-DB/3_2/GCUGC/ds-3_2-GCUGC_x.pdb.gz
MCSYM-DB/3_2/GCUGG/
MCSYM-DB/3_2/GCUGG/3_2-GCUGG.mcs
MCSYM-DB/3_2/GCUGG/ds-3_2-GCUGG_x.pdb.gz
MCSYM-DB/3_2/GCUGU/
MCSYM-DB/3_2/GCUGU/3_2-GCUGU.mcs
MCSYM-DB/3_2/GCUGU/ds-3_2-GCUGU_x.pdb.gz
MCSYM-DB/3_2/GCUUA/
MCSYM-DB/3_2/GCUUA/3_2-GCUUA.mcs
MCSYM-DB/3_2/GCUUA/ds-3_2-GCUUA_x.pdb.gz
MCSYM-DB/3_2/GCUUC/
MCSYM-DB/3_2/GCUUC/3_2-GCUUC.mcs
MCSYM-DB/3_2/GCUUC/ds-3_2-GCUUC_x.pdb.gz
MCSYM-DB/3_2/GCUUG/
MCSYM-DB/3_2/GCUUG/3_2-GCUUG.mcs
MCSYM-DB/3_2/GCUUG/ds-3_2-GCUUG_x.pdb.gz
MCSYM-DB/3_2/GCUUU/
MCSYM-DB/3_2/GCUUU/3_2-GCUUU.mcs
MCSYM-DB/3_2/GCUUU/ds-3_2-GCUUU_x.pdb.gz
MCSYM-DB/3_2/GGAAA/
MCSYM-DB/3_2/GGAAA/3_2-GGAAA.mcs
MCSYM-DB/3_2/GGAAA/ds-3_2-GGAAA_x.pdb.gz
MCSYM-DB/3_2/GGAAC/
MCSYM-DB/3_2/GGAAC/3_2-GGAAC.mcs
MCSYM-DB/3_2/GGAAC/ds-3_2-GGAAC_x.pdb.gz
MCSYM-DB/3_2/GGAAG/
MCSYM-DB/3_2/GGAAG/3_2-GGAAG.mcs
MCSYM-DB/3_2/GGAAG/ds-3_2-GGAAG_x.pdb.gz
MCSYM-DB/3_2/GGAAU/
MCSYM-DB/3_2/GGAAU/3_2-GGAAU.mcs
MCSYM-DB/3_2/GGAAU/ds-3_2-GGAAU_x.pdb.gz
MCSYM-DB/3_2/GGACA/
MCSYM-DB/3_2/GGACA/3_2-GGACA.mcs
MCSYM-DB/3_2/GGACA/ds-3_2-GGACA_x.pdb.gz
MCSYM-DB/3_2/GGACC/
MCSYM-DB/3_2/GGACC/3_2-GGACC.mcs
MCSYM-DB/3_2/GGACC/ds-3_2-GGACC_x.pdb.gz
MCSYM-DB/3_2/GGACG/
MCSYM-DB/3_2/GGACG/3_2-GGACG.mcs
MCSYM-DB/3_2/GGACG/ds-3_2-GGACG_x.pdb.gz
MCSYM-DB/3_2/GGACU/
MCSYM-DB/3_2/GGACU/3_2-GGACU.mcs
MCSYM-DB/3_2/GGACU/ds-3_2-GGACU_x.pdb.gz
MCSYM-DB/3_2/GGAGA/
MCSYM-DB/3_2/GGAGA/3_2-GGAGA.mcs
MCSYM-DB/3_2/GGAGA/ds-3_2-GGAGA_x.pdb.gz
MCSYM-DB/3_2/GGAGC/
MCSYM-DB/3_2/GGAGC/1M5L_model_1.pdb.gz
MCSYM-DB/3_2/GGAGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GGAGC/3_2-GGAGC.mcs
MCSYM-DB/3_2/GGAGC/ds-3_2-GGAGC_x.pdb.gz
MCSYM-DB/3_2/GGAGG/
MCSYM-DB/3_2/GGAGG/1M5L_model_1.pdb.gz
MCSYM-DB/3_2/GGAGG/3_2-GGAGG.mcs
MCSYM-DB/3_2/GGAGG/ds-3_2-GGAGG_x.pdb.gz
MCSYM-DB/3_2/GGAGU/
MCSYM-DB/3_2/GGAGU/3_2-GGAGU.mcs
MCSYM-DB/3_2/GGAGU/ds-3_2-GGAGU_x.pdb.gz
MCSYM-DB/3_2/GGAUA/
MCSYM-DB/3_2/GGAUA/3_2-GGAUA.mcs
MCSYM-DB/3_2/GGAUA/ds-3_2-GGAUA_x.pdb.gz
MCSYM-DB/3_2/GGAUC/
MCSYM-DB/3_2/GGAUC/3_2-GGAUC.mcs
MCSYM-DB/3_2/GGAUC/ds-3_2-GGAUC_x.pdb.gz
MCSYM-DB/3_2/GGAUG/
MCSYM-DB/3_2/GGAUG/2BTE_model_1.pdb.gz
MCSYM-DB/3_2/GGAUG/3_2-GGAUG.mcs
MCSYM-DB/3_2/GGAUG/ds-3_2-GGAUG_x.pdb.gz
MCSYM-DB/3_2/GGAUU/
MCSYM-DB/3_2/GGAUU/3_2-GGAUU.mcs
MCSYM-DB/3_2/GGAUU/ds-3_2-GGAUU_x.pdb.gz
MCSYM-DB/3_2/GGCAA/
MCSYM-DB/3_2/GGCAA/3_2-GGCAA.mcs
MCSYM-DB/3_2/GGCAA/ds-3_2-GGCAA_x.pdb.gz
MCSYM-DB/3_2/GGCAC/
MCSYM-DB/3_2/GGCAC/361D_model_1.pdb.gz
MCSYM-DB/3_2/GGCAC/3_2-GGCAC.mcs
MCSYM-DB/3_2/GGCAC/ds-3_2-GGCAC_x.pdb.gz
MCSYM-DB/3_2/GGCAG/
MCSYM-DB/3_2/GGCAG/3_2-GGCAG.mcs
MCSYM-DB/3_2/GGCAG/ds-3_2-GGCAG_x.pdb.gz
MCSYM-DB/3_2/GGCAU/
MCSYM-DB/3_2/GGCAU/3_2-GGCAU.mcs
MCSYM-DB/3_2/GGCAU/ds-3_2-GGCAU_x.pdb.gz
MCSYM-DB/3_2/GGCCA/
MCSYM-DB/3_2/GGCCA/3_2-GGCCA.mcs
MCSYM-DB/3_2/GGCCA/ds-3_2-GGCCA_x.pdb.gz
MCSYM-DB/3_2/GGCCC/
MCSYM-DB/3_2/GGCCC/3_2-GGCCC.mcs
MCSYM-DB/3_2/GGCCC/ds-3_2-GGCCC_x.pdb.gz
MCSYM-DB/3_2/GGCCG/
MCSYM-DB/3_2/GGCCG/3_2-GGCCG.mcs
MCSYM-DB/3_2/GGCCG/ds-3_2-GGCCG_x.pdb.gz
MCSYM-DB/3_2/GGCCU/
MCSYM-DB/3_2/GGCCU/3_2-GGCCU.mcs
MCSYM-DB/3_2/GGCCU/ds-3_2-GGCCU_x.pdb.gz
MCSYM-DB/3_2/GGCGA/
MCSYM-DB/3_2/GGCGA/3_2-GGCGA.mcs
MCSYM-DB/3_2/GGCGA/ds-3_2-GGCGA_x.pdb.gz
MCSYM-DB/3_2/GGCGC/
MCSYM-DB/3_2/GGCGC/1KIS_model_1.pdb.gz
MCSYM-DB/3_2/GGCGC/1U9S_model_1.pdb.gz
MCSYM-DB/3_2/GGCGC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GGCGC/3_2-GGCGC.mcs
MCSYM-DB/3_2/GGCGC/ds-3_2-GGCGC_x.pdb.gz
MCSYM-DB/3_2/GGCGG/
MCSYM-DB/3_2/GGCGG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GGCGG/3_2-GGCGG.mcs
MCSYM-DB/3_2/GGCGG/ds-3_2-GGCGG_x.pdb.gz
MCSYM-DB/3_2/GGCGU/
MCSYM-DB/3_2/GGCGU/1QC8_model_1.pdb.gz
MCSYM-DB/3_2/GGCGU/3_2-GGCGU.mcs
MCSYM-DB/3_2/GGCGU/ds-3_2-GGCGU_x.pdb.gz
MCSYM-DB/3_2/GGCUA/
MCSYM-DB/3_2/GGCUA/3_2-GGCUA.mcs
MCSYM-DB/3_2/GGCUA/ds-3_2-GGCUA_x.pdb.gz
MCSYM-DB/3_2/GGCUC/
MCSYM-DB/3_2/GGCUC/3_2-GGCUC.mcs
MCSYM-DB/3_2/GGCUC/ds-3_2-GGCUC_x.pdb.gz
MCSYM-DB/3_2/GGCUG/
MCSYM-DB/3_2/GGCUG/3_2-GGCUG.mcs
MCSYM-DB/3_2/GGCUG/ds-3_2-GGCUG_x.pdb.gz
MCSYM-DB/3_2/GGCUU/
MCSYM-DB/3_2/GGCUU/3_2-GGCUU.mcs
MCSYM-DB/3_2/GGCUU/ds-3_2-GGCUU_x.pdb.gz
MCSYM-DB/3_2/GGGAA/
MCSYM-DB/3_2/GGGAA/3_2-GGGAA.mcs
MCSYM-DB/3_2/GGGAA/ds-3_2-GGGAA_x.pdb.gz
MCSYM-DB/3_2/GGGAC/
MCSYM-DB/3_2/GGGAC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GGGAC/3_2-GGGAC.mcs
MCSYM-DB/3_2/GGGAC/ds-3_2-GGGAC_x.pdb.gz
MCSYM-DB/3_2/GGGAG/
MCSYM-DB/3_2/GGGAG/3_2-GGGAG.mcs
MCSYM-DB/3_2/GGGAG/ds-3_2-GGGAG_x.pdb.gz
MCSYM-DB/3_2/GGGAU/
MCSYM-DB/3_2/GGGAU/3_2-GGGAU.mcs
MCSYM-DB/3_2/GGGAU/ds-3_2-GGGAU_x.pdb.gz
MCSYM-DB/3_2/GGGCA/
MCSYM-DB/3_2/GGGCA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/GGGCA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GGGCA/3_2-GGGCA.mcs
MCSYM-DB/3_2/GGGCA/ds-3_2-GGGCA_x.pdb.gz
MCSYM-DB/3_2/GGGCC/
MCSYM-DB/3_2/GGGCC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GGGCC/3_2-GGGCC.mcs
MCSYM-DB/3_2/GGGCC/ds-3_2-GGGCC_x.pdb.gz
MCSYM-DB/3_2/GGGCG/
MCSYM-DB/3_2/GGGCG/3_2-GGGCG.mcs
MCSYM-DB/3_2/GGGCG/ds-3_2-GGGCG_x.pdb.gz
MCSYM-DB/3_2/GGGCU/
MCSYM-DB/3_2/GGGCU/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/GGGCU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GGGCU/3_2-GGGCU.mcs
MCSYM-DB/3_2/GGGCU/ds-3_2-GGGCU_x.pdb.gz
MCSYM-DB/3_2/GGGGA/
MCSYM-DB/3_2/GGGGA/3_2-GGGGA.mcs
MCSYM-DB/3_2/GGGGA/ds-3_2-GGGGA_x.pdb.gz
MCSYM-DB/3_2/GGGGC/
MCSYM-DB/3_2/GGGGC/3_2-GGGGC.mcs
MCSYM-DB/3_2/GGGGC/ds-3_2-GGGGC_x.pdb.gz
MCSYM-DB/3_2/GGGGG/
MCSYM-DB/3_2/GGGGG/3_2-GGGGG.mcs
MCSYM-DB/3_2/GGGGG/ds-3_2-GGGGG_x.pdb.gz
MCSYM-DB/3_2/GGGGU/
MCSYM-DB/3_2/GGGGU/3_2-GGGGU.mcs
MCSYM-DB/3_2/GGGGU/ds-3_2-GGGGU_x.pdb.gz
MCSYM-DB/3_2/GGGUA/
MCSYM-DB/3_2/GGGUA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/GGGUA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GGGUA/3_2-GGGUA.mcs
MCSYM-DB/3_2/GGGUA/ds-3_2-GGGUA_x.pdb.gz
MCSYM-DB/3_2/GGGUC/
MCSYM-DB/3_2/GGGUC/3_2-GGGUC.mcs
MCSYM-DB/3_2/GGGUC/ds-3_2-GGGUC_x.pdb.gz
MCSYM-DB/3_2/GGGUG/
MCSYM-DB/3_2/GGGUG/3_2-GGGUG.mcs
MCSYM-DB/3_2/GGGUG/ds-3_2-GGGUG_x.pdb.gz
MCSYM-DB/3_2/GGGUU/
MCSYM-DB/3_2/GGGUU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GGGUU/3_2-GGGUU.mcs
MCSYM-DB/3_2/GGGUU/ds-3_2-GGGUU_x.pdb.gz
MCSYM-DB/3_2/GGUAA/
MCSYM-DB/3_2/GGUAA/3_2-GGUAA.mcs
MCSYM-DB/3_2/GGUAA/ds-3_2-GGUAA_x.pdb.gz
MCSYM-DB/3_2/GGUAC/
MCSYM-DB/3_2/GGUAC/3_2-GGUAC.mcs
MCSYM-DB/3_2/GGUAC/ds-3_2-GGUAC_x.pdb.gz
MCSYM-DB/3_2/GGUAG/
MCSYM-DB/3_2/GGUAG/3_2-GGUAG.mcs
MCSYM-DB/3_2/GGUAG/ds-3_2-GGUAG_x.pdb.gz
MCSYM-DB/3_2/GGUAU/
MCSYM-DB/3_2/GGUAU/3_2-GGUAU.mcs
MCSYM-DB/3_2/GGUAU/ds-3_2-GGUAU_x.pdb.gz
MCSYM-DB/3_2/GGUCA/
MCSYM-DB/3_2/GGUCA/3_2-GGUCA.mcs
MCSYM-DB/3_2/GGUCA/ds-3_2-GGUCA_x.pdb.gz
MCSYM-DB/3_2/GGUCC/
MCSYM-DB/3_2/GGUCC/1VFG_model_1.pdb.gz
MCSYM-DB/3_2/GGUCC/3_2-GGUCC.mcs
MCSYM-DB/3_2/GGUCC/ds-3_2-GGUCC_x.pdb.gz
MCSYM-DB/3_2/GGUCG/
MCSYM-DB/3_2/GGUCG/3_2-GGUCG.mcs
MCSYM-DB/3_2/GGUCG/ds-3_2-GGUCG_x.pdb.gz
MCSYM-DB/3_2/GGUCU/
MCSYM-DB/3_2/GGUCU/3_2-GGUCU.mcs
MCSYM-DB/3_2/GGUCU/ds-3_2-GGUCU_x.pdb.gz
MCSYM-DB/3_2/GGUGA/
MCSYM-DB/3_2/GGUGA/3_2-GGUGA.mcs
MCSYM-DB/3_2/GGUGA/ds-3_2-GGUGA_x.pdb.gz
MCSYM-DB/3_2/GGUGC/
MCSYM-DB/3_2/GGUGC/3_2-GGUGC.mcs
MCSYM-DB/3_2/GGUGC/ds-3_2-GGUGC_x.pdb.gz
MCSYM-DB/3_2/GGUGG/
MCSYM-DB/3_2/GGUGG/3_2-GGUGG.mcs
MCSYM-DB/3_2/GGUGG/ds-3_2-GGUGG_x.pdb.gz
MCSYM-DB/3_2/GGUGU/
MCSYM-DB/3_2/GGUGU/3_2-GGUGU.mcs
MCSYM-DB/3_2/GGUGU/ds-3_2-GGUGU_x.pdb.gz
MCSYM-DB/3_2/GGUUA/
MCSYM-DB/3_2/GGUUA/3_2-GGUUA.mcs
MCSYM-DB/3_2/GGUUA/ds-3_2-GGUUA_x.pdb.gz
MCSYM-DB/3_2/GGUUC/
MCSYM-DB/3_2/GGUUC/3_2-GGUUC.mcs
MCSYM-DB/3_2/GGUUC/ds-3_2-GGUUC_x.pdb.gz
MCSYM-DB/3_2/GGUUG/
MCSYM-DB/3_2/GGUUG/3_2-GGUUG.mcs
MCSYM-DB/3_2/GGUUG/ds-3_2-GGUUG_x.pdb.gz
MCSYM-DB/3_2/GGUUU/
MCSYM-DB/3_2/GGUUU/3_2-GGUUU.mcs
MCSYM-DB/3_2/GGUUU/ds-3_2-GGUUU_x.pdb.gz
MCSYM-DB/3_2/GUAAA/
MCSYM-DB/3_2/GUAAA/3_2-GUAAA.mcs
MCSYM-DB/3_2/GUAAA/ds-3_2-GUAAA_x.pdb.gz
MCSYM-DB/3_2/GUAAC/
MCSYM-DB/3_2/GUAAC/1F6U_model_1.pdb.gz
MCSYM-DB/3_2/GUAAC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GUAAC/3_2-GUAAC.mcs
MCSYM-DB/3_2/GUAAC/ds-3_2-GUAAC_x.pdb.gz
MCSYM-DB/3_2/GUAAG/
MCSYM-DB/3_2/GUAAG/3_2-GUAAG.mcs
MCSYM-DB/3_2/GUAAG/ds-3_2-GUAAG_x.pdb.gz
MCSYM-DB/3_2/GUAAU/
MCSYM-DB/3_2/GUAAU/3_2-GUAAU.mcs
MCSYM-DB/3_2/GUAAU/ds-3_2-GUAAU_x.pdb.gz
MCSYM-DB/3_2/GUAC/
MCSYM-DB/3_2/GUACA/
MCSYM-DB/3_2/GUACA/3_2-GUACA.mcs
MCSYM-DB/3_2/GUACA/ds-3_2-GUACA_x.pdb.gz
MCSYM-DB/3_2/GUACC/
MCSYM-DB/3_2/GUACC/3_2-GUACC.mcs
MCSYM-DB/3_2/GUACC/ds-3_2-GUACC_x.pdb.gz
MCSYM-DB/3_2/GUACG/
MCSYM-DB/3_2/GUACG/3_2-GUACG.mcs
MCSYM-DB/3_2/GUACG/ds-3_2-GUACG_x.pdb.gz
MCSYM-DB/3_2/GUACU/
MCSYM-DB/3_2/GUACU/3_2-GUACU.mcs
MCSYM-DB/3_2/GUACU/ds-3_2-GUACU_x.pdb.gz
MCSYM-DB/3_2/GUAGA/
MCSYM-DB/3_2/GUAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GUAGA/3_2-GUAGA.mcs
MCSYM-DB/3_2/GUAGA/ds-3_2-GUAGA_x.pdb.gz
MCSYM-DB/3_2/GUAGC/
MCSYM-DB/3_2/GUAGC/3_2-GUAGC.mcs
MCSYM-DB/3_2/GUAGC/ds-3_2-GUAGC_x.pdb.gz
MCSYM-DB/3_2/GUAGG/
MCSYM-DB/3_2/GUAGG/1CSL_model_1.pdb.gz
MCSYM-DB/3_2/GUAGG/1DUQ_model_1.pdb.gz
MCSYM-DB/3_2/GUAGG/1EBR_model_1.pdb.gz
MCSYM-DB/3_2/GUAGG/1G70_model_1.pdb.gz
MCSYM-DB/3_2/GUAGG/1I9F_model_1.pdb.gz
MCSYM-DB/3_2/GUAGG/3_2-GUAGG.mcs
MCSYM-DB/3_2/GUAGG/ds-3_2-GUAGG_x.pdb.gz
MCSYM-DB/3_2/GUAGU/
MCSYM-DB/3_2/GUAGU/3_2-GUAGU.mcs
MCSYM-DB/3_2/GUAGU/ds-3_2-GUAGU_x.pdb.gz
MCSYM-DB/3_2/GUAUA/
MCSYM-DB/3_2/GUAUA/1R2P_model_1.pdb.gz
MCSYM-DB/3_2/GUAUA/1YNC_model_1.pdb.gz
MCSYM-DB/3_2/GUAUA/3_2-GUAUA.mcs
MCSYM-DB/3_2/GUAUA/ds-3_2-GUAUA_x.pdb.gz
MCSYM-DB/3_2/GUAUC/
MCSYM-DB/3_2/GUAUC/2A9X_model_1.pdb.gz
MCSYM-DB/3_2/GUAUC/3_2-GUAUC.mcs
MCSYM-DB/3_2/GUAUC/ds-3_2-GUAUC_x.pdb.gz
MCSYM-DB/3_2/GUAUG/
MCSYM-DB/3_2/GUAUG/3_2-GUAUG.mcs
MCSYM-DB/3_2/GUAUG/ds-3_2-GUAUG_x.pdb.gz
MCSYM-DB/3_2/GUAUU/
MCSYM-DB/3_2/GUAUU/3_2-GUAUU.mcs
MCSYM-DB/3_2/GUAUU/ds-3_2-GUAUU_x.pdb.gz
MCSYM-DB/3_2/GUCA/
MCSYM-DB/3_2/GUCAA/
MCSYM-DB/3_2/GUCAA/3_2-GUCAA.mcs
MCSYM-DB/3_2/GUCAA/ds-3_2-GUCAA_x.pdb.gz
MCSYM-DB/3_2/GUCAC/
MCSYM-DB/3_2/GUCAC/1L2X_model_1.pdb.gz
MCSYM-DB/3_2/GUCAC/2A43_model_1.pdb.gz
MCSYM-DB/3_2/GUCAC/3_2-GUCAC.mcs
MCSYM-DB/3_2/GUCAC/ds-3_2-GUCAC_x.pdb.gz
MCSYM-DB/3_2/GUCAG/
MCSYM-DB/3_2/GUCAG/3_2-GUCAG.mcs
MCSYM-DB/3_2/GUCAG/ds-3_2-GUCAG_x.pdb.gz
MCSYM-DB/3_2/GUCAU/
MCSYM-DB/3_2/GUCAU/3_2-GUCAU.mcs
MCSYM-DB/3_2/GUCAU/ds-3_2-GUCAU_x.pdb.gz
MCSYM-DB/3_2/GUCCA/
MCSYM-DB/3_2/GUCCA/3_2-GUCCA.mcs
MCSYM-DB/3_2/GUCCA/ds-3_2-GUCCA_x.pdb.gz
MCSYM-DB/3_2/GUCCC/
MCSYM-DB/3_2/GUCCC/3_2-GUCCC.mcs
MCSYM-DB/3_2/GUCCC/ds-3_2-GUCCC_x.pdb.gz
MCSYM-DB/3_2/GUCCG/
MCSYM-DB/3_2/GUCCG/3_2-GUCCG.mcs
MCSYM-DB/3_2/GUCCG/ds-3_2-GUCCG_x.pdb.gz
MCSYM-DB/3_2/GUCCU/
MCSYM-DB/3_2/GUCCU/3_2-GUCCU.mcs
MCSYM-DB/3_2/GUCCU/ds-3_2-GUCCU_x.pdb.gz
MCSYM-DB/3_2/GUCGA/
MCSYM-DB/3_2/GUCGA/2BS1_model_1.pdb.gz
MCSYM-DB/3_2/GUCGA/3_2-GUCGA.mcs
MCSYM-DB/3_2/GUCGA/ds-3_2-GUCGA_x.pdb.gz
MCSYM-DB/3_2/GUCGC/
MCSYM-DB/3_2/GUCGC/1F6X_model_1.pdb.gz
MCSYM-DB/3_2/GUCGC/1L2X_model_1.pdb.gz
MCSYM-DB/3_2/GUCGC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GUCGC/2A43_model_1.pdb.gz
MCSYM-DB/3_2/GUCGC/3_2-GUCGC.mcs
MCSYM-DB/3_2/GUCGC/ds-3_2-GUCGC.pdb.gz
MCSYM-DB/3_2/GUCGC/ds-3_2-GUCGC_x.pdb.gz
MCSYM-DB/3_2/GUCGG/
MCSYM-DB/3_2/GUCGG/3_2-GUCGG.mcs
MCSYM-DB/3_2/GUCGG/ds-3_2-GUCGG_x.pdb.gz
MCSYM-DB/3_2/GUCGU/
MCSYM-DB/3_2/GUCGU/1FQZ_model_1.pdb.gz
MCSYM-DB/3_2/GUCGU/3_2-GUCGU.mcs
MCSYM-DB/3_2/GUCGU/ds-3_2-GUCGU_x.pdb.gz
MCSYM-DB/3_2/GUCUA/
MCSYM-DB/3_2/GUCUA/3_2-GUCUA.mcs
MCSYM-DB/3_2/GUCUA/ds-3_2-GUCUA_x.pdb.gz
MCSYM-DB/3_2/GUCUC/
MCSYM-DB/3_2/GUCUC/3_2-GUCUC.mcs
MCSYM-DB/3_2/GUCUC/ds-3_2-GUCUC_x.pdb.gz
MCSYM-DB/3_2/GUCUG/
MCSYM-DB/3_2/GUCUG/3_2-GUCUG.mcs
MCSYM-DB/3_2/GUCUG/ds-3_2-GUCUG_x.pdb.gz
MCSYM-DB/3_2/GUCUU/
MCSYM-DB/3_2/GUCUU/3_2-GUCUU.mcs
MCSYM-DB/3_2/GUCUU/ds-3_2-GUCUU_x.pdb.gz
MCSYM-DB/3_2/GUGAA/
MCSYM-DB/3_2/GUGAA/3_2-GUGAA.mcs
MCSYM-DB/3_2/GUGAA/ds-3_2-GUGAA_x.pdb.gz
MCSYM-DB/3_2/GUGAC/
MCSYM-DB/3_2/GUGAC/3_2-GUGAC.mcs
MCSYM-DB/3_2/GUGAC/ds-3_2-GUGAC_x.pdb.gz
MCSYM-DB/3_2/GUGAG/
MCSYM-DB/3_2/GUGAG/3_2-GUGAG.mcs
MCSYM-DB/3_2/GUGAG/ds-3_2-GUGAG_x.pdb.gz
MCSYM-DB/3_2/GUGAU/
MCSYM-DB/3_2/GUGAU/3_2-GUGAU.mcs
MCSYM-DB/3_2/GUGAU/ds-3_2-GUGAU_x.pdb.gz
MCSYM-DB/3_2/GUGCA/
MCSYM-DB/3_2/GUGCA/2D1A_model_1.pdb.gz
MCSYM-DB/3_2/GUGCA/3_2-GUGCA.mcs
MCSYM-DB/3_2/GUGCA/ds-3_2-GUGCA_x.pdb.gz
MCSYM-DB/3_2/GUGCC/
MCSYM-DB/3_2/GUGCC/1DDY_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1ET4_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1JOX_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1P5M_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1P5O_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1RKJ_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1S2F_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1U6P_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/2A9X_model_1.pdb.gz
MCSYM-DB/3_2/GUGCC/3_2-GUGCC.mcs
MCSYM-DB/3_2/GUGCC/ds-3_2-GUGCC_x.pdb.gz
MCSYM-DB/3_2/GUGCG/
MCSYM-DB/3_2/GUGCG/3_2-GUGCG.mcs
MCSYM-DB/3_2/GUGCG/ds-3_2-GUGCG_x.pdb.gz
MCSYM-DB/3_2/GUGCU/
MCSYM-DB/3_2/GUGCU/1Q75_model_1.pdb.gz
MCSYM-DB/3_2/GUGCU/1Y39_model_1.pdb.gz
MCSYM-DB/3_2/GUGCU/3_2-GUGCU.mcs
MCSYM-DB/3_2/GUGCU/ds-3_2-GUGCU_x.pdb.gz
MCSYM-DB/3_2/GUGGA/
MCSYM-DB/3_2/GUGGA/3_2-GUGGA.mcs
MCSYM-DB/3_2/GUGGA/ds-3_2-GUGGA_x.pdb.gz
MCSYM-DB/3_2/GUGGC/
MCSYM-DB/3_2/GUGGC/3_2-GUGGC.mcs
MCSYM-DB/3_2/GUGGC/ds-3_2-GUGGC_x.pdb.gz
MCSYM-DB/3_2/GUGGG/
MCSYM-DB/3_2/GUGGG/3_2-GUGGG.mcs
MCSYM-DB/3_2/GUGGG/ds-3_2-GUGGG_x.pdb.gz
MCSYM-DB/3_2/GUGGU/
MCSYM-DB/3_2/GUGGU/3_2-GUGGU.mcs
MCSYM-DB/3_2/GUGGU/ds-3_2-GUGGU_x.pdb.gz
MCSYM-DB/3_2/GUGUA/
MCSYM-DB/3_2/GUGUA/3_2-GUGUA.mcs
MCSYM-DB/3_2/GUGUA/ds-3_2-GUGUA_x.pdb.gz
MCSYM-DB/3_2/GUGUC/
MCSYM-DB/3_2/GUGUC/1P5M_model_1.pdb.gz
MCSYM-DB/3_2/GUGUC/1P5O_model_1.pdb.gz
MCSYM-DB/3_2/GUGUC/3_2-GUGUC.mcs
MCSYM-DB/3_2/GUGUC/ds-3_2-GUGUC_x.pdb.gz
MCSYM-DB/3_2/GUGUG/
MCSYM-DB/3_2/GUGUG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/GUGUG/3_2-GUGUG.mcs
MCSYM-DB/3_2/GUGUG/ds-3_2-GUGUG_x.pdb.gz
MCSYM-DB/3_2/GUGUU/
MCSYM-DB/3_2/GUGUU/3_2-GUGUU.mcs
MCSYM-DB/3_2/GUGUU/ds-3_2-GUGUU_x.pdb.gz
MCSYM-DB/3_2/GUUAA/
MCSYM-DB/3_2/GUUAA/2AU4_model_1.pdb.gz
MCSYM-DB/3_2/GUUAA/3_2-GUUAA.mcs
MCSYM-DB/3_2/GUUAA/ds-3_2-GUUAA_x.pdb.gz
MCSYM-DB/3_2/GUUAC/
MCSYM-DB/3_2/GUUAC/1L8V_model_1.pdb.gz
MCSYM-DB/3_2/GUUAC/3_2-GUUAC.mcs
MCSYM-DB/3_2/GUUAC/ds-3_2-GUUAC_x.pdb.gz
MCSYM-DB/3_2/GUUAG/
MCSYM-DB/3_2/GUUAG/3_2-GUUAG.mcs
MCSYM-DB/3_2/GUUAG/ds-3_2-GUUAG_x.pdb.gz
MCSYM-DB/3_2/GUUAU/
MCSYM-DB/3_2/GUUAU/3_2-GUUAU.mcs
MCSYM-DB/3_2/GUUAU/ds-3_2-GUUAU_x.pdb.gz
MCSYM-DB/3_2/GUUCA/
MCSYM-DB/3_2/GUUCA/3_2-GUUCA.mcs
MCSYM-DB/3_2/GUUCA/ds-3_2-GUUCA_x.pdb.gz
MCSYM-DB/3_2/GUUCC/
MCSYM-DB/3_2/GUUCC/3_2-GUUCC.mcs
MCSYM-DB/3_2/GUUCC/ds-3_2-GUUCC_x.pdb.gz
MCSYM-DB/3_2/GUUCG/
MCSYM-DB/3_2/GUUCG/3_2-GUUCG.mcs
MCSYM-DB/3_2/GUUCG/ds-3_2-GUUCG_x.pdb.gz
MCSYM-DB/3_2/GUUCU/
MCSYM-DB/3_2/GUUCU/3_2-GUUCU.mcs
MCSYM-DB/3_2/GUUCU/ds-3_2-GUUCU_x.pdb.gz
MCSYM-DB/3_2/GUUGA/
MCSYM-DB/3_2/GUUGA/3_2-GUUGA.mcs
MCSYM-DB/3_2/GUUGA/ds-3_2-GUUGA_x.pdb.gz
MCSYM-DB/3_2/GUUGC/
MCSYM-DB/3_2/GUUGC/3_2-GUUGC.mcs
MCSYM-DB/3_2/GUUGC/ds-3_2-GUUGC_x.pdb.gz
MCSYM-DB/3_2/GUUGG/
MCSYM-DB/3_2/GUUGG/3_2-GUUGG.mcs
MCSYM-DB/3_2/GUUGG/ds-3_2-GUUGG_x.pdb.gz
MCSYM-DB/3_2/GUUGU/
MCSYM-DB/3_2/GUUGU/3_2-GUUGU.mcs
MCSYM-DB/3_2/GUUGU/ds-3_2-GUUGU_x.pdb.gz
MCSYM-DB/3_2/GUUUA/
MCSYM-DB/3_2/GUUUA/3_2-GUUUA.mcs
MCSYM-DB/3_2/GUUUA/ds-3_2-GUUUA_x.pdb.gz
MCSYM-DB/3_2/GUUUC/
MCSYM-DB/3_2/GUUUC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/GUUUC/3_2-GUUUC.mcs
MCSYM-DB/3_2/GUUUC/ds-3_2-GUUUC_x.pdb.gz
MCSYM-DB/3_2/GUUUG/
MCSYM-DB/3_2/GUUUG/3_2-GUUUG.mcs
MCSYM-DB/3_2/GUUUG/ds-3_2-GUUUG_x.pdb.gz
MCSYM-DB/3_2/GUUUU/
MCSYM-DB/3_2/GUUUU/3_2-GUUUU.mcs
MCSYM-DB/3_2/GUUUU/ds-3_2-GUUUU_x.pdb.gz
MCSYM-DB/3_2/UAAAA/
MCSYM-DB/3_2/UAAAA/3_2-UAAAA.mcs
MCSYM-DB/3_2/UAAAA/ds-3_2-UAAAA_x.pdb.gz
MCSYM-DB/3_2/UAAAC/
MCSYM-DB/3_2/UAAAC/3_2-UAAAC.mcs
MCSYM-DB/3_2/UAAAC/ds-3_2-UAAAC_x.pdb.gz
MCSYM-DB/3_2/UAAAG/
MCSYM-DB/3_2/UAAAG/3_2-UAAAG.mcs
MCSYM-DB/3_2/UAAAG/ds-3_2-UAAAG_x.pdb.gz
MCSYM-DB/3_2/UAAAU/
MCSYM-DB/3_2/UAAAU/3_2-UAAAU.mcs
MCSYM-DB/3_2/UAAAU/ds-3_2-UAAAU_x.pdb.gz
MCSYM-DB/3_2/UAACA/
MCSYM-DB/3_2/UAACA/3_2-UAACA.mcs
MCSYM-DB/3_2/UAACA/ds-3_2-UAACA_x.pdb.gz
MCSYM-DB/3_2/UAACC/
MCSYM-DB/3_2/UAACC/3_2-UAACC.mcs
MCSYM-DB/3_2/UAACC/ds-3_2-UAACC_x.pdb.gz
MCSYM-DB/3_2/UAACG/
MCSYM-DB/3_2/UAACG/3_2-UAACG.mcs
MCSYM-DB/3_2/UAACG/ds-3_2-UAACG_x.pdb.gz
MCSYM-DB/3_2/UAACU/
MCSYM-DB/3_2/UAACU/1QU2_model_1.pdb.gz
MCSYM-DB/3_2/UAACU/3_2-UAACU.mcs
MCSYM-DB/3_2/UAACU/ds-3_2-UAACU_x.pdb.gz
MCSYM-DB/3_2/UAAGA/
MCSYM-DB/3_2/UAAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UAAGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UAAGA/3_2-UAAGA.mcs
MCSYM-DB/3_2/UAAGA/ds-3_2-UAAGA_x.pdb.gz
MCSYM-DB/3_2/UAAGC/
MCSYM-DB/3_2/UAAGC/3_2-UAAGC.mcs
MCSYM-DB/3_2/UAAGC/ds-3_2-UAAGC_x.pdb.gz
MCSYM-DB/3_2/UAAGG/
MCSYM-DB/3_2/UAAGG/3_2-UAAGG.mcs
MCSYM-DB/3_2/UAAGG/ds-3_2-UAAGG_x.pdb.gz
MCSYM-DB/3_2/UAAGU/
MCSYM-DB/3_2/UAAGU/3_2-UAAGU.mcs
MCSYM-DB/3_2/UAAGU/ds-3_2-UAAGU_x.pdb.gz
MCSYM-DB/3_2/UAAUA/
MCSYM-DB/3_2/UAAUA/1I9X_model_1.pdb.gz
MCSYM-DB/3_2/UAAUA/1LMV_model_1.pdb.gz
MCSYM-DB/3_2/UAAUA/1U0B_model_1.pdb.gz
MCSYM-DB/3_2/UAAUA/3_2-UAAUA.mcs
MCSYM-DB/3_2/UAAUA/ds-3_2-UAAUA_x.pdb.gz
MCSYM-DB/3_2/UAAUC/
MCSYM-DB/3_2/UAAUC/3_2-UAAUC.mcs
MCSYM-DB/3_2/UAAUC/ds-3_2-UAAUC_x.pdb.gz
MCSYM-DB/3_2/UAAUG/
MCSYM-DB/3_2/UAAUG/1BGZ_model_1.pdb.gz
MCSYM-DB/3_2/UAAUG/1I6U_model_1.pdb.gz
MCSYM-DB/3_2/UAAUG/3_2-UAAUG.mcs
MCSYM-DB/3_2/UAAUG/ds-3_2-UAAUG_x.pdb.gz
MCSYM-DB/3_2/UAAUU/
MCSYM-DB/3_2/UAAUU/3_2-UAAUU.mcs
MCSYM-DB/3_2/UAAUU/ds-3_2-UAAUU_x.pdb.gz
MCSYM-DB/3_2/UACAA/
MCSYM-DB/3_2/UACAA/3_2-UACAA.mcs
MCSYM-DB/3_2/UACAA/ds-3_2-UACAA_x.pdb.gz
MCSYM-DB/3_2/UACAC/
MCSYM-DB/3_2/UACAC/3_2-UACAC.mcs
MCSYM-DB/3_2/UACAC/ds-3_2-UACAC_x.pdb.gz
MCSYM-DB/3_2/UACAG/
MCSYM-DB/3_2/UACAG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UACAG/3_2-UACAG.mcs
MCSYM-DB/3_2/UACAG/ds-3_2-UACAG_x.pdb.gz
MCSYM-DB/3_2/UACAU/
MCSYM-DB/3_2/UACAU/3_2-UACAU.mcs
MCSYM-DB/3_2/UACAU/ds-3_2-UACAU_x.pdb.gz
MCSYM-DB/3_2/UACCA/
MCSYM-DB/3_2/UACCA/3_2-UACCA.mcs
MCSYM-DB/3_2/UACCA/ds-3_2-UACCA_x.pdb.gz
MCSYM-DB/3_2/UACCC/
MCSYM-DB/3_2/UACCC/3_2-UACCC.mcs
MCSYM-DB/3_2/UACCC/ds-3_2-UACCC_x.pdb.gz
MCSYM-DB/3_2/UACCG/
MCSYM-DB/3_2/UACCG/3_2-UACCG.mcs
MCSYM-DB/3_2/UACCG/ds-3_2-UACCG_x.pdb.gz
MCSYM-DB/3_2/UACCU/
MCSYM-DB/3_2/UACCU/3_2-UACCU.mcs
MCSYM-DB/3_2/UACCU/ds-3_2-UACCU_x.pdb.gz
MCSYM-DB/3_2/UACGA/
MCSYM-DB/3_2/UACGA/1F6U_model_1.pdb.gz
MCSYM-DB/3_2/UACGA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/UACGA/1JZV_model_1.pdb.gz
MCSYM-DB/3_2/UACGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UACGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UACGA/3_2-UACGA.mcs
MCSYM-DB/3_2/UACGA/ds-3_2-UACGA_x.pdb.gz
MCSYM-DB/3_2/UACGC/
MCSYM-DB/3_2/UACGC/3_2-UACGC.mcs
MCSYM-DB/3_2/UACGC/ds-3_2-UACGC_x.pdb.gz
MCSYM-DB/3_2/UACGG/
MCSYM-DB/3_2/UACGG/1XJR_model_1.pdb.gz
MCSYM-DB/3_2/UACGG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UACGG/3_2-UACGG.mcs
MCSYM-DB/3_2/UACGG/ds-3_2-UACGG_x.pdb.gz
MCSYM-DB/3_2/UACGU/
MCSYM-DB/3_2/UACGU/1U8D_model_1.pdb.gz
MCSYM-DB/3_2/UACGU/1Y26_model_1.pdb.gz
MCSYM-DB/3_2/UACGU/1Y27_model_1.pdb.gz
MCSYM-DB/3_2/UACGU/3_2-UACGU.mcs
MCSYM-DB/3_2/UACGU/ds-3_2-UACGU_x.pdb.gz
MCSYM-DB/3_2/UACUA/
MCSYM-DB/3_2/UACUA/3_2-UACUA.mcs
MCSYM-DB/3_2/UACUA/ds-3_2-UACUA_x.pdb.gz
MCSYM-DB/3_2/UACUC/
MCSYM-DB/3_2/UACUC/3_2-UACUC.mcs
MCSYM-DB/3_2/UACUC/ds-3_2-UACUC_x.pdb.gz
MCSYM-DB/3_2/UACUG/
MCSYM-DB/3_2/UACUG/3_2-UACUG.mcs
MCSYM-DB/3_2/UACUG/ds-3_2-UACUG_x.pdb.gz
MCSYM-DB/3_2/UACUU/
MCSYM-DB/3_2/UACUU/3_2-UACUU.mcs
MCSYM-DB/3_2/UACUU/ds-3_2-UACUU_x.pdb.gz
MCSYM-DB/3_2/UAGAA/
MCSYM-DB/3_2/UAGAA/3_2-UAGAA.mcs
MCSYM-DB/3_2/UAGAA/ds-3_2-UAGAA_x.pdb.gz
MCSYM-DB/3_2/UAGAC/
MCSYM-DB/3_2/UAGAC/3_2-UAGAC.mcs
MCSYM-DB/3_2/UAGAC/ds-3_2-UAGAC_x.pdb.gz
MCSYM-DB/3_2/UAGAG/
MCSYM-DB/3_2/UAGAG/3_2-UAGAG.mcs
MCSYM-DB/3_2/UAGAG/ds-3_2-UAGAG_x.pdb.gz
MCSYM-DB/3_2/UAGAU/
MCSYM-DB/3_2/UAGAU/3_2-UAGAU.mcs
MCSYM-DB/3_2/UAGAU/ds-3_2-UAGAU_x.pdb.gz
MCSYM-DB/3_2/UAGCA/
MCSYM-DB/3_2/UAGCA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/UAGCA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UAGCA/3_2-UAGCA.mcs
MCSYM-DB/3_2/UAGCA/ds-3_2-UAGCA_x.pdb.gz
MCSYM-DB/3_2/UAGCC/
MCSYM-DB/3_2/UAGCC/3_2-UAGCC.mcs
MCSYM-DB/3_2/UAGCC/ds-3_2-UAGCC_x.pdb.gz
MCSYM-DB/3_2/UAGCG/
MCSYM-DB/3_2/UAGCG/1MFY_model_1.pdb.gz
MCSYM-DB/3_2/UAGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UAGCG/3_2-UAGCG.mcs
MCSYM-DB/3_2/UAGCG/ds-3_2-UAGCG_x.pdb.gz
MCSYM-DB/3_2/UAGCU/
MCSYM-DB/3_2/UAGCU/3_2-UAGCU.mcs
MCSYM-DB/3_2/UAGCU/ds-3_2-UAGCU_x.pdb.gz
MCSYM-DB/3_2/UAGGA/
MCSYM-DB/3_2/UAGGA/1G1X_model_1.pdb.gz
MCSYM-DB/3_2/UAGGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UAGGA/3_2-UAGGA.mcs
MCSYM-DB/3_2/UAGGA/ds-3_2-UAGGA_x.pdb.gz
MCSYM-DB/3_2/UAGGC/
MCSYM-DB/3_2/UAGGC/3_2-UAGGC.mcs
MCSYM-DB/3_2/UAGGC/ds-3_2-UAGGC_x.pdb.gz
MCSYM-DB/3_2/UAGGG/
MCSYM-DB/3_2/UAGGG/3_2-UAGGG.mcs
MCSYM-DB/3_2/UAGGG/ds-3_2-UAGGG_x.pdb.gz
MCSYM-DB/3_2/UAGGU/
MCSYM-DB/3_2/UAGGU/3_2-UAGGU.mcs
MCSYM-DB/3_2/UAGGU/ds-3_2-UAGGU_x.pdb.gz
MCSYM-DB/3_2/UAGUA/
MCSYM-DB/3_2/UAGUA/3_2-UAGUA.mcs
MCSYM-DB/3_2/UAGUA/ds-3_2-UAGUA_x.pdb.gz
MCSYM-DB/3_2/UAGUC/
MCSYM-DB/3_2/UAGUC/3_2-UAGUC.mcs
MCSYM-DB/3_2/UAGUC/ds-3_2-UAGUC_x.pdb.gz
MCSYM-DB/3_2/UAGUG/
MCSYM-DB/3_2/UAGUG/3_2-UAGUG.mcs
MCSYM-DB/3_2/UAGUG/ds-3_2-UAGUG_x.pdb.gz
MCSYM-DB/3_2/UAGUU/
MCSYM-DB/3_2/UAGUU/3_2-UAGUU.mcs
MCSYM-DB/3_2/UAGUU/ds-3_2-UAGUU_x.pdb.gz
MCSYM-DB/3_2/UAUAA/
MCSYM-DB/3_2/UAUAA/3_2-UAUAA.mcs
MCSYM-DB/3_2/UAUAA/ds-3_2-UAUAA_x.pdb.gz
MCSYM-DB/3_2/UAUAC/
MCSYM-DB/3_2/UAUAC/3_2-UAUAC.mcs
MCSYM-DB/3_2/UAUAC/ds-3_2-UAUAC_x.pdb.gz
MCSYM-DB/3_2/UAUAG/
MCSYM-DB/3_2/UAUAG/1L8V_model_1.pdb.gz
MCSYM-DB/3_2/UAUAG/3_2-UAUAG.mcs
MCSYM-DB/3_2/UAUAG/ds-3_2-UAUAG_x.pdb.gz
MCSYM-DB/3_2/UAUAU/
MCSYM-DB/3_2/UAUAU/3_2-UAUAU.mcs
MCSYM-DB/3_2/UAUAU/ds-3_2-UAUAU_x.pdb.gz
MCSYM-DB/3_2/UAUCA/
MCSYM-DB/3_2/UAUCA/3_2-UAUCA.mcs
MCSYM-DB/3_2/UAUCA/ds-3_2-UAUCA_x.pdb.gz
MCSYM-DB/3_2/UAUCC/
MCSYM-DB/3_2/UAUCC/3_2-UAUCC.mcs
MCSYM-DB/3_2/UAUCC/ds-3_2-UAUCC_x.pdb.gz
MCSYM-DB/3_2/UAUCG/
MCSYM-DB/3_2/UAUCG/3_2-UAUCG.mcs
MCSYM-DB/3_2/UAUCG/ds-3_2-UAUCG_x.pdb.gz
MCSYM-DB/3_2/UAUCU/
MCSYM-DB/3_2/UAUCU/3_2-UAUCU.mcs
MCSYM-DB/3_2/UAUCU/ds-3_2-UAUCU_x.pdb.gz
MCSYM-DB/3_2/UAUGA/
MCSYM-DB/3_2/UAUGA/3_2-UAUGA.mcs
MCSYM-DB/3_2/UAUGA/ds-3_2-UAUGA_x.pdb.gz
MCSYM-DB/3_2/UAUGC/
MCSYM-DB/3_2/UAUGC/3_2-UAUGC.mcs
MCSYM-DB/3_2/UAUGC/ds-3_2-UAUGC_x.pdb.gz
MCSYM-DB/3_2/UAUGG/
MCSYM-DB/3_2/UAUGG/3_2-UAUGG.mcs
MCSYM-DB/3_2/UAUGG/ds-3_2-UAUGG_x.pdb.gz
MCSYM-DB/3_2/UAUGU/
MCSYM-DB/3_2/UAUGU/3_2-UAUGU.mcs
MCSYM-DB/3_2/UAUGU/ds-3_2-UAUGU_x.pdb.gz
MCSYM-DB/3_2/UAUUA/
MCSYM-DB/3_2/UAUUA/3_2-UAUUA.mcs
MCSYM-DB/3_2/UAUUA/ds-3_2-UAUUA_x.pdb.gz
MCSYM-DB/3_2/UAUUC/
MCSYM-DB/3_2/UAUUC/3_2-UAUUC.mcs
MCSYM-DB/3_2/UAUUC/ds-3_2-UAUUC_x.pdb.gz
MCSYM-DB/3_2/UAUUG/
MCSYM-DB/3_2/UAUUG/3_2-UAUUG.mcs
MCSYM-DB/3_2/UAUUG/ds-3_2-UAUUG_x.pdb.gz
MCSYM-DB/3_2/UAUUU/
MCSYM-DB/3_2/UAUUU/3_2-UAUUU.mcs
MCSYM-DB/3_2/UAUUU/ds-3_2-UAUUU_x.pdb.gz
MCSYM-DB/3_2/UCAAA/
MCSYM-DB/3_2/UCAAA/3_2-UCAAA.mcs
MCSYM-DB/3_2/UCAAA/ds-3_2-UCAAA_x.pdb.gz
MCSYM-DB/3_2/UCAAC/
MCSYM-DB/3_2/UCAAC/3_2-UCAAC.mcs
MCSYM-DB/3_2/UCAAC/ds-3_2-UCAAC_x.pdb.gz
MCSYM-DB/3_2/UCAAG/
MCSYM-DB/3_2/UCAAG/3_2-UCAAG.mcs
MCSYM-DB/3_2/UCAAG/ds-3_2-UCAAG_x.pdb.gz
MCSYM-DB/3_2/UCAAU/
MCSYM-DB/3_2/UCAAU/3_2-UCAAU.mcs
MCSYM-DB/3_2/UCAAU/ds-3_2-UCAAU_x.pdb.gz
MCSYM-DB/3_2/UCACA/
MCSYM-DB/3_2/UCACA/3_2-UCACA.mcs
MCSYM-DB/3_2/UCACA/ds-3_2-UCACA_x.pdb.gz
MCSYM-DB/3_2/UCACC/
MCSYM-DB/3_2/UCACC/3_2-UCACC.mcs
MCSYM-DB/3_2/UCACC/ds-3_2-UCACC_x.pdb.gz
MCSYM-DB/3_2/UCACG/
MCSYM-DB/3_2/UCACG/3_2-UCACG.mcs
MCSYM-DB/3_2/UCACG/ds-3_2-UCACG_x.pdb.gz
MCSYM-DB/3_2/UCACU/
MCSYM-DB/3_2/UCACU/3_2-UCACU.mcs
MCSYM-DB/3_2/UCACU/ds-3_2-UCACU_x.pdb.gz
MCSYM-DB/3_2/UCAGA/
MCSYM-DB/3_2/UCAGA/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/UCAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UCAGA/3_2-UCAGA.mcs
MCSYM-DB/3_2/UCAGA/ds-3_2-UCAGA_x.pdb.gz
MCSYM-DB/3_2/UCAGC/
MCSYM-DB/3_2/UCAGC/3_2-UCAGC.mcs
MCSYM-DB/3_2/UCAGC/ds-3_2-UCAGC_x.pdb.gz
MCSYM-DB/3_2/UCAGG/
MCSYM-DB/3_2/UCAGG/3_2-UCAGG.mcs
MCSYM-DB/3_2/UCAGG/ds-3_2-UCAGG_x.pdb.gz
MCSYM-DB/3_2/UCAGU/
MCSYM-DB/3_2/UCAGU/3_2-UCAGU.mcs
MCSYM-DB/3_2/UCAGU/ds-3_2-UCAGU_x.pdb.gz
MCSYM-DB/3_2/UCAUA/
MCSYM-DB/3_2/UCAUA/3_2-UCAUA.mcs
MCSYM-DB/3_2/UCAUA/ds-3_2-UCAUA_x.pdb.gz
MCSYM-DB/3_2/UCAUC/
MCSYM-DB/3_2/UCAUC/3_2-UCAUC.mcs
MCSYM-DB/3_2/UCAUC/ds-3_2-UCAUC_x.pdb.gz
MCSYM-DB/3_2/UCAUG/
MCSYM-DB/3_2/UCAUG/3_2-UCAUG.mcs
MCSYM-DB/3_2/UCAUG/ds-3_2-UCAUG_x.pdb.gz
MCSYM-DB/3_2/UCAUU/
MCSYM-DB/3_2/UCAUU/1JU7_model_1.pdb.gz
MCSYM-DB/3_2/UCAUU/3_2-UCAUU.mcs
MCSYM-DB/3_2/UCAUU/ds-3_2-UCAUU_x.pdb.gz
MCSYM-DB/3_2/UCCAA/
MCSYM-DB/3_2/UCCAA/3_2-UCCAA.mcs
MCSYM-DB/3_2/UCCAA/ds-3_2-UCCAA_x.pdb.gz
MCSYM-DB/3_2/UCCAC/
MCSYM-DB/3_2/UCCAC/3_2-UCCAC.mcs
MCSYM-DB/3_2/UCCAC/ds-3_2-UCCAC_x.pdb.gz
MCSYM-DB/3_2/UCCAG/
MCSYM-DB/3_2/UCCAG/3_2-UCCAG.mcs
MCSYM-DB/3_2/UCCAG/ds-3_2-UCCAG_x.pdb.gz
MCSYM-DB/3_2/UCCAU/
MCSYM-DB/3_2/UCCAU/3_2-UCCAU.mcs
MCSYM-DB/3_2/UCCAU/ds-3_2-UCCAU_x.pdb.gz
MCSYM-DB/3_2/UCCCA/
MCSYM-DB/3_2/UCCCA/3_2-UCCCA.mcs
MCSYM-DB/3_2/UCCCA/ds-3_2-UCCCA_x.pdb.gz
MCSYM-DB/3_2/UCCCC/
MCSYM-DB/3_2/UCCCC/3_2-UCCCC.mcs
MCSYM-DB/3_2/UCCCC/ds-3_2-UCCCC_x.pdb.gz
MCSYM-DB/3_2/UCCCG/
MCSYM-DB/3_2/UCCCG/3_2-UCCCG.mcs
MCSYM-DB/3_2/UCCCG/ds-3_2-UCCCG_x.pdb.gz
MCSYM-DB/3_2/UCCCU/
MCSYM-DB/3_2/UCCCU/3_2-UCCCU.mcs
MCSYM-DB/3_2/UCCCU/ds-3_2-UCCCU_x.pdb.gz
MCSYM-DB/3_2/UCCGA/
MCSYM-DB/3_2/UCCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UCCGA/3_2-UCCGA.mcs
MCSYM-DB/3_2/UCCGA/ds-3_2-UCCGA_x.pdb.gz
MCSYM-DB/3_2/UCCGC/
MCSYM-DB/3_2/UCCGC/3_2-UCCGC.mcs
MCSYM-DB/3_2/UCCGC/ds-3_2-UCCGC_x.pdb.gz
MCSYM-DB/3_2/UCCGG/
MCSYM-DB/3_2/UCCGG/3_2-UCCGG.mcs
MCSYM-DB/3_2/UCCGG/ds-3_2-UCCGG_x.pdb.gz
MCSYM-DB/3_2/UCCGU/
MCSYM-DB/3_2/UCCGU/3_2-UCCGU.mcs
MCSYM-DB/3_2/UCCGU/ds-3_2-UCCGU_x.pdb.gz
MCSYM-DB/3_2/UCCUA/
MCSYM-DB/3_2/UCCUA/3_2-UCCUA.mcs
MCSYM-DB/3_2/UCCUA/ds-3_2-UCCUA_x.pdb.gz
MCSYM-DB/3_2/UCCUC/
MCSYM-DB/3_2/UCCUC/3_2-UCCUC.mcs
MCSYM-DB/3_2/UCCUC/ds-3_2-UCCUC_x.pdb.gz
MCSYM-DB/3_2/UCCUG/
MCSYM-DB/3_2/UCCUG/3_2-UCCUG.mcs
MCSYM-DB/3_2/UCCUG/ds-3_2-UCCUG_x.pdb.gz
MCSYM-DB/3_2/UCCUU/
MCSYM-DB/3_2/UCCUU/3_2-UCCUU.mcs
MCSYM-DB/3_2/UCCUU/ds-3_2-UCCUU_x.pdb.gz
MCSYM-DB/3_2/UCGAA/
MCSYM-DB/3_2/UCGAA/3_2-UCGAA.mcs
MCSYM-DB/3_2/UCGAA/ds-3_2-UCGAA_x.pdb.gz
MCSYM-DB/3_2/UCGAC/
MCSYM-DB/3_2/UCGAC/3_2-UCGAC.mcs
MCSYM-DB/3_2/UCGAC/ds-3_2-UCGAC_x.pdb.gz
MCSYM-DB/3_2/UCGAG/
MCSYM-DB/3_2/UCGAG/3_2-UCGAG.mcs
MCSYM-DB/3_2/UCGAG/ds-3_2-UCGAG_x.pdb.gz
MCSYM-DB/3_2/UCGAU/
MCSYM-DB/3_2/UCGAU/3_2-UCGAU.mcs
MCSYM-DB/3_2/UCGAU/ds-3_2-UCGAU_x.pdb.gz
MCSYM-DB/3_2/UCGCA/
MCSYM-DB/3_2/UCGCA/1DQF_model_1.pdb.gz
MCSYM-DB/3_2/UCGCA/1Z31_model_1.pdb.gz
MCSYM-DB/3_2/UCGCA/3_2-UCGCA.mcs
MCSYM-DB/3_2/UCGCA/ds-3_2-UCGCA.pdb.gz
MCSYM-DB/3_2/UCGCA/ds-3_2-UCGCA_x.pdb.gz
MCSYM-DB/3_2/UCGCC/
MCSYM-DB/3_2/UCGCC/3_2-UCGCC.mcs
MCSYM-DB/3_2/UCGCC/ds-3_2-UCGCC_x.pdb.gz
MCSYM-DB/3_2/UCGCG/
MCSYM-DB/3_2/UCGCG/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/UCGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UCGCG/3_2-UCGCG.mcs
MCSYM-DB/3_2/UCGCG/ds-3_2-UCGCG_x.pdb.gz
MCSYM-DB/3_2/UCGCU/
MCSYM-DB/3_2/UCGCU/3_2-UCGCU.mcs
MCSYM-DB/3_2/UCGCU/ds-3_2-UCGCU_x.pdb.gz
MCSYM-DB/3_2/UCGGA/
MCSYM-DB/3_2/UCGGA/3_2-UCGGA.mcs
MCSYM-DB/3_2/UCGGA/ds-3_2-UCGGA_x.pdb.gz
MCSYM-DB/3_2/UCGGC/
MCSYM-DB/3_2/UCGGC/3_2-UCGGC.mcs
MCSYM-DB/3_2/UCGGC/ds-3_2-UCGGC_x.pdb.gz
MCSYM-DB/3_2/UCGGG/
MCSYM-DB/3_2/UCGGG/2D17_model_1.pdb.gz
MCSYM-DB/3_2/UCGGG/3_2-UCGGG.mcs
MCSYM-DB/3_2/UCGGG/ds-3_2-UCGGG_x.pdb.gz
MCSYM-DB/3_2/UCGGU/
MCSYM-DB/3_2/UCGGU/3_2-UCGGU.mcs
MCSYM-DB/3_2/UCGGU/ds-3_2-UCGGU_x.pdb.gz
MCSYM-DB/3_2/UCGUA/
MCSYM-DB/3_2/UCGUA/3_2-UCGUA.mcs
MCSYM-DB/3_2/UCGUA/ds-3_2-UCGUA_x.pdb.gz
MCSYM-DB/3_2/UCGUC/
MCSYM-DB/3_2/UCGUC/3_2-UCGUC.mcs
MCSYM-DB/3_2/UCGUC/ds-3_2-UCGUC_x.pdb.gz
MCSYM-DB/3_2/UCGUG/
MCSYM-DB/3_2/UCGUG/1FG0_model_1.pdb.gz
MCSYM-DB/3_2/UCGUG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UCGUG/3_2-UCGUG.mcs
MCSYM-DB/3_2/UCGUG/ds-3_2-UCGUG_x.pdb.gz
MCSYM-DB/3_2/UCGUU/
MCSYM-DB/3_2/UCGUU/3_2-UCGUU.mcs
MCSYM-DB/3_2/UCGUU/ds-3_2-UCGUU_x.pdb.gz
MCSYM-DB/3_2/UCUAA/
MCSYM-DB/3_2/UCUAA/3_2-UCUAA.mcs
MCSYM-DB/3_2/UCUAA/ds-3_2-UCUAA_x.pdb.gz
MCSYM-DB/3_2/UCUAC/
MCSYM-DB/3_2/UCUAC/3_2-UCUAC.mcs
MCSYM-DB/3_2/UCUAC/ds-3_2-UCUAC_x.pdb.gz
MCSYM-DB/3_2/UCUAG/
MCSYM-DB/3_2/UCUAG/2CSX_model_1.pdb.gz
MCSYM-DB/3_2/UCUAG/3_2-UCUAG.mcs
MCSYM-DB/3_2/UCUAG/ds-3_2-UCUAG_x.pdb.gz
MCSYM-DB/3_2/UCUAU/
MCSYM-DB/3_2/UCUAU/3_2-UCUAU.mcs
MCSYM-DB/3_2/UCUAU/ds-3_2-UCUAU_x.pdb.gz
MCSYM-DB/3_2/UCUCA/
MCSYM-DB/3_2/UCUCA/3_2-UCUCA.mcs
MCSYM-DB/3_2/UCUCA/ds-3_2-UCUCA_x.pdb.gz
MCSYM-DB/3_2/UCUCC/
MCSYM-DB/3_2/UCUCC/3_2-UCUCC.mcs
MCSYM-DB/3_2/UCUCC/ds-3_2-UCUCC_x.pdb.gz
MCSYM-DB/3_2/UCUCG/
MCSYM-DB/3_2/UCUCG/3_2-UCUCG.mcs
MCSYM-DB/3_2/UCUCG/ds-3_2-UCUCG_x.pdb.gz
MCSYM-DB/3_2/UCUCU/
MCSYM-DB/3_2/UCUCU/3_2-UCUCU.mcs
MCSYM-DB/3_2/UCUCU/ds-3_2-UCUCU_x.pdb.gz
MCSYM-DB/3_2/UCUGA/
MCSYM-DB/3_2/UCUGA/1MFJ_model_1.pdb.gz
MCSYM-DB/3_2/UCUGA/3_2-UCUGA.mcs
MCSYM-DB/3_2/UCUGA/ds-3_2-UCUGA_x.pdb.gz
MCSYM-DB/3_2/UCUGC/
MCSYM-DB/3_2/UCUGC/3_2-UCUGC.mcs
MCSYM-DB/3_2/UCUGC/ds-3_2-UCUGC_x.pdb.gz
MCSYM-DB/3_2/UCUGG/
MCSYM-DB/3_2/UCUGG/3_2-UCUGG.mcs
MCSYM-DB/3_2/UCUGG/ds-3_2-UCUGG_x.pdb.gz
MCSYM-DB/3_2/UCUGU/
MCSYM-DB/3_2/UCUGU/3_2-UCUGU.mcs
MCSYM-DB/3_2/UCUGU/ds-3_2-UCUGU_x.pdb.gz
MCSYM-DB/3_2/UCUUA/
MCSYM-DB/3_2/UCUUA/3_2-UCUUA.mcs
MCSYM-DB/3_2/UCUUA/ds-3_2-UCUUA_x.pdb.gz
MCSYM-DB/3_2/UCUUC/
MCSYM-DB/3_2/UCUUC/3_2-UCUUC.mcs
MCSYM-DB/3_2/UCUUC/ds-3_2-UCUUC_x.pdb.gz
MCSYM-DB/3_2/UCUUG/
MCSYM-DB/3_2/UCUUG/3_2-UCUUG.mcs
MCSYM-DB/3_2/UCUUG/ds-3_2-UCUUG_x.pdb.gz
MCSYM-DB/3_2/UCUUU/
MCSYM-DB/3_2/UCUUU/3_2-UCUUU.mcs
MCSYM-DB/3_2/UCUUU/ds-3_2-UCUUU.pdb.gz
MCSYM-DB/3_2/UCUUU/ds-3_2-UCUUU_x.pdb.gz
MCSYM-DB/3_2/UGAAA/
MCSYM-DB/3_2/UGAAA/3_2-UGAAA.mcs
MCSYM-DB/3_2/UGAAA/ds-3_2-UGAAA_x.pdb.gz
MCSYM-DB/3_2/UGAAC/
MCSYM-DB/3_2/UGAAC/3_2-UGAAC.mcs
MCSYM-DB/3_2/UGAAC/ds-3_2-UGAAC_x.pdb.gz
MCSYM-DB/3_2/UGAAG/
MCSYM-DB/3_2/UGAAG/3_2-UGAAG.mcs
MCSYM-DB/3_2/UGAAG/ds-3_2-UGAAG_x.pdb.gz
MCSYM-DB/3_2/UGAAU/
MCSYM-DB/3_2/UGAAU/3_2-UGAAU.mcs
MCSYM-DB/3_2/UGAAU/ds-3_2-UGAAU_x.pdb.gz
MCSYM-DB/3_2/UGACA/
MCSYM-DB/3_2/UGACA/3_2-UGACA.mcs
MCSYM-DB/3_2/UGACA/ds-3_2-UGACA_x.pdb.gz
MCSYM-DB/3_2/UGACC/
MCSYM-DB/3_2/UGACC/3_2-UGACC.mcs
MCSYM-DB/3_2/UGACC/ds-3_2-UGACC_x.pdb.gz
MCSYM-DB/3_2/UGACG/
MCSYM-DB/3_2/UGACG/3_2-UGACG.mcs
MCSYM-DB/3_2/UGACG/ds-3_2-UGACG_x.pdb.gz
MCSYM-DB/3_2/UGACU/
MCSYM-DB/3_2/UGACU/3_2-UGACU.mcs
MCSYM-DB/3_2/UGACU/ds-3_2-UGACU_x.pdb.gz
MCSYM-DB/3_2/UGAGA/
MCSYM-DB/3_2/UGAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UGAGA/3_2-UGAGA.mcs
MCSYM-DB/3_2/UGAGA/ds-3_2-UGAGA_x.pdb.gz
MCSYM-DB/3_2/UGAGC/
MCSYM-DB/3_2/UGAGC/3_2-UGAGC.mcs
MCSYM-DB/3_2/UGAGC/ds-3_2-UGAGC_x.pdb.gz
MCSYM-DB/3_2/UGAGG/
MCSYM-DB/3_2/UGAGG/3_2-UGAGG.mcs
MCSYM-DB/3_2/UGAGG/ds-3_2-UGAGG_x.pdb.gz
MCSYM-DB/3_2/UGAGU/
MCSYM-DB/3_2/UGAGU/3_2-UGAGU.mcs
MCSYM-DB/3_2/UGAGU/ds-3_2-UGAGU_x.pdb.gz
MCSYM-DB/3_2/UGAUA/
MCSYM-DB/3_2/UGAUA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UGAUA/3_2-UGAUA.mcs
MCSYM-DB/3_2/UGAUA/ds-3_2-UGAUA_x.pdb.gz
MCSYM-DB/3_2/UGAUC/
MCSYM-DB/3_2/UGAUC/3_2-UGAUC.mcs
MCSYM-DB/3_2/UGAUC/ds-3_2-UGAUC_x.pdb.gz
MCSYM-DB/3_2/UGAUG/
MCSYM-DB/3_2/UGAUG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UGAUG/3_2-UGAUG.mcs
MCSYM-DB/3_2/UGAUG/ds-3_2-UGAUG_x.pdb.gz
MCSYM-DB/3_2/UGAUU/
MCSYM-DB/3_2/UGAUU/3_2-UGAUU.mcs
MCSYM-DB/3_2/UGAUU/ds-3_2-UGAUU_x.pdb.gz
MCSYM-DB/3_2/UGCAA/
MCSYM-DB/3_2/UGCAA/3_2-UGCAA.mcs
MCSYM-DB/3_2/UGCAA/ds-3_2-UGCAA_x.pdb.gz
MCSYM-DB/3_2/UGCAC/
MCSYM-DB/3_2/UGCAC/3_2-UGCAC.mcs
MCSYM-DB/3_2/UGCAC/ds-3_2-UGCAC_x.pdb.gz
MCSYM-DB/3_2/UGCAG/
MCSYM-DB/3_2/UGCAG/3_2-UGCAG.mcs
MCSYM-DB/3_2/UGCAG/ds-3_2-UGCAG_x.pdb.gz
MCSYM-DB/3_2/UGCAU/
MCSYM-DB/3_2/UGCAU/3_2-UGCAU.mcs
MCSYM-DB/3_2/UGCAU/ds-3_2-UGCAU_x.pdb.gz
MCSYM-DB/3_2/UGCCA/
MCSYM-DB/3_2/UGCCA/3_2-UGCCA.mcs
MCSYM-DB/3_2/UGCCA/ds-3_2-UGCCA_x.pdb.gz
MCSYM-DB/3_2/UGCCC/
MCSYM-DB/3_2/UGCCC/3_2-UGCCC.mcs
MCSYM-DB/3_2/UGCCC/ds-3_2-UGCCC_x.pdb.gz
MCSYM-DB/3_2/UGCCG/
MCSYM-DB/3_2/UGCCG/3_2-UGCCG.mcs
MCSYM-DB/3_2/UGCCG/ds-3_2-UGCCG_x.pdb.gz
MCSYM-DB/3_2/UGCCU/
MCSYM-DB/3_2/UGCCU/3_2-UGCCU.mcs
MCSYM-DB/3_2/UGCCU/ds-3_2-UGCCU_x.pdb.gz
MCSYM-DB/3_2/UGCGA/
MCSYM-DB/3_2/UGCGA/3_2-UGCGA.mcs
MCSYM-DB/3_2/UGCGA/ds-3_2-UGCGA_x.pdb.gz
MCSYM-DB/3_2/UGCGC/
MCSYM-DB/3_2/UGCGC/3_2-UGCGC.mcs
MCSYM-DB/3_2/UGCGC/ds-3_2-UGCGC_x.pdb.gz
MCSYM-DB/3_2/UGCGG/
MCSYM-DB/3_2/UGCGG/1U9S_model_1.pdb.gz
MCSYM-DB/3_2/UGCGG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UGCGG/3_2-UGCGG.mcs
MCSYM-DB/3_2/UGCGG/ds-3_2-UGCGG_x.pdb.gz
MCSYM-DB/3_2/UGCGU/
MCSYM-DB/3_2/UGCGU/3_2-UGCGU.mcs
MCSYM-DB/3_2/UGCGU/ds-3_2-UGCGU_x.pdb.gz
MCSYM-DB/3_2/UGCUA/
MCSYM-DB/3_2/UGCUA/3_2-UGCUA.mcs
MCSYM-DB/3_2/UGCUA/ds-3_2-UGCUA_x.pdb.gz
MCSYM-DB/3_2/UGCUC/
MCSYM-DB/3_2/UGCUC/3_2-UGCUC.mcs
MCSYM-DB/3_2/UGCUC/ds-3_2-UGCUC_x.pdb.gz
MCSYM-DB/3_2/UGCUG/
MCSYM-DB/3_2/UGCUG/3_2-UGCUG.mcs
MCSYM-DB/3_2/UGCUG/ds-3_2-UGCUG_x.pdb.gz
MCSYM-DB/3_2/UGCUU/
MCSYM-DB/3_2/UGCUU/3_2-UGCUU.mcs
MCSYM-DB/3_2/UGCUU/ds-3_2-UGCUU_x.pdb.gz
MCSYM-DB/3_2/UGGAA/
MCSYM-DB/3_2/UGGAA/3_2-UGGAA.mcs
MCSYM-DB/3_2/UGGAA/ds-3_2-UGGAA_x.pdb.gz
MCSYM-DB/3_2/UGGAC/
MCSYM-DB/3_2/UGGAC/3_2-UGGAC.mcs
MCSYM-DB/3_2/UGGAC/ds-3_2-UGGAC_x.pdb.gz
MCSYM-DB/3_2/UGGAG/
MCSYM-DB/3_2/UGGAG/3_2-UGGAG.mcs
MCSYM-DB/3_2/UGGAG/ds-3_2-UGGAG_x.pdb.gz
MCSYM-DB/3_2/UGGAU/
MCSYM-DB/3_2/UGGAU/3_2-UGGAU.mcs
MCSYM-DB/3_2/UGGAU/ds-3_2-UGGAU_x.pdb.gz
MCSYM-DB/3_2/UGGCA/
MCSYM-DB/3_2/UGGCA/3_2-UGGCA.mcs
MCSYM-DB/3_2/UGGCA/ds-3_2-UGGCA_x.pdb.gz
MCSYM-DB/3_2/UGGCC/
MCSYM-DB/3_2/UGGCC/3_2-UGGCC.mcs
MCSYM-DB/3_2/UGGCC/ds-3_2-UGGCC_x.pdb.gz
MCSYM-DB/3_2/UGGCG/
MCSYM-DB/3_2/UGGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UGGCG/3_2-UGGCG.mcs
MCSYM-DB/3_2/UGGCG/ds-3_2-UGGCG_x.pdb.gz
MCSYM-DB/3_2/UGGCU/
MCSYM-DB/3_2/UGGCU/3_2-UGGCU.mcs
MCSYM-DB/3_2/UGGCU/ds-3_2-UGGCU_x.pdb.gz
MCSYM-DB/3_2/UGGGA/
MCSYM-DB/3_2/UGGGA/3_2-UGGGA.mcs
MCSYM-DB/3_2/UGGGA/ds-3_2-UGGGA_x.pdb.gz
MCSYM-DB/3_2/UGGGC/
MCSYM-DB/3_2/UGGGC/3_2-UGGGC.mcs
MCSYM-DB/3_2/UGGGC/ds-3_2-UGGGC_x.pdb.gz
MCSYM-DB/3_2/UGGGG/
MCSYM-DB/3_2/UGGGG/3_2-UGGGG.mcs
MCSYM-DB/3_2/UGGGG/ds-3_2-UGGGG_x.pdb.gz
MCSYM-DB/3_2/UGGGU/
MCSYM-DB/3_2/UGGGU/3_2-UGGGU.mcs
MCSYM-DB/3_2/UGGGU/ds-3_2-UGGGU_x.pdb.gz
MCSYM-DB/3_2/UGGUA/
MCSYM-DB/3_2/UGGUA/3_2-UGGUA.mcs
MCSYM-DB/3_2/UGGUA/ds-3_2-UGGUA_x.pdb.gz
MCSYM-DB/3_2/UGGUC/
MCSYM-DB/3_2/UGGUC/3_2-UGGUC.mcs
MCSYM-DB/3_2/UGGUC/ds-3_2-UGGUC_x.pdb.gz
MCSYM-DB/3_2/UGGUG/
MCSYM-DB/3_2/UGGUG/3_2-UGGUG.mcs
MCSYM-DB/3_2/UGGUG/ds-3_2-UGGUG_x.pdb.gz
MCSYM-DB/3_2/UGGUU/
MCSYM-DB/3_2/UGGUU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UGGUU/3_2-UGGUU.mcs
MCSYM-DB/3_2/UGGUU/ds-3_2-UGGUU_x.pdb.gz
MCSYM-DB/3_2/UGUAA/
MCSYM-DB/3_2/UGUAA/3_2-UGUAA.mcs
MCSYM-DB/3_2/UGUAA/ds-3_2-UGUAA_x.pdb.gz
MCSYM-DB/3_2/UGUAC/
MCSYM-DB/3_2/UGUAC/3_2-UGUAC.mcs
MCSYM-DB/3_2/UGUAC/ds-3_2-UGUAC_x.pdb.gz
MCSYM-DB/3_2/UGUAG/
MCSYM-DB/3_2/UGUAG/3_2-UGUAG.mcs
MCSYM-DB/3_2/UGUAG/ds-3_2-UGUAG_x.pdb.gz
MCSYM-DB/3_2/UGUAU/
MCSYM-DB/3_2/UGUAU/3_2-UGUAU.mcs
MCSYM-DB/3_2/UGUAU/ds-3_2-UGUAU_x.pdb.gz
MCSYM-DB/3_2/UGUCA/
MCSYM-DB/3_2/UGUCA/3_2-UGUCA.mcs
MCSYM-DB/3_2/UGUCA/ds-3_2-UGUCA_x.pdb.gz
MCSYM-DB/3_2/UGUCC/
MCSYM-DB/3_2/UGUCC/3_2-UGUCC.mcs
MCSYM-DB/3_2/UGUCC/ds-3_2-UGUCC_x.pdb.gz
MCSYM-DB/3_2/UGUCG/
MCSYM-DB/3_2/UGUCG/3_2-UGUCG.mcs
MCSYM-DB/3_2/UGUCG/ds-3_2-UGUCG_x.pdb.gz
MCSYM-DB/3_2/UGUCU/
MCSYM-DB/3_2/UGUCU/3_2-UGUCU.mcs
MCSYM-DB/3_2/UGUCU/ds-3_2-UGUCU_x.pdb.gz
MCSYM-DB/3_2/UGUGA/
MCSYM-DB/3_2/UGUGA/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UGUGA/3_2-UGUGA.mcs
MCSYM-DB/3_2/UGUGA/ds-3_2-UGUGA_x.pdb.gz
MCSYM-DB/3_2/UGUGC/
MCSYM-DB/3_2/UGUGC/3_2-UGUGC.mcs
MCSYM-DB/3_2/UGUGC/ds-3_2-UGUGC_x.pdb.gz
MCSYM-DB/3_2/UGUGG/
MCSYM-DB/3_2/UGUGG/3_2-UGUGG.mcs
MCSYM-DB/3_2/UGUGG/ds-3_2-UGUGG_x.pdb.gz
MCSYM-DB/3_2/UGUGU/
MCSYM-DB/3_2/UGUGU/3_2-UGUGU.mcs
MCSYM-DB/3_2/UGUGU/ds-3_2-UGUGU_x.pdb.gz
MCSYM-DB/3_2/UGUUA/
MCSYM-DB/3_2/UGUUA/2FRL_model_1.pdb.gz
MCSYM-DB/3_2/UGUUA/3_2-UGUUA.mcs
MCSYM-DB/3_2/UGUUA/ds-3_2-UGUUA_x.pdb.gz
MCSYM-DB/3_2/UGUUC/
MCSYM-DB/3_2/UGUUC/3_2-UGUUC.mcs
MCSYM-DB/3_2/UGUUC/ds-3_2-UGUUC_x.pdb.gz
MCSYM-DB/3_2/UGUUG/
MCSYM-DB/3_2/UGUUG/3_2-UGUUG.mcs
MCSYM-DB/3_2/UGUUG/ds-3_2-UGUUG_x.pdb.gz
MCSYM-DB/3_2/UGUUU/
MCSYM-DB/3_2/UGUUU/3_2-UGUUU.mcs
MCSYM-DB/3_2/UGUUU/ds-3_2-UGUUU_x.pdb.gz
MCSYM-DB/3_2/UUAAA/
MCSYM-DB/3_2/UUAAA/3_2-UUAAA.mcs
MCSYM-DB/3_2/UUAAA/ds-3_2-UUAAA_x.pdb.gz
MCSYM-DB/3_2/UUAAC/
MCSYM-DB/3_2/UUAAC/3_2-UUAAC.mcs
MCSYM-DB/3_2/UUAAC/ds-3_2-UUAAC_x.pdb.gz
MCSYM-DB/3_2/UUAAG/
MCSYM-DB/3_2/UUAAG/1N77_model_1.pdb.gz
MCSYM-DB/3_2/UUAAG/3_2-UUAAG.mcs
MCSYM-DB/3_2/UUAAG/ds-3_2-UUAAG_x.pdb.gz
MCSYM-DB/3_2/UUAAU/
MCSYM-DB/3_2/UUAAU/3_2-UUAAU.mcs
MCSYM-DB/3_2/UUAAU/ds-3_2-UUAAU_x.pdb.gz
MCSYM-DB/3_2/UUACA/
MCSYM-DB/3_2/UUACA/3_2-UUACA.mcs
MCSYM-DB/3_2/UUACA/ds-3_2-UUACA_x.pdb.gz
MCSYM-DB/3_2/UUACC/
MCSYM-DB/3_2/UUACC/3_2-UUACC.mcs
MCSYM-DB/3_2/UUACC/ds-3_2-UUACC_x.pdb.gz
MCSYM-DB/3_2/UUACG/
MCSYM-DB/3_2/UUACG/3_2-UUACG.mcs
MCSYM-DB/3_2/UUACG/ds-3_2-UUACG_x.pdb.gz
MCSYM-DB/3_2/UUACU/
MCSYM-DB/3_2/UUACU/3_2-UUACU.mcs
MCSYM-DB/3_2/UUACU/ds-3_2-UUACU_x.pdb.gz
MCSYM-DB/3_2/UUAGA/
MCSYM-DB/3_2/UUAGA/1M5K_model_1.pdb.gz
MCSYM-DB/3_2/UUAGA/1ZFV_model_1.pdb.gz
MCSYM-DB/3_2/UUAGA/3_2-UUAGA.mcs
MCSYM-DB/3_2/UUAGA/ds-3_2-UUAGA_x.pdb.gz
MCSYM-DB/3_2/UUAGC/
MCSYM-DB/3_2/UUAGC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UUAGC/3_2-UUAGC.mcs
MCSYM-DB/3_2/UUAGC/ds-3_2-UUAGC_x.pdb.gz
MCSYM-DB/3_2/UUAGG/
MCSYM-DB/3_2/UUAGG/3_2-UUAGG.mcs
MCSYM-DB/3_2/UUAGG/ds-3_2-UUAGG_x.pdb.gz
MCSYM-DB/3_2/UUAGU/
MCSYM-DB/3_2/UUAGU/3_2-UUAGU.mcs
MCSYM-DB/3_2/UUAGU/ds-3_2-UUAGU_x.pdb.gz
MCSYM-DB/3_2/UUAUA/
MCSYM-DB/3_2/UUAUA/3_2-UUAUA.mcs
MCSYM-DB/3_2/UUAUA/ds-3_2-UUAUA_x.pdb.gz
MCSYM-DB/3_2/UUAUC/
MCSYM-DB/3_2/UUAUC/3_2-UUAUC.mcs
MCSYM-DB/3_2/UUAUC/ds-3_2-UUAUC_x.pdb.gz
MCSYM-DB/3_2/UUAUG/
MCSYM-DB/3_2/UUAUG/3_2-UUAUG.mcs
MCSYM-DB/3_2/UUAUG/ds-3_2-UUAUG_x.pdb.gz
MCSYM-DB/3_2/UUAUU/
MCSYM-DB/3_2/UUAUU/3_2-UUAUU.mcs
MCSYM-DB/3_2/UUAUU/ds-3_2-UUAUU_x.pdb.gz
MCSYM-DB/3_2/UUCAA/
MCSYM-DB/3_2/UUCAA/3_2-UUCAA.mcs
MCSYM-DB/3_2/UUCAA/ds-3_2-UUCAA_x.pdb.gz
MCSYM-DB/3_2/UUCAC/
MCSYM-DB/3_2/UUCAC/3_2-UUCAC.mcs
MCSYM-DB/3_2/UUCAC/ds-3_2-UUCAC_x.pdb.gz
MCSYM-DB/3_2/UUCAG/
MCSYM-DB/3_2/UUCAG/3_2-UUCAG.mcs
MCSYM-DB/3_2/UUCAG/ds-3_2-UUCAG_x.pdb.gz
MCSYM-DB/3_2/UUCAU/
MCSYM-DB/3_2/UUCAU/3_2-UUCAU.mcs
MCSYM-DB/3_2/UUCAU/ds-3_2-UUCAU_x.pdb.gz
MCSYM-DB/3_2/UUCCA/
MCSYM-DB/3_2/UUCCA/3_2-UUCCA.mcs
MCSYM-DB/3_2/UUCCA/ds-3_2-UUCCA_x.pdb.gz
MCSYM-DB/3_2/UUCCC/
MCSYM-DB/3_2/UUCCC/3_2-UUCCC.mcs
MCSYM-DB/3_2/UUCCC/ds-3_2-UUCCC_x.pdb.gz
MCSYM-DB/3_2/UUCCG/
MCSYM-DB/3_2/UUCCG/3_2-UUCCG.mcs
MCSYM-DB/3_2/UUCCG/ds-3_2-UUCCG_x.pdb.gz
MCSYM-DB/3_2/UUCCU/
MCSYM-DB/3_2/UUCCU/3_2-UUCCU.mcs
MCSYM-DB/3_2/UUCCU/ds-3_2-UUCCU_x.pdb.gz
MCSYM-DB/3_2/UUCGA/
MCSYM-DB/3_2/UUCGA/1U6P_model_1.pdb.gz
MCSYM-DB/3_2/UUCGA/1XMQ_model_1.pdb.gz
MCSYM-DB/3_2/UUCGA/3_2-UUCGA.mcs
MCSYM-DB/3_2/UUCGA/ds-3_2-UUCGA_x.pdb.gz
MCSYM-DB/3_2/UUCGC/
MCSYM-DB/3_2/UUCGC/3_2-UUCGC.mcs
MCSYM-DB/3_2/UUCGC/ds-3_2-UUCGC_x.pdb.gz
MCSYM-DB/3_2/UUCGG/
MCSYM-DB/3_2/UUCGG/1F6Z_model_1.pdb.gz
MCSYM-DB/3_2/UUCGG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_2/UUCGG/3_2-UUCGG.mcs
MCSYM-DB/3_2/UUCGG/ds-3_2-UUCGG_x.pdb.gz
MCSYM-DB/3_2/UUCGU/
MCSYM-DB/3_2/UUCGU/3_2-UUCGU.mcs
MCSYM-DB/3_2/UUCGU/ds-3_2-UUCGU_x.pdb.gz
MCSYM-DB/3_2/UUCUA/
MCSYM-DB/3_2/UUCUA/3_2-UUCUA.mcs
MCSYM-DB/3_2/UUCUA/ds-3_2-UUCUA_x.pdb.gz
MCSYM-DB/3_2/UUCUC/
MCSYM-DB/3_2/UUCUC/3_2-UUCUC.mcs
MCSYM-DB/3_2/UUCUC/ds-3_2-UUCUC_x.pdb.gz
MCSYM-DB/3_2/UUCUG/
MCSYM-DB/3_2/UUCUG/3_2-UUCUG.mcs
MCSYM-DB/3_2/UUCUG/ds-3_2-UUCUG_x.pdb.gz
MCSYM-DB/3_2/UUCUU/
MCSYM-DB/3_2/UUCUU/3_2-UUCUU.mcs
MCSYM-DB/3_2/UUCUU/ds-3_2-UUCUU_x.pdb.gz
MCSYM-DB/3_2/UUGAA/
MCSYM-DB/3_2/UUGAA/3_2-UUGAA.mcs
MCSYM-DB/3_2/UUGAA/ds-3_2-UUGAA_x.pdb.gz
MCSYM-DB/3_2/UUGAC/
MCSYM-DB/3_2/UUGAC/3_2-UUGAC.mcs
MCSYM-DB/3_2/UUGAC/ds-3_2-UUGAC_x.pdb.gz
MCSYM-DB/3_2/UUGAG/
MCSYM-DB/3_2/UUGAG/3_2-UUGAG.mcs
MCSYM-DB/3_2/UUGAG/ds-3_2-UUGAG_x.pdb.gz
MCSYM-DB/3_2/UUGAU/
MCSYM-DB/3_2/UUGAU/3_2-UUGAU.mcs
MCSYM-DB/3_2/UUGAU/ds-3_2-UUGAU_x.pdb.gz
MCSYM-DB/3_2/UUGCA/
MCSYM-DB/3_2/UUGCA/1MFK_model_1.pdb.gz
MCSYM-DB/3_2/UUGCA/3_2-UUGCA.mcs
MCSYM-DB/3_2/UUGCA/ds-3_2-UUGCA.pdb.gz
MCSYM-DB/3_2/UUGCA/ds-3_2-UUGCA_x.pdb.gz
MCSYM-DB/3_2/UUGCC/
MCSYM-DB/3_2/UUGCC/3_2-UUGCC.mcs
MCSYM-DB/3_2/UUGCC/ds-3_2-UUGCC_x.pdb.gz
MCSYM-DB/3_2/UUGCG/
MCSYM-DB/3_2/UUGCG/3_2-UUGCG.mcs
MCSYM-DB/3_2/UUGCG/ds-3_2-UUGCG.pdb.gz
MCSYM-DB/3_2/UUGCG/ds-3_2-UUGCG_x.pdb.gz
MCSYM-DB/3_2/UUGCU/
MCSYM-DB/3_2/UUGCU/3_2-UUGCU.mcs
MCSYM-DB/3_2/UUGCU/ds-3_2-UUGCU_x.pdb.gz
MCSYM-DB/3_2/UUGGA/
MCSYM-DB/3_2/UUGGA/3_2-UUGGA.mcs
MCSYM-DB/3_2/UUGGA/ds-3_2-UUGGA_x.pdb.gz
MCSYM-DB/3_2/UUGGC/
MCSYM-DB/3_2/UUGGC/3_2-UUGGC.mcs
MCSYM-DB/3_2/UUGGC/ds-3_2-UUGGC_x.pdb.gz
MCSYM-DB/3_2/UUGGG/
MCSYM-DB/3_2/UUGGG/3_2-UUGGG.mcs
MCSYM-DB/3_2/UUGGG/ds-3_2-UUGGG_x.pdb.gz
MCSYM-DB/3_2/UUGGU/
MCSYM-DB/3_2/UUGGU/3_2-UUGGU.mcs
MCSYM-DB/3_2/UUGGU/ds-3_2-UUGGU_x.pdb.gz
MCSYM-DB/3_2/UUGUA/
MCSYM-DB/3_2/UUGUA/3_2-UUGUA.mcs
MCSYM-DB/3_2/UUGUA/ds-3_2-UUGUA_x.pdb.gz
MCSYM-DB/3_2/UUGUC/
MCSYM-DB/3_2/UUGUC/3_2-UUGUC.mcs
MCSYM-DB/3_2/UUGUC/ds-3_2-UUGUC_x.pdb.gz
MCSYM-DB/3_2/UUGUG/
MCSYM-DB/3_2/UUGUG/3_2-UUGUG.mcs
MCSYM-DB/3_2/UUGUG/ds-3_2-UUGUG_x.pdb.gz
MCSYM-DB/3_2/UUGUU/
MCSYM-DB/3_2/UUGUU/3_2-UUGUU.mcs
MCSYM-DB/3_2/UUGUU/ds-3_2-UUGUU_x.pdb.gz
MCSYM-DB/3_2/UUUAA/
MCSYM-DB/3_2/UUUAA/3_2-UUUAA.mcs
MCSYM-DB/3_2/UUUAA/ds-3_2-UUUAA_x.pdb.gz
MCSYM-DB/3_2/UUUAC/
MCSYM-DB/3_2/UUUAC/3_2-UUUAC.mcs
MCSYM-DB/3_2/UUUAC/ds-3_2-UUUAC_x.pdb.gz
MCSYM-DB/3_2/UUUAG/
MCSYM-DB/3_2/UUUAG/3_2-UUUAG.mcs
MCSYM-DB/3_2/UUUAG/ds-3_2-UUUAG_x.pdb.gz
MCSYM-DB/3_2/UUUAU/
MCSYM-DB/3_2/UUUAU/3_2-UUUAU.mcs
MCSYM-DB/3_2/UUUAU/ds-3_2-UUUAU_x.pdb.gz
MCSYM-DB/3_2/UUUCA/
MCSYM-DB/3_2/UUUCA/3_2-UUUCA.mcs
MCSYM-DB/3_2/UUUCA/ds-3_2-UUUCA_x.pdb.gz
MCSYM-DB/3_2/UUUCC/
MCSYM-DB/3_2/UUUCC/3_2-UUUCC.mcs
MCSYM-DB/3_2/UUUCC/ds-3_2-UUUCC_x.pdb.gz
MCSYM-DB/3_2/UUUCG/
MCSYM-DB/3_2/UUUCG/3_2-UUUCG.mcs
MCSYM-DB/3_2/UUUCG/ds-3_2-UUUCG_x.pdb.gz
MCSYM-DB/3_2/UUUCU/
MCSYM-DB/3_2/UUUCU/3_2-UUUCU.mcs
MCSYM-DB/3_2/UUUCU/ds-3_2-UUUCU_x.pdb.gz
MCSYM-DB/3_2/UUUGA/
MCSYM-DB/3_2/UUUGA/2ES5_model_1.pdb.gz
MCSYM-DB/3_2/UUUGA/3_2-UUUGA.mcs
MCSYM-DB/3_2/UUUGA/ds-3_2-UUUGA_x.pdb.gz
MCSYM-DB/3_2/UUUGC/
MCSYM-DB/3_2/UUUGC/3_2-UUUGC.mcs
MCSYM-DB/3_2/UUUGC/ds-3_2-UUUGC_x.pdb.gz
MCSYM-DB/3_2/UUUGG/
MCSYM-DB/3_2/UUUGG/3_2-UUUGG.mcs
MCSYM-DB/3_2/UUUGG/ds-3_2-UUUGG_x.pdb.gz
MCSYM-DB/3_2/UUUGU/
MCSYM-DB/3_2/UUUGU/3_2-UUUGU.mcs
MCSYM-DB/3_2/UUUGU/ds-3_2-UUUGU_x.pdb.gz
MCSYM-DB/3_2/UUUUA/
MCSYM-DB/3_2/UUUUA/3_2-UUUUA.mcs
MCSYM-DB/3_2/UUUUA/ds-3_2-UUUUA_x.pdb.gz
MCSYM-DB/3_2/UUUUC/
MCSYM-DB/3_2/UUUUC/3_2-UUUUC.mcs
MCSYM-DB/3_2/UUUUC/ds-3_2-UUUUC_x.pdb.gz
MCSYM-DB/3_2/UUUUG/
MCSYM-DB/3_2/UUUUG/3_2-UUUUG.mcs
MCSYM-DB/3_2/UUUUG/ds-3_2-UUUUG_x.pdb.gz
MCSYM-DB/3_2/UUUUU/
MCSYM-DB/3_2/UUUUU/3_2-UUUUU.mcs
MCSYM-DB/3_2/UUUUU/ds-3_2-UUUUU_x.pdb.gz
MCSYM-DB/3_2/3_2.stats
MCSYM-DB/3_2/make_3_2.bat
MCSYM-DB/3_2/make_3_2.mut.bat
MCSYM-DB/3_3/
MCSYM-DB/3_3/AAAAAA/
MCSYM-DB/3_3/AAAAAA/3_3-AAAAAA.mcs
MCSYM-DB/3_3/AAAAAA/ds-3_3-AAAAAA_x.pdb.gz
MCSYM-DB/3_3/AAAAAU/
MCSYM-DB/3_3/AAAAAU/3_3-AAAAAU.mcs
MCSYM-DB/3_3/AAAAAU/ds-3_3-AAAAAU_x.pdb.gz
MCSYM-DB/3_3/AAAACC/
MCSYM-DB/3_3/AAAACC/3_3-AAAACC.mcs
MCSYM-DB/3_3/AAAAGU/
MCSYM-DB/3_3/AAAAGU/3_3-AAAAGU.mcs
MCSYM-DB/3_3/AAAAGU/ds-3_3-AAAAGU_x.pdb.gz
MCSYM-DB/3_3/AAAAUG/
MCSYM-DB/3_3/AAAAUG/3_3-AAAAUG.mcs
MCSYM-DB/3_3/AAAAUU/
MCSYM-DB/3_3/AAAAUU/3_3-AAAAUU.mcs
MCSYM-DB/3_3/AAACAU/
MCSYM-DB/3_3/AAACAU/3_3-AAACAU.mcs
MCSYM-DB/3_3/AAACCA/
MCSYM-DB/3_3/AAACCA/3_3-AAACCA.mcs
MCSYM-DB/3_3/AAACCC/
MCSYM-DB/3_3/AAACCC/3_3-AAACCC.mcs
MCSYM-DB/3_3/AAACCU/
MCSYM-DB/3_3/AAACCU/3_3-AAACCU.mcs
MCSYM-DB/3_3/AAACGU/
MCSYM-DB/3_3/AAACGU/3_3-AAACGU.mcs
MCSYM-DB/3_3/AAACUU/
MCSYM-DB/3_3/AAACUU/3_3-AAACUU.mcs
MCSYM-DB/3_3/AAAGCU/
MCSYM-DB/3_3/AAAGCU/3_3-AAAGCU.mcs
MCSYM-DB/3_3/AAAGGG/
MCSYM-DB/3_3/AAAGGG/3_3-AAAGGG.mcs
MCSYM-DB/3_3/AAAGUU/
MCSYM-DB/3_3/AAAGUU/3_3-AAAGUU.mcs
MCSYM-DB/3_3/AAAUAA/
MCSYM-DB/3_3/AAAUAA/3_3-AAAUAA.mcs
MCSYM-DB/3_3/AAAUAA/ds-3_3-AAAUAA_x.pdb.gz
MCSYM-DB/3_3/AAAUAC/
MCSYM-DB/3_3/AAAUAC/3_3-AAAUAC.mcs
MCSYM-DB/3_3/AAAUAG/
MCSYM-DB/3_3/AAAUAG/3_3-AAAUAG.mcs
MCSYM-DB/3_3/AAAUAG/ds-3_3-AAAUAG_x.pdb.gz
MCSYM-DB/3_3/AAAUAU/
MCSYM-DB/3_3/AAAUAU/3_3-AAAUAU.mcs
MCSYM-DB/3_3/AAAUAU/ds-3_3-AAAUAU_x.pdb.gz
MCSYM-DB/3_3/AAAUCA/
MCSYM-DB/3_3/AAAUCA/3_3-AAAUCA.mcs
MCSYM-DB/3_3/AAAUCG/
MCSYM-DB/3_3/AAAUCG/3_3-AAAUCG.mcs
MCSYM-DB/3_3/AAAUCU/
MCSYM-DB/3_3/AAAUCU/3_3-AAAUCU.mcs
MCSYM-DB/3_3/AAAUCU/ds-3_3-AAAUCU_x.pdb.gz
MCSYM-DB/3_3/AAAUGA/
MCSYM-DB/3_3/AAAUGA/3_3-AAAUGA.mcs
MCSYM-DB/3_3/AAAUGG/
MCSYM-DB/3_3/AAAUGG/3_3-AAAUGG.mcs
MCSYM-DB/3_3/AAAUGU/
MCSYM-DB/3_3/AAAUGU/3_3-AAAUGU.mcs
MCSYM-DB/3_3/AAAUGU/ds-3_3-AAAUGU_x.pdb.gz
MCSYM-DB/3_3/AAAUUA/
MCSYM-DB/3_3/AAAUUA/3_3-AAAUUA.mcs
MCSYM-DB/3_3/AAAUUC/
MCSYM-DB/3_3/AAAUUC/3_3-AAAUUC.mcs
MCSYM-DB/3_3/AAAUUG/
MCSYM-DB/3_3/AAAUUG/3_3-AAAUUG.mcs
MCSYM-DB/3_3/AAAUUU/
MCSYM-DB/3_3/AAAUUU/3_3-AAAUUU.mcs
MCSYM-DB/3_3/AACACG/
MCSYM-DB/3_3/AACACG/3_3-AACACG.mcs
MCSYM-DB/3_3/AACACG/ds-3_3-AACACG_x.pdb.gz
MCSYM-DB/3_3/AACAUU/
MCSYM-DB/3_3/AACAUU/3_3-AACAUU.mcs
MCSYM-DB/3_3/AACCAG/
MCSYM-DB/3_3/AACCAG/3_3-AACCAG.mcs
MCSYM-DB/3_3/AACCAU/
MCSYM-DB/3_3/AACCAU/3_3-AACCAU.mcs
MCSYM-DB/3_3/AACCAU/ds-3_3-AACCAU_x.pdb.gz
MCSYM-DB/3_3/AACGAA/
MCSYM-DB/3_3/AACGAA/3_3-AACGAA.mcs
MCSYM-DB/3_3/AACGAC/
MCSYM-DB/3_3/AACGAC/3_3-AACGAC.mcs
MCSYM-DB/3_3/AACGAG/
MCSYM-DB/3_3/AACGAG/3_3-AACGAG.mcs
MCSYM-DB/3_3/AACGAG/ds-3_3-AACGAG_x.pdb.gz
MCSYM-DB/3_3/AACGAU/
MCSYM-DB/3_3/AACGAU/3_3-AACGAU.mcs
MCSYM-DB/3_3/AACGAU/ds-3_3-AACGAU_x.pdb.gz
MCSYM-DB/3_3/AACGCA/
MCSYM-DB/3_3/AACGCA/3_3-AACGCA.mcs
MCSYM-DB/3_3/AACGCA/ds-3_3-AACGCA_x.pdb.gz
MCSYM-DB/3_3/AACGCG/
MCSYM-DB/3_3/AACGCG/3_3-AACGCG.mcs
MCSYM-DB/3_3/AACGCU/
MCSYM-DB/3_3/AACGCU/3_3-AACGCU.mcs
MCSYM-DB/3_3/AACGCU/ds-3_3-AACGCU_x.pdb.gz
MCSYM-DB/3_3/AACGGC/
MCSYM-DB/3_3/AACGGC/3_3-AACGGC.mcs
MCSYM-DB/3_3/AACGGG/
MCSYM-DB/3_3/AACGGG/3_3-AACGGG.mcs
MCSYM-DB/3_3/AACGGG/ds-3_3-AACGGG_x.pdb.gz
MCSYM-DB/3_3/AACGGU/
MCSYM-DB/3_3/AACGGU/3_3-AACGGU.mcs
MCSYM-DB/3_3/AACGUA/
MCSYM-DB/3_3/AACGUA/3_3-AACGUA.mcs
MCSYM-DB/3_3/AACGUC/
MCSYM-DB/3_3/AACGUC/3_3-AACGUC.mcs
MCSYM-DB/3_3/AACGUG/
MCSYM-DB/3_3/AACGUG/3_3-AACGUG.mcs
MCSYM-DB/3_3/AACGUU/
MCSYM-DB/3_3/AACGUU/3_3-AACGUU.mcs
MCSYM-DB/3_3/AACGUU/ds-3_3-AACGUU_x.pdb.gz
MCSYM-DB/3_3/AACUUU/
MCSYM-DB/3_3/AACUUU/3_3-AACUUU.mcs
MCSYM-DB/3_3/AAGAAG/
MCSYM-DB/3_3/AAGAAG/3_3-AAGAAG.mcs
MCSYM-DB/3_3/AAGAAG/ds-3_3-AAGAAG_x.pdb.gz
MCSYM-DB/3_3/AAGAAU/
MCSYM-DB/3_3/AAGAAU/3_3-AAGAAU.mcs
MCSYM-DB/3_3/AAGACA/
MCSYM-DB/3_3/AAGACA/3_3-AAGACA.mcs
MCSYM-DB/3_3/AAGACU/
MCSYM-DB/3_3/AAGACU/3_3-AAGACU.mcs
MCSYM-DB/3_3/AAGAUG/
MCSYM-DB/3_3/AAGAUG/3_3-AAGAUG.mcs
MCSYM-DB/3_3/AAGAUU/
MCSYM-DB/3_3/AAGAUU/3_3-AAGAUU.mcs
MCSYM-DB/3_3/AAGCAA/
MCSYM-DB/3_3/AAGCAA/3_3-AAGCAA.mcs
MCSYM-DB/3_3/AAGCAA/ds-3_3-AAGCAA_x.pdb.gz
MCSYM-DB/3_3/AAGCAG/
MCSYM-DB/3_3/AAGCAG/3_3-AAGCAG.mcs
MCSYM-DB/3_3/AAGCAG/ds-3_3-AAGCAG_x.pdb.gz
MCSYM-DB/3_3/AAGCAU/
MCSYM-DB/3_3/AAGCAU/3_3-AAGCAU.mcs
MCSYM-DB/3_3/AAGCAU/ds-3_3-AAGCAU_x.pdb.gz
MCSYM-DB/3_3/AAGCCC/
MCSYM-DB/3_3/AAGCCC/3_3-AAGCCC.mcs
MCSYM-DB/3_3/AAGCCU/
MCSYM-DB/3_3/AAGCCU/3_3-AAGCCU.mcs
MCSYM-DB/3_3/AAGCCU/ds-3_3-AAGCCU_x.pdb.gz
MCSYM-DB/3_3/AAGCGA/
MCSYM-DB/3_3/AAGCGA/3_3-AAGCGA.mcs
MCSYM-DB/3_3/AAGCGU/
MCSYM-DB/3_3/AAGCGU/3_3-AAGCGU.mcs
MCSYM-DB/3_3/AAGCGU/ds-3_3-AAGCGU_x.pdb.gz
MCSYM-DB/3_3/AAGCUA/
MCSYM-DB/3_3/AAGCUA/3_3-AAGCUA.mcs
MCSYM-DB/3_3/AAGCUC/
MCSYM-DB/3_3/AAGCUC/3_3-AAGCUC.mcs
MCSYM-DB/3_3/AAGCUG/
MCSYM-DB/3_3/AAGCUG/3_3-AAGCUG.mcs
MCSYM-DB/3_3/AAGCUU/
MCSYM-DB/3_3/AAGCUU/3_3-AAGCUU.mcs
MCSYM-DB/3_3/AAGCUU/ds-3_3-AAGCUU_x.pdb.gz
MCSYM-DB/3_3/AAGGUG/
MCSYM-DB/3_3/AAGGUG/3_3-AAGGUG.mcs
MCSYM-DB/3_3/AAGGUU/
MCSYM-DB/3_3/AAGGUU/3_3-AAGGUU.mcs
MCSYM-DB/3_3/AAGUAG/
MCSYM-DB/3_3/AAGUAG/3_3-AAGUAG.mcs
MCSYM-DB/3_3/AAGUAU/
MCSYM-DB/3_3/AAGUAU/3_3-AAGUAU.mcs
MCSYM-DB/3_3/AAGUAU/ds-3_3-AAGUAU_x.pdb.gz
MCSYM-DB/3_3/AAGUCG/
MCSYM-DB/3_3/AAGUCG/3_3-AAGUCG.mcs
MCSYM-DB/3_3/AAGUCU/
MCSYM-DB/3_3/AAGUCU/3_3-AAGUCU.mcs
MCSYM-DB/3_3/AAGUCU/ds-3_3-AAGUCU_x.pdb.gz
MCSYM-DB/3_3/AAGUGU/
MCSYM-DB/3_3/AAGUGU/3_3-AAGUGU.mcs
MCSYM-DB/3_3/AAGUGU/ds-3_3-AAGUGU_x.pdb.gz
MCSYM-DB/3_3/AAGUUA/
MCSYM-DB/3_3/AAGUUA/3_3-AAGUUA.mcs
MCSYM-DB/3_3/AAGUUA/ds-3_3-AAGUUA_x.pdb.gz
MCSYM-DB/3_3/AAGUUC/
MCSYM-DB/3_3/AAGUUC/3_3-AAGUUC.mcs
MCSYM-DB/3_3/AAGUUG/
MCSYM-DB/3_3/AAGUUG/3_3-AAGUUG.mcs
MCSYM-DB/3_3/AAGUUU/
MCSYM-DB/3_3/AAGUUU/3_3-AAGUUU.mcs
MCSYM-DB/3_3/AAUAAA/
MCSYM-DB/3_3/AAUAAA/3_3-AAUAAA.mcs
MCSYM-DB/3_3/AAUAAA/ds-3_3-AAUAAA_x.pdb.gz
MCSYM-DB/3_3/AAUAAG/
MCSYM-DB/3_3/AAUAAG/3_3-AAUAAG.mcs
MCSYM-DB/3_3/AAUAAG/ds-3_3-AAUAAG_x.pdb.gz
MCSYM-DB/3_3/AAUAAU/
MCSYM-DB/3_3/AAUAAU/3_3-AAUAAU.mcs
MCSYM-DB/3_3/AAUAAU/ds-3_3-AAUAAU_x.pdb.gz
MCSYM-DB/3_3/AAUACA/
MCSYM-DB/3_3/AAUACA/3_3-AAUACA.mcs
MCSYM-DB/3_3/AAUACC/
MCSYM-DB/3_3/AAUACC/3_3-AAUACC.mcs
MCSYM-DB/3_3/AAUACU/
MCSYM-DB/3_3/AAUACU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/AAUACU/1Z7F_model_1.pdb.gz
MCSYM-DB/3_3/AAUACU/3_3-AAUACU.mcs
MCSYM-DB/3_3/AAUACU/405D_model_1.pdb.gz
MCSYM-DB/3_3/AAUACU/ds-3_3-AAUACU_x.pdb.gz
MCSYM-DB/3_3/AAUAGC/
MCSYM-DB/3_3/AAUAGC/3_3-AAUAGC.mcs
MCSYM-DB/3_3/AAUAGG/
MCSYM-DB/3_3/AAUAGG/3_3-AAUAGG.mcs
MCSYM-DB/3_3/AAUAGU/
MCSYM-DB/3_3/AAUAGU/3_3-AAUAGU.mcs
MCSYM-DB/3_3/AAUAGU/ds-3_3-AAUAGU_x.pdb.gz
MCSYM-DB/3_3/AAUAUA/
MCSYM-DB/3_3/AAUAUA/3_3-AAUAUA.mcs
MCSYM-DB/3_3/AAUAUC/
MCSYM-DB/3_3/AAUAUC/3_3-AAUAUC.mcs
MCSYM-DB/3_3/AAUAUG/
MCSYM-DB/3_3/AAUAUG/3_3-AAUAUG.mcs
MCSYM-DB/3_3/AAUAUU/
MCSYM-DB/3_3/AAUAUU/3_3-AAUAUU.mcs
MCSYM-DB/3_3/AAUCAU/
MCSYM-DB/3_3/AAUCAU/3_3-AAUCAU.mcs
MCSYM-DB/3_3/AAUCCU/
MCSYM-DB/3_3/AAUCCU/3_3-AAUCCU.mcs
MCSYM-DB/3_3/AAUCUA/
MCSYM-DB/3_3/AAUCUA/3_3-AAUCUA.mcs
MCSYM-DB/3_3/AAUCUU/
MCSYM-DB/3_3/AAUCUU/3_3-AAUCUU.mcs
MCSYM-DB/3_3/AAUGAG/
MCSYM-DB/3_3/AAUGAG/3_3-AAUGAG.mcs
MCSYM-DB/3_3/AAUGAU/
MCSYM-DB/3_3/AAUGAU/3_3-AAUGAU.mcs
MCSYM-DB/3_3/AAUGAU/ds-3_3-AAUGAU_x.pdb.gz
MCSYM-DB/3_3/AAUGCA/
MCSYM-DB/3_3/AAUGCA/3_3-AAUGCA.mcs
MCSYM-DB/3_3/AAUGCU/
MCSYM-DB/3_3/AAUGCU/3_3-AAUGCU.mcs
MCSYM-DB/3_3/AAUGCU/ds-3_3-AAUGCU_x.pdb.gz
MCSYM-DB/3_3/AAUGGA/
MCSYM-DB/3_3/AAUGGA/3_3-AAUGGA.mcs
MCSYM-DB/3_3/AAUGGG/
MCSYM-DB/3_3/AAUGGG/3_3-AAUGGG.mcs
MCSYM-DB/3_3/AAUGGU/
MCSYM-DB/3_3/AAUGGU/3_3-AAUGGU.mcs
MCSYM-DB/3_3/AAUGUC/
MCSYM-DB/3_3/AAUGUC/3_3-AAUGUC.mcs
MCSYM-DB/3_3/AAUGUG/
MCSYM-DB/3_3/AAUGUG/3_3-AAUGUG.mcs
MCSYM-DB/3_3/AAUGUU/
MCSYM-DB/3_3/AAUGUU/3_3-AAUGUU.mcs
MCSYM-DB/3_3/AAUUAU/
MCSYM-DB/3_3/AAUUAU/3_3-AAUUAU.mcs
MCSYM-DB/3_3/AAUUCG/
MCSYM-DB/3_3/AAUUCG/3_3-AAUUCG.mcs
MCSYM-DB/3_3/AAUUCG/ds-3_3-AAUUCG_x.pdb.gz
MCSYM-DB/3_3/AAUUCU/
MCSYM-DB/3_3/AAUUCU/3_3-AAUUCU.mcs
MCSYM-DB/3_3/AAUUGG/
MCSYM-DB/3_3/AAUUGG/3_3-AAUUGG.mcs
MCSYM-DB/3_3/AAUUGU/
MCSYM-DB/3_3/AAUUGU/3_3-AAUUGU.mcs
MCSYM-DB/3_3/AAUUUU/
MCSYM-DB/3_3/AAUUUU/3_3-AAUUUU.mcs
MCSYM-DB/3_3/ACAAAU/
MCSYM-DB/3_3/ACAAAU/3_3-ACAAAU.mcs
MCSYM-DB/3_3/ACAACC/
MCSYM-DB/3_3/ACAACC/3_3-ACAACC.mcs
MCSYM-DB/3_3/ACAACC/ds-3_3-ACAACC_x.pdb.gz
MCSYM-DB/3_3/ACAAUU/
MCSYM-DB/3_3/ACAAUU/3_3-ACAAUU.mcs
MCSYM-DB/3_3/ACACAC/
MCSYM-DB/3_3/ACACAC/3_3-ACACAC.mcs
MCSYM-DB/3_3/ACACAG/
MCSYM-DB/3_3/ACACAG/3_3-ACACAG.mcs
MCSYM-DB/3_3/ACACAU/
MCSYM-DB/3_3/ACACAU/3_3-ACACAU.mcs
MCSYM-DB/3_3/ACACAU/ds-3_3-ACACAU_x.pdb.gz
MCSYM-DB/3_3/ACACCU/
MCSYM-DB/3_3/ACACCU/3_3-ACACCU.mcs
MCSYM-DB/3_3/ACAGCU/
MCSYM-DB/3_3/ACAGCU/3_3-ACAGCU.mcs
MCSYM-DB/3_3/ACAGGG/
MCSYM-DB/3_3/ACAGGG/3_3-ACAGGG.mcs
MCSYM-DB/3_3/ACAGGU/
MCSYM-DB/3_3/ACAGGU/3_3-ACAGGU.mcs
MCSYM-DB/3_3/ACAGUU/
MCSYM-DB/3_3/ACAGUU/3_3-ACAGUU.mcs
MCSYM-DB/3_3/ACAUAA/
MCSYM-DB/3_3/ACAUAA/3_3-ACAUAA.mcs
MCSYM-DB/3_3/ACAUAC/
MCSYM-DB/3_3/ACAUAC/3_3-ACAUAC.mcs
MCSYM-DB/3_3/ACAUAC/ds-3_3-ACAUAC_x.pdb.gz
MCSYM-DB/3_3/ACAUAU/
MCSYM-DB/3_3/ACAUAU/3_3-ACAUAU.mcs
MCSYM-DB/3_3/ACAUAU/ds-3_3-ACAUAU_x.pdb.gz
MCSYM-DB/3_3/ACAUCU/
MCSYM-DB/3_3/ACAUCU/3_3-ACAUCU.mcs
MCSYM-DB/3_3/ACAUCU/ds-3_3-ACAUCU_x.pdb.gz
MCSYM-DB/3_3/ACAUGC/
MCSYM-DB/3_3/ACAUGC/3_3-ACAUGC.mcs
MCSYM-DB/3_3/ACAUGG/
MCSYM-DB/3_3/ACAUGG/3_3-ACAUGG.mcs
MCSYM-DB/3_3/ACAUGU/
MCSYM-DB/3_3/ACAUGU/3_3-ACAUGU.mcs
MCSYM-DB/3_3/ACAUGU/ds-3_3-ACAUGU_x.pdb.gz
MCSYM-DB/3_3/ACAUUC/
MCSYM-DB/3_3/ACAUUC/3_3-ACAUUC.mcs
MCSYM-DB/3_3/ACAUUG/
MCSYM-DB/3_3/ACAUUG/3_3-ACAUUG.mcs
MCSYM-DB/3_3/ACAUUU/
MCSYM-DB/3_3/ACAUUU/3_3-ACAUUU.mcs
MCSYM-DB/3_3/ACAUUU/ds-3_3-ACAUUU_x.pdb.gz
MCSYM-DB/3_3/ACCAAG/
MCSYM-DB/3_3/ACCAAG/3_3-ACCAAG.mcs
MCSYM-DB/3_3/ACCAAU/
MCSYM-DB/3_3/ACCAAU/3_3-ACCAAU.mcs
MCSYM-DB/3_3/ACCACU/
MCSYM-DB/3_3/ACCACU/3_3-ACCACU.mcs
MCSYM-DB/3_3/ACCAUU/
MCSYM-DB/3_3/ACCAUU/3_3-ACCAUU.mcs
MCSYM-DB/3_3/ACCCAU/
MCSYM-DB/3_3/ACCCAU/3_3-ACCCAU.mcs
MCSYM-DB/3_3/ACCCCU/
MCSYM-DB/3_3/ACCCCU/3_3-ACCCCU.mcs
MCSYM-DB/3_3/ACCCGU/
MCSYM-DB/3_3/ACCCGU/3_3-ACCCGU.mcs
MCSYM-DB/3_3/ACCCUC/
MCSYM-DB/3_3/ACCCUC/3_3-ACCCUC.mcs
MCSYM-DB/3_3/ACCCUG/
MCSYM-DB/3_3/ACCCUG/3_3-ACCCUG.mcs
MCSYM-DB/3_3/ACCCUU/
MCSYM-DB/3_3/ACCCUU/3_3-ACCCUU.mcs
MCSYM-DB/3_3/ACCGAC/
MCSYM-DB/3_3/ACCGAC/3_3-ACCGAC.mcs
MCSYM-DB/3_3/ACCGAC/ds-3_3-ACCGAC_x.pdb.gz
MCSYM-DB/3_3/ACCGAU/
MCSYM-DB/3_3/ACCGAU/3_3-ACCGAU.mcs
MCSYM-DB/3_3/ACCGAU/ds-3_3-ACCGAU_x.pdb.gz
MCSYM-DB/3_3/ACCGCU/
MCSYM-DB/3_3/ACCGCU/3_3-ACCGCU.mcs
MCSYM-DB/3_3/ACCGCU/ds-3_3-ACCGCU_x.pdb.gz
MCSYM-DB/3_3/ACCGGC/
MCSYM-DB/3_3/ACCGGC/3_3-ACCGGC.mcs
MCSYM-DB/3_3/ACCGGG/
MCSYM-DB/3_3/ACCGGG/3_3-ACCGGG.mcs
MCSYM-DB/3_3/ACCGGG/ds-3_3-ACCGGG_x.pdb.gz
MCSYM-DB/3_3/ACCGGU/
MCSYM-DB/3_3/ACCGGU/3_3-ACCGGU.mcs
MCSYM-DB/3_3/ACCGUC/
MCSYM-DB/3_3/ACCGUC/3_3-ACCGUC.mcs
MCSYM-DB/3_3/ACCGUG/
MCSYM-DB/3_3/ACCGUG/3_3-ACCGUG.mcs
MCSYM-DB/3_3/ACCGUU/
MCSYM-DB/3_3/ACCGUU/3_3-ACCGUU.mcs
MCSYM-DB/3_3/ACCGUU/ds-3_3-ACCGUU_x.pdb.gz
MCSYM-DB/3_3/ACCUAU/
MCSYM-DB/3_3/ACCUAU/3_3-ACCUAU.mcs
MCSYM-DB/3_3/ACCUCU/
MCSYM-DB/3_3/ACCUCU/3_3-ACCUCU.mcs
MCSYM-DB/3_3/ACCUUU/
MCSYM-DB/3_3/ACCUUU/3_3-ACCUUU.mcs
MCSYM-DB/3_3/ACGCAA/
MCSYM-DB/3_3/ACGCAA/3_3-ACGCAA.mcs
MCSYM-DB/3_3/ACGCAC/
MCSYM-DB/3_3/ACGCAC/3_3-ACGCAC.mcs
MCSYM-DB/3_3/ACGCAU/
MCSYM-DB/3_3/ACGCAU/1JZC_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1AFX_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K2G_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1AJF_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1JZV_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1AJT_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K4A_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ATO_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K4B_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ATV_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K5I_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1AUD_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KUQ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1B23_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KXK_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1B36_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1L1W_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1BJ2_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1L8V_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1BN0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1L9A_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1BYJ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1LDZ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1C4L_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1LMV_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1CK5_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1LPW_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1CSL_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1M5K_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1CX0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ME1_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1D4R_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1MFJ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1D6K_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1MFK_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1DDY_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1MJI_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1DQF_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1MT4_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1DZ5_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1MZP_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1E4P_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1N66_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EBR_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1N77_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EHZ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1N8X_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EKZ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NC0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ESH_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NEM_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ET4_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NTA_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EUY_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NUJ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EXD_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NYB_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1EXY_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1NZ1_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1F27_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1OOA_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1F5U_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1OW9_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1F6U_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1P5M_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1F6X_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1P5O_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1F6Z_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Q29_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1FG0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Q93_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1FMN_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Q96_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1FYO_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1QC0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1G1X_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1QC8_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1G70_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1QU2_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1H3E_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1QWB_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1H4S_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1R2P_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1I46_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1R3E_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1I4B_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1R7W_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1I6U_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1R7Z_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1I9V_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1RFR_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1I9X_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ROQ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1IK1_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1RPU_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1IVS_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1S03_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1J1U_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K6H_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1SDR_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1K8S_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1SJ3_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KIS_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1SLP_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KOD_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1SYZ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KOS_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1T0D_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1KPY_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/ds-3_3-ACGCAU_x.pdb.gz
MCSYM-DB/3_3/ACGCAU/1T0E_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1T28_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1T4L_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1TLR_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1TOB_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1TTT_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1TXS_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U0B_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U2A_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U3K_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U6P_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U8D_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1U9S_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ULL_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1UUU_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1VOP_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1WSU_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1WTS_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XHP_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XJR_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XP7_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XPF_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XSG_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1XSH_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Y27_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Y3O_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YG3_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YMO_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YN1_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YSV_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YTU_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1YVP_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Z30_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1Z31_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZCI_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZDK_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZE2_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZFV_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZJW_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZL3_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZX7_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/1ZZ5_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/205D_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2AB4_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2ADT_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2AU4_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2BE0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2BGG_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2BH2_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/2BS0_model_1.pdb.gz
MCSYM-DB/3_3/ACGCAU/3_3-ACGCAU.mcs
MCSYM-DB/3_3/ACGCCG/
MCSYM-DB/3_3/ACGCCG/3_3-ACGCCG.mcs
MCSYM-DB/3_3/ACGCCU/
MCSYM-DB/3_3/ACGCCU/3_3-ACGCCU.mcs
MCSYM-DB/3_3/ACGCCU/ds-3_3-ACGCCU_x.pdb.gz
MCSYM-DB/3_3/ACGCGU/
MCSYM-DB/3_3/ACGCGU/3_3-ACGCGU.mcs
MCSYM-DB/3_3/ACGCUG/
MCSYM-DB/3_3/ACGCUG/3_3-ACGCUG.mcs
MCSYM-DB/3_3/ACGCUU/
MCSYM-DB/3_3/ACGCUU/3_3-ACGCUU.mcs
MCSYM-DB/3_3/ACGCUU/ds-3_3-ACGCUU_x.pdb.gz
MCSYM-DB/3_3/ACGUAU/
MCSYM-DB/3_3/ACGUAU/3_3-ACGUAU.mcs
MCSYM-DB/3_3/ACGUCU/
MCSYM-DB/3_3/ACGUCU/3_3-ACGUCU.mcs
MCSYM-DB/3_3/ACGUGU/
MCSYM-DB/3_3/ACGUGU/3_3-ACGUGU.mcs
MCSYM-DB/3_3/ACGUUU/
MCSYM-DB/3_3/ACGUUU/3_3-ACGUUU.mcs
MCSYM-DB/3_3/ACGUUU/ds-3_3-ACGUUU_x.pdb.gz
MCSYM-DB/3_3/ACUAAA/
MCSYM-DB/3_3/ACUAAA/3_3-ACUAAA.mcs
MCSYM-DB/3_3/ACUAAG/
MCSYM-DB/3_3/ACUAAG/3_3-ACUAAG.mcs
MCSYM-DB/3_3/ACUAAU/
MCSYM-DB/3_3/ACUAAU/3_3-ACUAAU.mcs
MCSYM-DB/3_3/ACUAAU/ds-3_3-ACUAAU_x.pdb.gz
MCSYM-DB/3_3/ACUACA/
MCSYM-DB/3_3/ACUACA/3_3-ACUACA.mcs
MCSYM-DB/3_3/ACUACA/ds-3_3-ACUACA_x.pdb.gz
MCSYM-DB/3_3/ACUACC/
MCSYM-DB/3_3/ACUACC/3_3-ACUACC.mcs
MCSYM-DB/3_3/ACUACU/
MCSYM-DB/3_3/ACUACU/3_3-ACUACU.mcs
MCSYM-DB/3_3/ACUACU/ds-3_3-ACUACU_x.pdb.gz
MCSYM-DB/3_3/ACUAGA/
MCSYM-DB/3_3/ACUAGA/3_3-ACUAGA.mcs
MCSYM-DB/3_3/ACUAGC/
MCSYM-DB/3_3/ACUAGC/3_3-ACUAGC.mcs
MCSYM-DB/3_3/ACUAGG/
MCSYM-DB/3_3/ACUAGG/3_3-ACUAGG.mcs
MCSYM-DB/3_3/ACUAGU/
MCSYM-DB/3_3/ACUAGU/3_3-ACUAGU.mcs
MCSYM-DB/3_3/ACUAUG/
MCSYM-DB/3_3/ACUAUG/3_3-ACUAUG.mcs
MCSYM-DB/3_3/ACUAUG/ds-3_3-ACUAUG_x.pdb.gz
MCSYM-DB/3_3/ACUAUU/
MCSYM-DB/3_3/ACUAUU/3_3-ACUAUU.mcs
MCSYM-DB/3_3/ACUAUU/ds-3_3-ACUAUU_x.pdb.gz
MCSYM-DB/3_3/ACUCAC/
MCSYM-DB/3_3/ACUCAC/3_3-ACUCAC.mcs
MCSYM-DB/3_3/ACUCAU/
MCSYM-DB/3_3/ACUCAU/3_3-ACUCAU.mcs
MCSYM-DB/3_3/ACUCCU/
MCSYM-DB/3_3/ACUCCU/3_3-ACUCCU.mcs
MCSYM-DB/3_3/ACUCGU/
MCSYM-DB/3_3/ACUCGU/3_3-ACUCGU.mcs
MCSYM-DB/3_3/ACUCUU/
MCSYM-DB/3_3/ACUCUU/3_3-ACUCUU.mcs
MCSYM-DB/3_3/ACUCUU/ds-3_3-ACUCUU_x.pdb.gz
MCSYM-DB/3_3/ACUGAC/
MCSYM-DB/3_3/ACUGAC/3_3-ACUGAC.mcs
MCSYM-DB/3_3/ACUGAU/
MCSYM-DB/3_3/ACUGAU/3_3-ACUGAU.mcs
MCSYM-DB/3_3/ACUGAU/ds-3_3-ACUGAU_x.pdb.gz
MCSYM-DB/3_3/ACUGCU/
MCSYM-DB/3_3/ACUGCU/3_3-ACUGCU.mcs
MCSYM-DB/3_3/ACUGGU/
MCSYM-DB/3_3/ACUGGU/3_3-ACUGGU.mcs
MCSYM-DB/3_3/ACUGUU/
MCSYM-DB/3_3/ACUGUU/3_3-ACUGUU.mcs
MCSYM-DB/3_3/ACUUAU/
MCSYM-DB/3_3/ACUUAU/3_3-ACUUAU.mcs
MCSYM-DB/3_3/ACUUCU/
MCSYM-DB/3_3/ACUUCU/3_3-ACUUCU.mcs
MCSYM-DB/3_3/ACUUGU/
MCSYM-DB/3_3/ACUUGU/3_3-ACUUGU.mcs
MCSYM-DB/3_3/ACUUUU/
MCSYM-DB/3_3/ACUUUU/3_3-ACUUUU.mcs
MCSYM-DB/3_3/AGAAAA/
MCSYM-DB/3_3/AGAAAA/3_3-AGAAAA.mcs
MCSYM-DB/3_3/AGAAAA/ds-3_3-AGAAAA_x.pdb.gz
MCSYM-DB/3_3/AGAAAU/
MCSYM-DB/3_3/AGAAAU/3_3-AGAAAU.mcs
MCSYM-DB/3_3/AGAAAU/ds-3_3-AGAAAU_x.pdb.gz
MCSYM-DB/3_3/AGAACU/
MCSYM-DB/3_3/AGAACU/3_3-AGAACU.mcs
MCSYM-DB/3_3/AGAAGU/
MCSYM-DB/3_3/AGAAGU/3_3-AGAAGU.mcs
MCSYM-DB/3_3/AGAAUG/
MCSYM-DB/3_3/AGAAUG/3_3-AGAAUG.mcs
MCSYM-DB/3_3/AGACCU/
MCSYM-DB/3_3/AGACCU/3_3-AGACCU.mcs
MCSYM-DB/3_3/AGAGAG/
MCSYM-DB/3_3/AGAGAG/3_3-AGAGAG.mcs
MCSYM-DB/3_3/AGAGAG/ds-3_3-AGAGAG_x.pdb.gz
MCSYM-DB/3_3/AGAGAU/
MCSYM-DB/3_3/AGAGAU/3_3-AGAGAU.mcs
MCSYM-DB/3_3/AGAGCU/
MCSYM-DB/3_3/AGAGCU/3_3-AGAGCU.mcs
MCSYM-DB/3_3/AGAGGU/
MCSYM-DB/3_3/AGAGGU/3_3-AGAGGU.mcs
MCSYM-DB/3_3/AGAGGU/ds-3_3-AGAGGU_x.pdb.gz
MCSYM-DB/3_3/AGAUAC/
MCSYM-DB/3_3/AGAUAC/3_3-AGAUAC.mcs
MCSYM-DB/3_3/AGAUAG/
MCSYM-DB/3_3/AGAUAG/3_3-AGAUAG.mcs
MCSYM-DB/3_3/AGAUAU/
MCSYM-DB/3_3/AGAUAU/3_3-AGAUAU.mcs
MCSYM-DB/3_3/AGAUAU/ds-3_3-AGAUAU_x.pdb.gz
MCSYM-DB/3_3/AGAUCC/
MCSYM-DB/3_3/AGAUCC/3_3-AGAUCC.mcs
MCSYM-DB/3_3/AGAUCU/
MCSYM-DB/3_3/AGAUCU/3_3-AGAUCU.mcs
MCSYM-DB/3_3/AGAUGC/
MCSYM-DB/3_3/AGAUGC/3_3-AGAUGC.mcs
MCSYM-DB/3_3/AGAUGU/
MCSYM-DB/3_3/AGAUGU/3_3-AGAUGU.mcs
MCSYM-DB/3_3/AGAUGU/ds-3_3-AGAUGU_x.pdb.gz
MCSYM-DB/3_3/AGAUUC/
MCSYM-DB/3_3/AGAUUC/3_3-AGAUUC.mcs
MCSYM-DB/3_3/AGAUUU/
MCSYM-DB/3_3/AGAUUU/3_3-AGAUUU.mcs
MCSYM-DB/3_3/AGAUUU/ds-3_3-AGAUUU_x.pdb.gz
MCSYM-DB/3_3/AGCCCU/
MCSYM-DB/3_3/AGCCCU/3_3-AGCCCU.mcs
MCSYM-DB/3_3/AGCCUG/
MCSYM-DB/3_3/AGCCUG/3_3-AGCCUG.mcs
MCSYM-DB/3_3/AGCGAA/
MCSYM-DB/3_3/AGCGAA/3_3-AGCGAA.mcs
MCSYM-DB/3_3/AGCGAC/
MCSYM-DB/3_3/AGCGAC/3_3-AGCGAC.mcs
MCSYM-DB/3_3/AGCGAG/
MCSYM-DB/3_3/AGCGAG/3_3-AGCGAG.mcs
MCSYM-DB/3_3/AGCGAU/
MCSYM-DB/3_3/AGCGAU/3_3-AGCGAU.mcs
MCSYM-DB/3_3/AGCGCA/
MCSYM-DB/3_3/AGCGCA/3_3-AGCGCA.mcs
MCSYM-DB/3_3/AGCGCC/
MCSYM-DB/3_3/AGCGCC/3_3-AGCGCC.mcs
MCSYM-DB/3_3/AGCGCG/
MCSYM-DB/3_3/AGCGCG/3_3-AGCGCG.mcs
MCSYM-DB/3_3/AGCGCU/
MCSYM-DB/3_3/AGCGCU/3_3-AGCGCU.mcs
MCSYM-DB/3_3/AGCGGA/
MCSYM-DB/3_3/AGCGGA/3_3-AGCGGA.mcs
MCSYM-DB/3_3/AGCGGA/ds-3_3-AGCGGA_x.pdb.gz
MCSYM-DB/3_3/AGCGGG/
MCSYM-DB/3_3/AGCGGG/3_3-AGCGGG.mcs
MCSYM-DB/3_3/AGCGGU/
MCSYM-DB/3_3/AGCGGU/3_3-AGCGGU.mcs
MCSYM-DB/3_3/AGCGGU/ds-3_3-AGCGGU_x.pdb.gz
MCSYM-DB/3_3/AGCGUG/
MCSYM-DB/3_3/AGCGUG/3_3-AGCGUG.mcs
MCSYM-DB/3_3/AGCGUU/
MCSYM-DB/3_3/AGCGUU/3_3-AGCGUU.mcs
MCSYM-DB/3_3/AGCGUU/ds-3_3-AGCGUU_x.pdb.gz
MCSYM-DB/3_3/AGCUCU/
MCSYM-DB/3_3/AGCUCU/3_3-AGCUCU.mcs
MCSYM-DB/3_3/AGCUUU/
MCSYM-DB/3_3/AGCUUU/3_3-AGCUUU.mcs
MCSYM-DB/3_3/AGGAAU/
MCSYM-DB/3_3/AGGAAU/3_3-AGGAAU.mcs
MCSYM-DB/3_3/AGGACA/
MCSYM-DB/3_3/AGGACA/3_3-AGGACA.mcs
MCSYM-DB/3_3/AGGACC/
MCSYM-DB/3_3/AGGACC/3_3-AGGACC.mcs
MCSYM-DB/3_3/AGGACU/
MCSYM-DB/3_3/AGGACU/3_3-AGGACU.mcs
MCSYM-DB/3_3/AGGAGG/
MCSYM-DB/3_3/AGGAGG/3_3-AGGAGG.mcs
MCSYM-DB/3_3/AGGAGU/
MCSYM-DB/3_3/AGGAGU/3_3-AGGAGU.mcs
MCSYM-DB/3_3/AGGAUU/
MCSYM-DB/3_3/AGGAUU/3_3-AGGAUU.mcs
MCSYM-DB/3_3/AGGCAC/
MCSYM-DB/3_3/AGGCAC/3_3-AGGCAC.mcs
MCSYM-DB/3_3/AGGCAG/
MCSYM-DB/3_3/AGGCAG/3_3-AGGCAG.mcs
MCSYM-DB/3_3/AGGCAU/
MCSYM-DB/3_3/AGGCAU/3_3-AGGCAU.mcs
MCSYM-DB/3_3/AGGCAU/ds-3_3-AGGCAU_x.pdb.gz
MCSYM-DB/3_3/AGGCCA/
MCSYM-DB/3_3/AGGCCA/3_3-AGGCCA.mcs
MCSYM-DB/3_3/AGGCCC/
MCSYM-DB/3_3/AGGCCC/3_3-AGGCCC.mcs
MCSYM-DB/3_3/AGGCCG/
MCSYM-DB/3_3/AGGCCG/3_3-AGGCCG.mcs
MCSYM-DB/3_3/AGGCCU/
MCSYM-DB/3_3/AGGCCU/3_3-AGGCCU.mcs
MCSYM-DB/3_3/AGGCGA/
MCSYM-DB/3_3/AGGCGA/3_3-AGGCGA.mcs
MCSYM-DB/3_3/AGGCGC/
MCSYM-DB/3_3/AGGCGC/3_3-AGGCGC.mcs
MCSYM-DB/3_3/AGGCGG/
MCSYM-DB/3_3/AGGCGG/3_3-AGGCGG.mcs
MCSYM-DB/3_3/AGGCGU/
MCSYM-DB/3_3/AGGCGU/3_3-AGGCGU.mcs
MCSYM-DB/3_3/AGGCGU/ds-3_3-AGGCGU_x.pdb.gz
MCSYM-DB/3_3/AGGCUA/
MCSYM-DB/3_3/AGGCUA/3_3-AGGCUA.mcs
MCSYM-DB/3_3/AGGCUG/
MCSYM-DB/3_3/AGGCUG/3_3-AGGCUG.mcs
MCSYM-DB/3_3/AGGCUU/
MCSYM-DB/3_3/AGGCUU/3_3-AGGCUU.mcs
MCSYM-DB/3_3/AGGGCU/
MCSYM-DB/3_3/AGGGCU/3_3-AGGGCU.mcs
MCSYM-DB/3_3/AGGGGU/
MCSYM-DB/3_3/AGGGGU/3_3-AGGGGU.mcs
MCSYM-DB/3_3/AGGUAU/
MCSYM-DB/3_3/AGGUAU/3_3-AGGUAU.mcs
MCSYM-DB/3_3/AGGUCU/
MCSYM-DB/3_3/AGGUCU/3_3-AGGUCU.mcs
MCSYM-DB/3_3/AGGUGU/
MCSYM-DB/3_3/AGGUGU/3_3-AGGUGU.mcs
MCSYM-DB/3_3/AGGUGU/ds-3_3-AGGUGU_x.pdb.gz
MCSYM-DB/3_3/AGGUUA/
MCSYM-DB/3_3/AGGUUA/3_3-AGGUUA.mcs
MCSYM-DB/3_3/AGGUUA/ds-3_3-AGGUUA_x.pdb.gz
MCSYM-DB/3_3/AGGUUU/
MCSYM-DB/3_3/AGGUUU/3_3-AGGUUU.mcs
MCSYM-DB/3_3/AGUAAG/
MCSYM-DB/3_3/AGUAAG/3_3-AGUAAG.mcs
MCSYM-DB/3_3/AGUAAU/
MCSYM-DB/3_3/AGUAAU/3_3-AGUAAU.mcs
MCSYM-DB/3_3/AGUAAU/ds-3_3-AGUAAU_x.pdb.gz
MCSYM-DB/3_3/AGUACC/
MCSYM-DB/3_3/AGUACC/3_3-AGUACC.mcs
MCSYM-DB/3_3/AGUACU/
MCSYM-DB/3_3/AGUACU/3_3-AGUACU.mcs
MCSYM-DB/3_3/AGUAGA/
MCSYM-DB/3_3/AGUAGA/3_3-AGUAGA.mcs
MCSYM-DB/3_3/AGUAGA/ds-3_3-AGUAGA_x.pdb.gz
MCSYM-DB/3_3/AGUAGG/
MCSYM-DB/3_3/AGUAGG/3_3-AGUAGG.mcs
MCSYM-DB/3_3/AGUAGU/
MCSYM-DB/3_3/AGUAGU/3_3-AGUAGU.mcs
MCSYM-DB/3_3/AGUAGU/ds-3_3-AGUAGU_x.pdb.gz
MCSYM-DB/3_3/AGUAUG/
MCSYM-DB/3_3/AGUAUG/3_3-AGUAUG.mcs
MCSYM-DB/3_3/AGUAUU/
MCSYM-DB/3_3/AGUAUU/3_3-AGUAUU.mcs
MCSYM-DB/3_3/AGUGAG/
MCSYM-DB/3_3/AGUGAG/3_3-AGUGAG.mcs
MCSYM-DB/3_3/AGUGCU/
MCSYM-DB/3_3/AGUGCU/3_3-AGUGCU.mcs
MCSYM-DB/3_3/AGUGGC/
MCSYM-DB/3_3/AGUGGC/3_3-AGUGGC.mcs
MCSYM-DB/3_3/AGUGGG/
MCSYM-DB/3_3/AGUGGG/3_3-AGUGGG.mcs
MCSYM-DB/3_3/AGUGGU/
MCSYM-DB/3_3/AGUGGU/3_3-AGUGGU.mcs
MCSYM-DB/3_3/AGUGGU/ds-3_3-AGUGGU_x.pdb.gz
MCSYM-DB/3_3/AGUGUG/
MCSYM-DB/3_3/AGUGUG/3_3-AGUGUG.mcs
MCSYM-DB/3_3/AGUUCA/
MCSYM-DB/3_3/AGUUCA/3_3-AGUUCA.mcs
MCSYM-DB/3_3/AGUUCC/
MCSYM-DB/3_3/AGUUCC/3_3-AGUUCC.mcs
MCSYM-DB/3_3/AGUUCU/
MCSYM-DB/3_3/AGUUCU/3_3-AGUUCU.mcs
MCSYM-DB/3_3/AGUUGU/
MCSYM-DB/3_3/AGUUGU/3_3-AGUUGU.mcs
MCSYM-DB/3_3/AUAAAU/
MCSYM-DB/3_3/AUAAAU/3_3-AUAAAU.mcs
MCSYM-DB/3_3/AUAACU/
MCSYM-DB/3_3/AUAACU/3_3-AUAACU.mcs
MCSYM-DB/3_3/AUAAUG/
MCSYM-DB/3_3/AUAAUG/3_3-AUAAUG.mcs
MCSYM-DB/3_3/AUAAUU/
MCSYM-DB/3_3/AUAAUU/3_3-AUAAUU.mcs
MCSYM-DB/3_3/AUAAUU/ds-3_3-AUAAUU_x.pdb.gz
MCSYM-DB/3_3/AUACAU/
MCSYM-DB/3_3/AUACAU/3_3-AUACAU.mcs
MCSYM-DB/3_3/AUACCU/
MCSYM-DB/3_3/AUACCU/3_3-AUACCU.mcs
MCSYM-DB/3_3/AUAGCU/
MCSYM-DB/3_3/AUAGCU/3_3-AUAGCU.mcs
MCSYM-DB/3_3/AUAGCU/ds-3_3-AUAGCU_x.pdb.gz
MCSYM-DB/3_3/AUAGGG/
MCSYM-DB/3_3/AUAGGG/3_3-AUAGGG.mcs
MCSYM-DB/3_3/AUAGGU/
MCSYM-DB/3_3/AUAGGU/3_3-AUAGGU.mcs
MCSYM-DB/3_3/AUAGUU/
MCSYM-DB/3_3/AUAGUU/3_3-AUAGUU.mcs
MCSYM-DB/3_3/AUAUAA/
MCSYM-DB/3_3/AUAUAA/3_3-AUAUAA.mcs
MCSYM-DB/3_3/AUAUAC/
MCSYM-DB/3_3/AUAUAC/3_3-AUAUAC.mcs
MCSYM-DB/3_3/AUAUAG/
MCSYM-DB/3_3/AUAUAG/3_3-AUAUAG.mcs
MCSYM-DB/3_3/AUAUAU/
MCSYM-DB/3_3/AUAUAU/3_3-AUAUAU.mcs
MCSYM-DB/3_3/AUAUAU/ds-3_3-AUAUAU_x.pdb.gz
MCSYM-DB/3_3/AUAUCU/
MCSYM-DB/3_3/AUAUCU/3_3-AUAUCU.mcs
MCSYM-DB/3_3/AUAUCU/ds-3_3-AUAUCU_x.pdb.gz
MCSYM-DB/3_3/AUAUGC/
MCSYM-DB/3_3/AUAUGC/3_3-AUAUGC.mcs
MCSYM-DB/3_3/AUAUGG/
MCSYM-DB/3_3/AUAUGG/3_3-AUAUGG.mcs
MCSYM-DB/3_3/AUAUGU/
MCSYM-DB/3_3/AUAUGU/3_3-AUAUGU.mcs
MCSYM-DB/3_3/AUAUGU/ds-3_3-AUAUGU_x.pdb.gz
MCSYM-DB/3_3/AUAUUU/
MCSYM-DB/3_3/AUAUUU/3_3-AUAUUU.mcs
MCSYM-DB/3_3/AUAUUU/ds-3_3-AUAUUU_x.pdb.gz
MCSYM-DB/3_3/AUCAAU/
MCSYM-DB/3_3/AUCAAU/3_3-AUCAAU.mcs
MCSYM-DB/3_3/AUCACU/
MCSYM-DB/3_3/AUCACU/3_3-AUCACU.mcs
MCSYM-DB/3_3/AUCCAU/
MCSYM-DB/3_3/AUCCAU/3_3-AUCCAU.mcs
MCSYM-DB/3_3/AUCCCC/
MCSYM-DB/3_3/AUCCCC/3_3-AUCCCC.mcs
MCSYM-DB/3_3/AUCGAA/
MCSYM-DB/3_3/AUCGAA/3_3-AUCGAA.mcs
MCSYM-DB/3_3/AUCGAC/
MCSYM-DB/3_3/AUCGAC/3_3-AUCGAC.mcs
MCSYM-DB/3_3/AUCGAG/
MCSYM-DB/3_3/AUCGAG/3_3-AUCGAG.mcs
MCSYM-DB/3_3/AUCGAU/
MCSYM-DB/3_3/AUCGAU/3_3-AUCGAU.mcs
MCSYM-DB/3_3/AUCGAU/ds-3_3-AUCGAU_x.pdb.gz
MCSYM-DB/3_3/AUCGCG/
MCSYM-DB/3_3/AUCGCG/3_3-AUCGCG.mcs
MCSYM-DB/3_3/AUCGCU/
MCSYM-DB/3_3/AUCGCU/3_3-AUCGCU.mcs
MCSYM-DB/3_3/AUCGCU/ds-3_3-AUCGCU_x.pdb.gz
MCSYM-DB/3_3/AUCGGU/
MCSYM-DB/3_3/AUCGGU/3_3-AUCGGU.mcs
MCSYM-DB/3_3/AUCGGU/ds-3_3-AUCGGU_x.pdb.gz
MCSYM-DB/3_3/AUCGUC/
MCSYM-DB/3_3/AUCGUC/3_3-AUCGUC.mcs
MCSYM-DB/3_3/AUCGUG/
MCSYM-DB/3_3/AUCGUG/3_3-AUCGUG.mcs
MCSYM-DB/3_3/AUCGUU/
MCSYM-DB/3_3/AUCGUU/3_3-AUCGUU.mcs
MCSYM-DB/3_3/AUCGUU/ds-3_3-AUCGUU_x.pdb.gz
MCSYM-DB/3_3/AUCUAU/
MCSYM-DB/3_3/AUCUAU/3_3-AUCUAU.mcs
MCSYM-DB/3_3/AUCUCA/
MCSYM-DB/3_3/AUCUCA/3_3-AUCUCA.mcs
MCSYM-DB/3_3/AUCUCU/
MCSYM-DB/3_3/AUCUCU/3_3-AUCUCU.mcs
MCSYM-DB/3_3/AUCUGU/
MCSYM-DB/3_3/AUCUGU/3_3-AUCUGU.mcs
MCSYM-DB/3_3/AUGAAU/
MCSYM-DB/3_3/AUGAAU/3_3-AUGAAU.mcs
MCSYM-DB/3_3/AUGACC/
MCSYM-DB/3_3/AUGACC/3_3-AUGACC.mcs
MCSYM-DB/3_3/AUGACU/
MCSYM-DB/3_3/AUGACU/3_3-AUGACU.mcs
MCSYM-DB/3_3/AUGAGC/
MCSYM-DB/3_3/AUGAGC/3_3-AUGAGC.mcs
MCSYM-DB/3_3/AUGAGU/
MCSYM-DB/3_3/AUGAGU/3_3-AUGAGU.mcs
MCSYM-DB/3_3/AUGAUA/
MCSYM-DB/3_3/AUGAUA/3_3-AUGAUA.mcs
MCSYM-DB/3_3/AUGAUU/
MCSYM-DB/3_3/AUGAUU/3_3-AUGAUU.mcs
MCSYM-DB/3_3/AUGCAA/
MCSYM-DB/3_3/AUGCAA/3_3-AUGCAA.mcs
MCSYM-DB/3_3/AUGCAC/
MCSYM-DB/3_3/AUGCAC/3_3-AUGCAC.mcs
MCSYM-DB/3_3/AUGCAG/
MCSYM-DB/3_3/AUGCAG/3_3-AUGCAG.mcs
MCSYM-DB/3_3/AUGCAU/
MCSYM-DB/3_3/AUGCAU/1BJ2_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1HC8_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1K6G_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1MMS_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1OLN_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1RKJ_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1S03_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1U8D_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1XOK_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1Y26_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1Y27_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1Y39_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1Z43_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/1ZDK_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/2BTE_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/2C4Y_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/2C4Z_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/2TPK_model_1.pdb.gz
MCSYM-DB/3_3/AUGCAU/3_3-AUGCAU.mcs
MCSYM-DB/3_3/AUGCAU/ds-3_3-AUGCAU_x.pdb.gz
MCSYM-DB/3_3/AUGCCC/
MCSYM-DB/3_3/AUGCCC/3_3-AUGCCC.mcs
MCSYM-DB/3_3/AUGCCU/
MCSYM-DB/3_3/AUGCCU/3_3-AUGCCU.mcs
MCSYM-DB/3_3/AUGCCU/ds-3_3-AUGCCU_x.pdb.gz
MCSYM-DB/3_3/AUGCGA/
MCSYM-DB/3_3/AUGCGA/3_3-AUGCGA.mcs
MCSYM-DB/3_3/AUGCGG/
MCSYM-DB/3_3/AUGCGG/3_3-AUGCGG.mcs
MCSYM-DB/3_3/AUGCGU/
MCSYM-DB/3_3/AUGCGU/3_3-AUGCGU.mcs
MCSYM-DB/3_3/AUGCGU/ds-3_3-AUGCGU_x.pdb.gz
MCSYM-DB/3_3/AUGCUC/
MCSYM-DB/3_3/AUGCUC/3_3-AUGCUC.mcs
MCSYM-DB/3_3/AUGCUG/
MCSYM-DB/3_3/AUGCUG/3_3-AUGCUG.mcs
MCSYM-DB/3_3/AUGCUG/ds-3_3-AUGCUG_x.pdb.gz
MCSYM-DB/3_3/AUGCUU/
MCSYM-DB/3_3/AUGCUU/3_3-AUGCUU.mcs
MCSYM-DB/3_3/AUGCUU/ds-3_3-AUGCUU_x.pdb.gz
MCSYM-DB/3_3/AUGGGU/
MCSYM-DB/3_3/AUGGGU/3_3-AUGGGU.mcs
MCSYM-DB/3_3/AUGGUU/
MCSYM-DB/3_3/AUGGUU/3_3-AUGGUU.mcs
MCSYM-DB/3_3/AUGUAA/
MCSYM-DB/3_3/AUGUAA/3_3-AUGUAA.mcs
MCSYM-DB/3_3/AUGUAC/
MCSYM-DB/3_3/AUGUAC/3_3-AUGUAC.mcs
MCSYM-DB/3_3/AUGUAU/
MCSYM-DB/3_3/AUGUAU/3_3-AUGUAU.mcs
MCSYM-DB/3_3/AUGUAU/ds-3_3-AUGUAU_x.pdb.gz
MCSYM-DB/3_3/AUGUCA/
MCSYM-DB/3_3/AUGUCA/3_3-AUGUCA.mcs
MCSYM-DB/3_3/AUGUCA/ds-3_3-AUGUCA_x.pdb.gz
MCSYM-DB/3_3/AUGUCU/
MCSYM-DB/3_3/AUGUCU/3_3-AUGUCU.mcs
MCSYM-DB/3_3/AUGUCU/ds-3_3-AUGUCU_x.pdb.gz
MCSYM-DB/3_3/AUGUGC/
MCSYM-DB/3_3/AUGUGC/3_3-AUGUGC.mcs
MCSYM-DB/3_3/AUGUGG/
MCSYM-DB/3_3/AUGUGG/3_3-AUGUGG.mcs
MCSYM-DB/3_3/AUGUGG/ds-3_3-AUGUGG_x.pdb.gz
MCSYM-DB/3_3/AUGUGU/
MCSYM-DB/3_3/AUGUGU/3_3-AUGUGU.mcs
MCSYM-DB/3_3/AUGUUU/
MCSYM-DB/3_3/AUGUUU/3_3-AUGUUU.mcs
MCSYM-DB/3_3/AUGUUU/ds-3_3-AUGUUU_x.pdb.gz
MCSYM-DB/3_3/AUUAAA/
MCSYM-DB/3_3/AUUAAA/3_3-AUUAAA.mcs
MCSYM-DB/3_3/AUUAAC/
MCSYM-DB/3_3/AUUAAC/3_3-AUUAAC.mcs
MCSYM-DB/3_3/AUUAAG/
MCSYM-DB/3_3/AUUAAG/3_3-AUUAAG.mcs
MCSYM-DB/3_3/AUUAAU/
MCSYM-DB/3_3/AUUAAU/3_3-AUUAAU.mcs
MCSYM-DB/3_3/AUUACC/
MCSYM-DB/3_3/AUUACC/3_3-AUUACC.mcs
MCSYM-DB/3_3/AUUACC/ds-3_3-AUUACC_x.pdb.gz
MCSYM-DB/3_3/AUUACU/
MCSYM-DB/3_3/AUUACU/3_3-AUUACU.mcs
MCSYM-DB/3_3/AUUACU/ds-3_3-AUUACU_x.pdb.gz
MCSYM-DB/3_3/AUUAGA/
MCSYM-DB/3_3/AUUAGA/3_3-AUUAGA.mcs
MCSYM-DB/3_3/AUUAGC/
MCSYM-DB/3_3/AUUAGC/3_3-AUUAGC.mcs
MCSYM-DB/3_3/AUUAGG/
MCSYM-DB/3_3/AUUAGG/3_3-AUUAGG.mcs
MCSYM-DB/3_3/AUUAGU/
MCSYM-DB/3_3/AUUAGU/3_3-AUUAGU.mcs
MCSYM-DB/3_3/AUUAGU/ds-3_3-AUUAGU_x.pdb.gz
MCSYM-DB/3_3/AUUAUC/
MCSYM-DB/3_3/AUUAUC/3_3-AUUAUC.mcs
MCSYM-DB/3_3/AUUAUU/
MCSYM-DB/3_3/AUUAUU/3_3-AUUAUU.mcs
MCSYM-DB/3_3/AUUAUU/ds-3_3-AUUAUU_x.pdb.gz
MCSYM-DB/3_3/AUUCAU/
MCSYM-DB/3_3/AUUCAU/3_3-AUUCAU.mcs
MCSYM-DB/3_3/AUUCCG/
MCSYM-DB/3_3/AUUCCG/3_3-AUUCCG.mcs
MCSYM-DB/3_3/AUUCCU/
MCSYM-DB/3_3/AUUCCU/3_3-AUUCCU.mcs
MCSYM-DB/3_3/AUUCGC/
MCSYM-DB/3_3/AUUCGC/3_3-AUUCGC.mcs
MCSYM-DB/3_3/AUUGAC/
MCSYM-DB/3_3/AUUGAC/3_3-AUUGAC.mcs
MCSYM-DB/3_3/AUUGAG/
MCSYM-DB/3_3/AUUGAG/3_3-AUUGAG.mcs
MCSYM-DB/3_3/AUUGAU/
MCSYM-DB/3_3/AUUGAU/3_3-AUUGAU.mcs
MCSYM-DB/3_3/AUUGAU/ds-3_3-AUUGAU_x.pdb.gz
MCSYM-DB/3_3/AUUGCA/
MCSYM-DB/3_3/AUUGCA/3_3-AUUGCA.mcs
MCSYM-DB/3_3/AUUGCC/
MCSYM-DB/3_3/AUUGCC/3_3-AUUGCC.mcs
MCSYM-DB/3_3/AUUGCU/
MCSYM-DB/3_3/AUUGCU/3_3-AUUGCU.mcs
MCSYM-DB/3_3/AUUGGU/
MCSYM-DB/3_3/AUUGGU/3_3-AUUGGU.mcs
MCSYM-DB/3_3/AUUGUC/
MCSYM-DB/3_3/AUUGUC/3_3-AUUGUC.mcs
MCSYM-DB/3_3/AUUGUU/
MCSYM-DB/3_3/AUUGUU/3_3-AUUGUU.mcs
MCSYM-DB/3_3/AUUGUU/ds-3_3-AUUGUU_x.pdb.gz
MCSYM-DB/3_3/AUUUAU/
MCSYM-DB/3_3/AUUUAU/3_3-AUUUAU.mcs
MCSYM-DB/3_3/AUUUCC/
MCSYM-DB/3_3/AUUUCC/3_3-AUUUCC.mcs
MCSYM-DB/3_3/AUUUCU/
MCSYM-DB/3_3/AUUUCU/3_3-AUUUCU.mcs
MCSYM-DB/3_3/AUUUCU/ds-3_3-AUUUCU_x.pdb.gz
MCSYM-DB/3_3/AUUUGU/
MCSYM-DB/3_3/AUUUGU/3_3-AUUUGU.mcs
MCSYM-DB/3_3/AUUUUC/
MCSYM-DB/3_3/AUUUUC/3_3-AUUUUC.mcs
MCSYM-DB/3_3/AUUUUC/ds-3_3-AUUUUC_x.pdb.gz
MCSYM-DB/3_3/CAAAAG/
MCSYM-DB/3_3/CAAAAG/3_3-CAAAAG.mcs
MCSYM-DB/3_3/CAAACG/
MCSYM-DB/3_3/CAAACG/3_3-CAAACG.mcs
MCSYM-DB/3_3/CAAAGC/
MCSYM-DB/3_3/CAAAGC/3_3-CAAAGC.mcs
MCSYM-DB/3_3/CAAAUG/
MCSYM-DB/3_3/CAAAUG/3_3-CAAAUG.mcs
MCSYM-DB/3_3/CAACAG/
MCSYM-DB/3_3/CAACAG/3_3-CAACAG.mcs
MCSYM-DB/3_3/CAACCC/
MCSYM-DB/3_3/CAACCC/3_3-CAACCC.mcs
MCSYM-DB/3_3/CAACUG/
MCSYM-DB/3_3/CAACUG/3_3-CAACUG.mcs
MCSYM-DB/3_3/CAAGAA/
MCSYM-DB/3_3/CAAGAA/3_3-CAAGAA.mcs
MCSYM-DB/3_3/CAAGAA/ds-3_3-CAAGAA_x.pdb.gz
MCSYM-DB/3_3/CAAGAG/
MCSYM-DB/3_3/CAAGAG/3_3-CAAGAG.mcs
MCSYM-DB/3_3/CAAGAG/ds-3_3-CAAGAG_x.pdb.gz
MCSYM-DB/3_3/CAAGCA/
MCSYM-DB/3_3/CAAGCA/3_3-CAAGCA.mcs
MCSYM-DB/3_3/CAAGCG/
MCSYM-DB/3_3/CAAGCG/3_3-CAAGCG.mcs
MCSYM-DB/3_3/CAAUAA/
MCSYM-DB/3_3/CAAUAA/3_3-CAAUAA.mcs
MCSYM-DB/3_3/CAAUAC/
MCSYM-DB/3_3/CAAUAC/3_3-CAAUAC.mcs
MCSYM-DB/3_3/CAAUAG/
MCSYM-DB/3_3/CAAUAG/3_3-CAAUAG.mcs
MCSYM-DB/3_3/CAAUAG/ds-3_3-CAAUAG_x.pdb.gz
MCSYM-DB/3_3/CAAUCA/
MCSYM-DB/3_3/CAAUCA/3_3-CAAUCA.mcs
MCSYM-DB/3_3/CAAUCC/
MCSYM-DB/3_3/CAAUCC/3_3-CAAUCC.mcs
MCSYM-DB/3_3/CAAUCG/
MCSYM-DB/3_3/CAAUCG/3_3-CAAUCG.mcs
MCSYM-DB/3_3/CAAUCG/ds-3_3-CAAUCG_x.pdb.gz
MCSYM-DB/3_3/CAAUGA/
MCSYM-DB/3_3/CAAUGA/3_3-CAAUGA.mcs
MCSYM-DB/3_3/CAAUGC/
MCSYM-DB/3_3/CAAUGC/3_3-CAAUGC.mcs
MCSYM-DB/3_3/CAAUGG/
MCSYM-DB/3_3/CAAUGG/3_3-CAAUGG.mcs
MCSYM-DB/3_3/CAAUGG/ds-3_3-CAAUGG_x.pdb.gz
MCSYM-DB/3_3/CAAUUA/
MCSYM-DB/3_3/CAAUUA/3_3-CAAUUA.mcs
MCSYM-DB/3_3/CAAUUG/
MCSYM-DB/3_3/CAAUUG/3_3-CAAUUG.mcs
MCSYM-DB/3_3/CAAUUG/ds-3_3-CAAUUG_x.pdb.gz
MCSYM-DB/3_3/CAAUUU/
MCSYM-DB/3_3/CAAUUU/3_3-CAAUUU.mcs
MCSYM-DB/3_3/CACAAG/
MCSYM-DB/3_3/CACAAG/3_3-CACAAG.mcs
MCSYM-DB/3_3/CACACA/
MCSYM-DB/3_3/CACACA/3_3-CACACA.mcs
MCSYM-DB/3_3/CACAUG/
MCSYM-DB/3_3/CACAUG/3_3-CACAUG.mcs
MCSYM-DB/3_3/CACCUC/
MCSYM-DB/3_3/CACCUC/3_3-CACCUC.mcs
MCSYM-DB/3_3/CACCUG/
MCSYM-DB/3_3/CACCUG/3_3-CACCUG.mcs
MCSYM-DB/3_3/CACGAA/
MCSYM-DB/3_3/CACGAA/3_3-CACGAA.mcs
MCSYM-DB/3_3/CACGAG/
MCSYM-DB/3_3/CACGAG/3_3-CACGAG.mcs
MCSYM-DB/3_3/CACGAG/ds-3_3-CACGAG_x.pdb.gz
MCSYM-DB/3_3/CACGCA/
MCSYM-DB/3_3/CACGCA/3_3-CACGCA.mcs
MCSYM-DB/3_3/CACGCA/ds-3_3-CACGCA_x.pdb.gz
MCSYM-DB/3_3/CACGCC/
MCSYM-DB/3_3/CACGCC/3_3-CACGCC.mcs
MCSYM-DB/3_3/CACGCC/ds-3_3-CACGCC_x.pdb.gz
MCSYM-DB/3_3/CACGCG/
MCSYM-DB/3_3/CACGCG/1U9S_model_1.pdb.gz
MCSYM-DB/3_3/CACGCG/3_3-CACGCG.mcs
MCSYM-DB/3_3/CACGCG/ds-3_3-CACGCG_x.pdb.gz
MCSYM-DB/3_3/CACGCU/
MCSYM-DB/3_3/CACGCU/3_3-CACGCU.mcs
MCSYM-DB/3_3/CACGGG/
MCSYM-DB/3_3/CACGGG/3_3-CACGGG.mcs
MCSYM-DB/3_3/CACGGG/ds-3_3-CACGGG_x.pdb.gz
MCSYM-DB/3_3/CACGGU/
MCSYM-DB/3_3/CACGGU/3_3-CACGGU.mcs
MCSYM-DB/3_3/CACGUA/
MCSYM-DB/3_3/CACGUA/3_3-CACGUA.mcs
MCSYM-DB/3_3/CACGUC/
MCSYM-DB/3_3/CACGUC/3_3-CACGUC.mcs
MCSYM-DB/3_3/CACGUG/
MCSYM-DB/3_3/CACGUG/3_3-CACGUG.mcs
MCSYM-DB/3_3/CACGUG/ds-3_3-CACGUG_x.pdb.gz
MCSYM-DB/3_3/CACGUU/
MCSYM-DB/3_3/CACGUU/3_3-CACGUU.mcs
MCSYM-DB/3_3/CACUAU/
MCSYM-DB/3_3/CACUAU/3_3-CACUAU.mcs
MCSYM-DB/3_3/CACUCC/
MCSYM-DB/3_3/CACUCC/3_3-CACUCC.mcs
MCSYM-DB/3_3/CACUCU/
MCSYM-DB/3_3/CACUCU/3_3-CACUCU.mcs
MCSYM-DB/3_3/CACUGG/
MCSYM-DB/3_3/CACUGG/3_3-CACUGG.mcs
MCSYM-DB/3_3/CACUUG/
MCSYM-DB/3_3/CACUUG/3_3-CACUUG.mcs
MCSYM-DB/3_3/CAGAAG/
MCSYM-DB/3_3/CAGAAG/3_3-CAGAAG.mcs
MCSYM-DB/3_3/CAGAAG/ds-3_3-CAGAAG_x.pdb.gz
MCSYM-DB/3_3/CAGAAU/
MCSYM-DB/3_3/CAGAAU/3_3-CAGAAU.mcs
MCSYM-DB/3_3/CAGACC/
MCSYM-DB/3_3/CAGACC/3_3-CAGACC.mcs
MCSYM-DB/3_3/CAGACG/
MCSYM-DB/3_3/CAGACG/3_3-CAGACG.mcs
MCSYM-DB/3_3/CAGACG/ds-3_3-CAGACG_x.pdb.gz
MCSYM-DB/3_3/CAGAGG/
MCSYM-DB/3_3/CAGAGG/3_3-CAGAGG.mcs
MCSYM-DB/3_3/CAGAUA/
MCSYM-DB/3_3/CAGAUA/3_3-CAGAUA.mcs
MCSYM-DB/3_3/CAGAUG/
MCSYM-DB/3_3/CAGAUG/3_3-CAGAUG.mcs
MCSYM-DB/3_3/CAGCAA/
MCSYM-DB/3_3/CAGCAA/3_3-CAGCAA.mcs
MCSYM-DB/3_3/CAGCAC/
MCSYM-DB/3_3/CAGCAC/3_3-CAGCAC.mcs
MCSYM-DB/3_3/CAGCAG/
MCSYM-DB/3_3/CAGCAG/3_3-CAGCAG.mcs
MCSYM-DB/3_3/CAGCAG/ds-3_3-CAGCAG_x.pdb.gz
MCSYM-DB/3_3/CAGCAU/
MCSYM-DB/3_3/CAGCAU/3_3-CAGCAU.mcs
MCSYM-DB/3_3/CAGCCA/
MCSYM-DB/3_3/CAGCCA/3_3-CAGCCA.mcs
MCSYM-DB/3_3/CAGCCC/
MCSYM-DB/3_3/CAGCCC/3_3-CAGCCC.mcs
MCSYM-DB/3_3/CAGCCC/ds-3_3-CAGCCC_x.pdb.gz
MCSYM-DB/3_3/CAGCCG/
MCSYM-DB/3_3/CAGCCG/3_3-CAGCCG.mcs
MCSYM-DB/3_3/CAGCCG/ds-3_3-CAGCCG_x.pdb.gz
MCSYM-DB/3_3/CAGCCU/
MCSYM-DB/3_3/CAGCCU/3_3-CAGCCU.mcs
MCSYM-DB/3_3/CAGCGG/
MCSYM-DB/3_3/CAGCGG/3_3-CAGCGG.mcs
MCSYM-DB/3_3/CAGCGG/ds-3_3-CAGCGG_x.pdb.gz
MCSYM-DB/3_3/CAGCUC/
MCSYM-DB/3_3/CAGCUC/3_3-CAGCUC.mcs
MCSYM-DB/3_3/CAGCUG/
MCSYM-DB/3_3/CAGCUG/3_3-CAGCUG.mcs
MCSYM-DB/3_3/CAGCUG/ds-3_3-CAGCUG_x.pdb.gz
MCSYM-DB/3_3/CAGCUU/
MCSYM-DB/3_3/CAGCUU/3_3-CAGCUU.mcs
MCSYM-DB/3_3/CAGGCA/
MCSYM-DB/3_3/CAGGCA/3_3-CAGGCA.mcs
MCSYM-DB/3_3/CAGGCA/ds-3_3-CAGGCA_x.pdb.gz
MCSYM-DB/3_3/CAGGCG/
MCSYM-DB/3_3/CAGGCG/3_3-CAGGCG.mcs
MCSYM-DB/3_3/CAGGGG/
MCSYM-DB/3_3/CAGGGG/3_3-CAGGGG.mcs
MCSYM-DB/3_3/CAGGGU/
MCSYM-DB/3_3/CAGGGU/3_3-CAGGGU.mcs
MCSYM-DB/3_3/CAGUAA/
MCSYM-DB/3_3/CAGUAA/3_3-CAGUAA.mcs
MCSYM-DB/3_3/CAGUAA/ds-3_3-CAGUAA_x.pdb.gz
MCSYM-DB/3_3/CAGUAG/
MCSYM-DB/3_3/CAGUAG/3_3-CAGUAG.mcs
MCSYM-DB/3_3/CAGUAG/ds-3_3-CAGUAG_x.pdb.gz
MCSYM-DB/3_3/CAGUCG/
MCSYM-DB/3_3/CAGUCG/3_3-CAGUCG.mcs
MCSYM-DB/3_3/CAGUGG/
MCSYM-DB/3_3/CAGUGG/1IL2_model_1.pdb.gz
MCSYM-DB/3_3/CAGUGG/3_3-CAGUGG.mcs
MCSYM-DB/3_3/CAGUGG/ds-3_3-CAGUGG_x.pdb.gz
MCSYM-DB/3_3/CAGUUA/
MCSYM-DB/3_3/CAGUUA/3_3-CAGUUA.mcs
MCSYM-DB/3_3/CAGUUG/
MCSYM-DB/3_3/CAGUUG/3_3-CAGUUG.mcs
MCSYM-DB/3_3/CAGUUU/
MCSYM-DB/3_3/CAGUUU/3_3-CAGUUU.mcs
MCSYM-DB/3_3/CAUAAA/
MCSYM-DB/3_3/CAUAAA/3_3-CAUAAA.mcs
MCSYM-DB/3_3/CAUAAG/
MCSYM-DB/3_3/CAUAAG/3_3-CAUAAG.mcs
MCSYM-DB/3_3/CAUAAG/ds-3_3-CAUAAG_x.pdb.gz
MCSYM-DB/3_3/CAUAAU/
MCSYM-DB/3_3/CAUAAU/3_3-CAUAAU.mcs
MCSYM-DB/3_3/CAUACA/
MCSYM-DB/3_3/CAUACA/3_3-CAUACA.mcs
MCSYM-DB/3_3/CAUACC/
MCSYM-DB/3_3/CAUACC/3_3-CAUACC.mcs
MCSYM-DB/3_3/CAUACC/ds-3_3-CAUACC_x.pdb.gz
MCSYM-DB/3_3/CAUACG/
MCSYM-DB/3_3/CAUACG/3_3-CAUACG.mcs
MCSYM-DB/3_3/CAUACG/ds-3_3-CAUACG_x.pdb.gz
MCSYM-DB/3_3/CAUACU/
MCSYM-DB/3_3/CAUACU/3_3-CAUACU.mcs
MCSYM-DB/3_3/CAUAGC/
MCSYM-DB/3_3/CAUAGC/3_3-CAUAGC.mcs
MCSYM-DB/3_3/CAUAGG/
MCSYM-DB/3_3/CAUAGG/3_3-CAUAGG.mcs
MCSYM-DB/3_3/CAUAGG/ds-3_3-CAUAGG_x.pdb.gz
MCSYM-DB/3_3/CAUAUA/
MCSYM-DB/3_3/CAUAUA/3_3-CAUAUA.mcs
MCSYM-DB/3_3/CAUAUG/
MCSYM-DB/3_3/CAUAUG/3_3-CAUAUG.mcs
MCSYM-DB/3_3/CAUAUG/ds-3_3-CAUAUG_x.pdb.gz
MCSYM-DB/3_3/CAUAUU/
MCSYM-DB/3_3/CAUAUU/3_3-CAUAUU.mcs
MCSYM-DB/3_3/CAUCCA/
MCSYM-DB/3_3/CAUCCA/3_3-CAUCCA.mcs
MCSYM-DB/3_3/CAUCUC/
MCSYM-DB/3_3/CAUCUC/3_3-CAUCUC.mcs
MCSYM-DB/3_3/CAUCUG/
MCSYM-DB/3_3/CAUCUG/3_3-CAUCUG.mcs
MCSYM-DB/3_3/CAUGAG/
MCSYM-DB/3_3/CAUGAG/3_3-CAUGAG.mcs
MCSYM-DB/3_3/CAUGCA/
MCSYM-DB/3_3/CAUGCA/3_3-CAUGCA.mcs
MCSYM-DB/3_3/CAUGCG/
MCSYM-DB/3_3/CAUGCG/3_3-CAUGCG.mcs
MCSYM-DB/3_3/CAUGCG/ds-3_3-CAUGCG_x.pdb.gz
MCSYM-DB/3_3/CAUGGG/
MCSYM-DB/3_3/CAUGGG/3_3-CAUGGG.mcs
MCSYM-DB/3_3/CAUGUG/
MCSYM-DB/3_3/CAUGUG/3_3-CAUGUG.mcs
MCSYM-DB/3_3/CAUGUU/
MCSYM-DB/3_3/CAUGUU/3_3-CAUGUU.mcs
MCSYM-DB/3_3/CAUUAG/
MCSYM-DB/3_3/CAUUAG/3_3-CAUUAG.mcs
MCSYM-DB/3_3/CAUUCA/
MCSYM-DB/3_3/CAUUCA/3_3-CAUUCA.mcs
MCSYM-DB/3_3/CAUUCG/
MCSYM-DB/3_3/CAUUCG/3_3-CAUUCG.mcs
MCSYM-DB/3_3/CAUUCG/ds-3_3-CAUUCG_x.pdb.gz
MCSYM-DB/3_3/CAUUCU/
MCSYM-DB/3_3/CAUUCU/3_3-CAUUCU.mcs
MCSYM-DB/3_3/CAUUUG/
MCSYM-DB/3_3/CAUUUG/3_3-CAUUUG.mcs
MCSYM-DB/3_3/CCAAAG/
MCSYM-DB/3_3/CCAAAG/3_3-CCAAAG.mcs
MCSYM-DB/3_3/CCAAAG/ds-3_3-CCAAAG_x.pdb.gz
MCSYM-DB/3_3/CCAAAU/
MCSYM-DB/3_3/CCAAAU/3_3-CCAAAU.mcs
MCSYM-DB/3_3/CCAACG/
MCSYM-DB/3_3/CCAACG/3_3-CCAACG.mcs
MCSYM-DB/3_3/CCAAGA/
MCSYM-DB/3_3/CCAAGA/3_3-CCAAGA.mcs
MCSYM-DB/3_3/CCAAUG/
MCSYM-DB/3_3/CCAAUG/3_3-CCAAUG.mcs
MCSYM-DB/3_3/CCAAUG/ds-3_3-CCAAUG_x.pdb.gz
MCSYM-DB/3_3/CCACAA/
MCSYM-DB/3_3/CCACAA/3_3-CCACAA.mcs
MCSYM-DB/3_3/CCACAG/
MCSYM-DB/3_3/CCACAG/3_3-CCACAG.mcs
MCSYM-DB/3_3/CCACAU/
MCSYM-DB/3_3/CCACAU/3_3-CCACAU.mcs
MCSYM-DB/3_3/CCACCA/
MCSYM-DB/3_3/CCACCA/3_3-CCACCA.mcs
MCSYM-DB/3_3/CCACCG/
MCSYM-DB/3_3/CCACCG/3_3-CCACCG.mcs
MCSYM-DB/3_3/CCACUG/
MCSYM-DB/3_3/CCACUG/3_3-CCACUG.mcs
MCSYM-DB/3_3/CCACUG/ds-3_3-CCACUG_x.pdb.gz
MCSYM-DB/3_3/CCAGCG/
MCSYM-DB/3_3/CCAGCG/3_3-CCAGCG.mcs
MCSYM-DB/3_3/CCAGGG/
MCSYM-DB/3_3/CCAGGG/3_3-CCAGGG.mcs
MCSYM-DB/3_3/CCAGUG/
MCSYM-DB/3_3/CCAGUG/3_3-CCAGUG.mcs
MCSYM-DB/3_3/CCAGUG/ds-3_3-CCAGUG_x.pdb.gz
MCSYM-DB/3_3/CCAUAA/
MCSYM-DB/3_3/CCAUAA/3_3-CCAUAA.mcs
MCSYM-DB/3_3/CCAUAC/
MCSYM-DB/3_3/CCAUAC/3_3-CCAUAC.mcs
MCSYM-DB/3_3/CCAUAG/
MCSYM-DB/3_3/CCAUAG/3_3-CCAUAG.mcs
MCSYM-DB/3_3/CCAUAG/ds-3_3-CCAUAG_x.pdb.gz
MCSYM-DB/3_3/CCAUAU/
MCSYM-DB/3_3/CCAUAU/3_3-CCAUAU.mcs
MCSYM-DB/3_3/CCAUCA/
MCSYM-DB/3_3/CCAUCA/3_3-CCAUCA.mcs
MCSYM-DB/3_3/CCAUCC/
MCSYM-DB/3_3/CCAUCC/3_3-CCAUCC.mcs
MCSYM-DB/3_3/CCAUCG/
MCSYM-DB/3_3/CCAUCG/3_3-CCAUCG.mcs
MCSYM-DB/3_3/CCAUCG/ds-3_3-CCAUCG_x.pdb.gz
MCSYM-DB/3_3/CCAUGA/
MCSYM-DB/3_3/CCAUGA/3_3-CCAUGA.mcs
MCSYM-DB/3_3/CCAUGG/
MCSYM-DB/3_3/CCAUGG/3_3-CCAUGG.mcs
MCSYM-DB/3_3/CCAUGU/
MCSYM-DB/3_3/CCAUGU/3_3-CCAUGU.mcs
MCSYM-DB/3_3/CCAUUA/
MCSYM-DB/3_3/CCAUUA/3_3-CCAUUA.mcs
MCSYM-DB/3_3/CCAUUA/ds-3_3-CCAUUA_x.pdb.gz
MCSYM-DB/3_3/CCAUUG/
MCSYM-DB/3_3/CCAUUG/3_3-CCAUUG.mcs
MCSYM-DB/3_3/CCAUUG/ds-3_3-CCAUUG_x.pdb.gz
MCSYM-DB/3_3/CCAUUU/
MCSYM-DB/3_3/CCAUUU/3_3-CCAUUU.mcs
MCSYM-DB/3_3/CCCAAG/
MCSYM-DB/3_3/CCCAAG/3_3-CCCAAG.mcs
MCSYM-DB/3_3/CCCAAU/
MCSYM-DB/3_3/CCCAAU/3_3-CCCAAU.mcs
MCSYM-DB/3_3/CCCACC/
MCSYM-DB/3_3/CCCACC/3_3-CCCACC.mcs
MCSYM-DB/3_3/CCCAGG/
MCSYM-DB/3_3/CCCAGG/3_3-CCCAGG.mcs
MCSYM-DB/3_3/CCCAGG/ds-3_3-CCCAGG_x.pdb.gz
MCSYM-DB/3_3/CCCAUG/
MCSYM-DB/3_3/CCCAUG/3_3-CCCAUG.mcs
MCSYM-DB/3_3/CCCCAG/
MCSYM-DB/3_3/CCCCAG/3_3-CCCCAG.mcs
MCSYM-DB/3_3/CCCCCG/
MCSYM-DB/3_3/CCCCCG/3_3-CCCCCG.mcs
MCSYM-DB/3_3/CCCCCG/ds-3_3-CCCCCG_x.pdb.gz
MCSYM-DB/3_3/CCCCCU/
MCSYM-DB/3_3/CCCCCU/3_3-CCCCCU.mcs
MCSYM-DB/3_3/CCCCUA/
MCSYM-DB/3_3/CCCCUA/3_3-CCCCUA.mcs
MCSYM-DB/3_3/CCCCUA/ds-3_3-CCCCUA_x.pdb.gz
MCSYM-DB/3_3/CCCCUG/
MCSYM-DB/3_3/CCCCUG/3_3-CCCCUG.mcs
MCSYM-DB/3_3/CCCCUG/ds-3_3-CCCCUG_x.pdb.gz
MCSYM-DB/3_3/CCCGAA/
MCSYM-DB/3_3/CCCGAA/3_3-CCCGAA.mcs
MCSYM-DB/3_3/CCCGAG/
MCSYM-DB/3_3/CCCGAG/3_3-CCCGAG.mcs
MCSYM-DB/3_3/CCCGAG/ds-3_3-CCCGAG_x.pdb.gz
MCSYM-DB/3_3/CCCGAU/
MCSYM-DB/3_3/CCCGAU/3_3-CCCGAU.mcs
MCSYM-DB/3_3/CCCGCC/
MCSYM-DB/3_3/CCCGCC/3_3-CCCGCC.mcs
MCSYM-DB/3_3/CCCGCG/
MCSYM-DB/3_3/CCCGCG/3_3-CCCGCG.mcs
MCSYM-DB/3_3/CCCGCG/ds-3_3-CCCGCG_x.pdb.gz
MCSYM-DB/3_3/CCCGGC/
MCSYM-DB/3_3/CCCGGC/3_3-CCCGGC.mcs
MCSYM-DB/3_3/CCCGGG/
MCSYM-DB/3_3/CCCGGG/3_3-CCCGGG.mcs
MCSYM-DB/3_3/CCCGGG/ds-3_3-CCCGGG_x.pdb.gz
MCSYM-DB/3_3/CCCGGU/
MCSYM-DB/3_3/CCCGGU/3_3-CCCGGU.mcs
MCSYM-DB/3_3/CCCGUA/
MCSYM-DB/3_3/CCCGUA/3_3-CCCGUA.mcs
MCSYM-DB/3_3/CCCGUC/
MCSYM-DB/3_3/CCCGUC/3_3-CCCGUC.mcs
MCSYM-DB/3_3/CCCGUC/ds-3_3-CCCGUC_x.pdb.gz
MCSYM-DB/3_3/CCCGUG/
MCSYM-DB/3_3/CCCGUG/3_3-CCCGUG.mcs
MCSYM-DB/3_3/CCCGUG/ds-3_3-CCCGUG_x.pdb.gz
MCSYM-DB/3_3/CCCUAG/
MCSYM-DB/3_3/CCCUAG/3_3-CCCUAG.mcs
MCSYM-DB/3_3/CCGAAG/
MCSYM-DB/3_3/CCGAAG/3_3-CCGAAG.mcs
MCSYM-DB/3_3/CCGACC/
MCSYM-DB/3_3/CCGACC/3_3-CCGACC.mcs
MCSYM-DB/3_3/CCGAGG/
MCSYM-DB/3_3/CCGAGG/3_3-CCGAGG.mcs
MCSYM-DB/3_3/CCGCAC/
MCSYM-DB/3_3/CCGCAC/3_3-CCGCAC.mcs
MCSYM-DB/3_3/CCGCAG/
MCSYM-DB/3_3/CCGCAG/1XHP_model_1.pdb.gz
MCSYM-DB/3_3/CCGCAG/3_3-CCGCAG.mcs
MCSYM-DB/3_3/CCGCAG/ds-3_3-CCGCAG_x.pdb.gz
MCSYM-DB/3_3/CCGCCA/
MCSYM-DB/3_3/CCGCCA/3_3-CCGCCA.mcs
MCSYM-DB/3_3/CCGCCC/
MCSYM-DB/3_3/CCGCCC/3_3-CCGCCC.mcs
MCSYM-DB/3_3/CCGCCG/
MCSYM-DB/3_3/CCGCCG/3_3-CCGCCG.mcs
MCSYM-DB/3_3/CCGCCG/ds-3_3-CCGCCG_x.pdb.gz
MCSYM-DB/3_3/CCGCGA/
MCSYM-DB/3_3/CCGCGA/3_3-CCGCGA.mcs
MCSYM-DB/3_3/CCGCGC/
MCSYM-DB/3_3/CCGCGC/3_3-CCGCGC.mcs
MCSYM-DB/3_3/CCGCGG/
MCSYM-DB/3_3/CCGCGG/3_3-CCGCGG.mcs
MCSYM-DB/3_3/CCGCUG/
MCSYM-DB/3_3/CCGCUG/3_3-CCGCUG.mcs
MCSYM-DB/3_3/CCGCUG/ds-3_3-CCGCUG_x.pdb.gz
MCSYM-DB/3_3/CCGCUU/
MCSYM-DB/3_3/CCGCUU/3_3-CCGCUU.mcs
MCSYM-DB/3_3/CCGGAG/
MCSYM-DB/3_3/CCGGAG/3_3-CCGGAG.mcs
MCSYM-DB/3_3/CCGUAG/
MCSYM-DB/3_3/CCGUAG/3_3-CCGUAG.mcs
MCSYM-DB/3_3/CCGUAG/ds-3_3-CCGUAG_x.pdb.gz
MCSYM-DB/3_3/CCGUCG/
MCSYM-DB/3_3/CCGUCG/3_3-CCGUCG.mcs
MCSYM-DB/3_3/CCGUCG/ds-3_3-CCGUCG_x.pdb.gz
MCSYM-DB/3_3/CCGUGG/
MCSYM-DB/3_3/CCGUGG/3_3-CCGUGG.mcs
MCSYM-DB/3_3/CCGUUG/
MCSYM-DB/3_3/CCGUUG/3_3-CCGUUG.mcs
MCSYM-DB/3_3/CCGUUG/ds-3_3-CCGUUG_x.pdb.gz
MCSYM-DB/3_3/CCUAAA/
MCSYM-DB/3_3/CCUAAA/3_3-CCUAAA.mcs
MCSYM-DB/3_3/CCUAAG/
MCSYM-DB/3_3/CCUAAG/3_3-CCUAAG.mcs
MCSYM-DB/3_3/CCUAAG/ds-3_3-CCUAAG_x.pdb.gz
MCSYM-DB/3_3/CCUACA/
MCSYM-DB/3_3/CCUACA/3_3-CCUACA.mcs
MCSYM-DB/3_3/CCUACC/
MCSYM-DB/3_3/CCUACC/3_3-CCUACC.mcs
MCSYM-DB/3_3/CCUACG/
MCSYM-DB/3_3/CCUACG/3_3-CCUACG.mcs
MCSYM-DB/3_3/CCUACG/ds-3_3-CCUACG_x.pdb.gz
MCSYM-DB/3_3/CCUACU/
MCSYM-DB/3_3/CCUACU/3_3-CCUACU.mcs
MCSYM-DB/3_3/CCUAGA/
MCSYM-DB/3_3/CCUAGA/3_3-CCUAGA.mcs
MCSYM-DB/3_3/CCUAGG/
MCSYM-DB/3_3/CCUAGG/3_3-CCUAGG.mcs
MCSYM-DB/3_3/CCUAGU/
MCSYM-DB/3_3/CCUAGU/3_3-CCUAGU.mcs
MCSYM-DB/3_3/CCUAUA/
MCSYM-DB/3_3/CCUAUA/3_3-CCUAUA.mcs
MCSYM-DB/3_3/CCUAUC/
MCSYM-DB/3_3/CCUAUC/3_3-CCUAUC.mcs
MCSYM-DB/3_3/CCUAUC/ds-3_3-CCUAUC_x.pdb.gz
MCSYM-DB/3_3/CCUAUG/
MCSYM-DB/3_3/CCUAUG/3_3-CCUAUG.mcs
MCSYM-DB/3_3/CCUAUG/ds-3_3-CCUAUG_x.pdb.gz
MCSYM-DB/3_3/CCUAUU/
MCSYM-DB/3_3/CCUAUU/3_3-CCUAUU.mcs
MCSYM-DB/3_3/CCUCAA/
MCSYM-DB/3_3/CCUCAA/3_3-CCUCAA.mcs
MCSYM-DB/3_3/CCUCAC/
MCSYM-DB/3_3/CCUCAC/3_3-CCUCAC.mcs
MCSYM-DB/3_3/CCUCAG/
MCSYM-DB/3_3/CCUCAG/3_3-CCUCAG.mcs
MCSYM-DB/3_3/CCUCAU/
MCSYM-DB/3_3/CCUCAU/3_3-CCUCAU.mcs
MCSYM-DB/3_3/CCUCCA/
MCSYM-DB/3_3/CCUCCA/3_3-CCUCCA.mcs
MCSYM-DB/3_3/CCUCCU/
MCSYM-DB/3_3/CCUCCU/3_3-CCUCCU.mcs
MCSYM-DB/3_3/CCUCUG/
MCSYM-DB/3_3/CCUCUG/3_3-CCUCUG.mcs
MCSYM-DB/3_3/CCUCUU/
MCSYM-DB/3_3/CCUCUU/3_3-CCUCUU.mcs
MCSYM-DB/3_3/CCUGAC/
MCSYM-DB/3_3/CCUGAC/3_3-CCUGAC.mcs
MCSYM-DB/3_3/CCUGAG/
MCSYM-DB/3_3/CCUGAG/3_3-CCUGAG.mcs
MCSYM-DB/3_3/CCUGAG/ds-3_3-CCUGAG_x.pdb.gz
MCSYM-DB/3_3/CCUGCG/
MCSYM-DB/3_3/CCUGCG/3_3-CCUGCG.mcs
MCSYM-DB/3_3/CCUGCG/ds-3_3-CCUGCG_x.pdb.gz
MCSYM-DB/3_3/CCUGGA/
MCSYM-DB/3_3/CCUGGA/3_3-CCUGGA.mcs
MCSYM-DB/3_3/CCUGGC/
MCSYM-DB/3_3/CCUGGC/3_3-CCUGGC.mcs
MCSYM-DB/3_3/CCUGUG/
MCSYM-DB/3_3/CCUGUG/3_3-CCUGUG.mcs
MCSYM-DB/3_3/CCUGUG/ds-3_3-CCUGUG_x.pdb.gz
MCSYM-DB/3_3/CCUUAG/
MCSYM-DB/3_3/CCUUAG/3_3-CCUUAG.mcs
MCSYM-DB/3_3/CCUUCA/
MCSYM-DB/3_3/CCUUCA/3_3-CCUUCA.mcs
MCSYM-DB/3_3/CCUUCU/
MCSYM-DB/3_3/CCUUCU/3_3-CCUUCU.mcs
MCSYM-DB/3_3/CCUUGA/
MCSYM-DB/3_3/CCUUGA/3_3-CCUUGA.mcs
MCSYM-DB/3_3/CCUUGG/
MCSYM-DB/3_3/CCUUGG/3_3-CCUUGG.mcs
MCSYM-DB/3_3/CCUUUA/
MCSYM-DB/3_3/CCUUUA/3_3-CCUUUA.mcs
MCSYM-DB/3_3/CCUUUG/
MCSYM-DB/3_3/CCUUUG/3_3-CCUUUG.mcs
MCSYM-DB/3_3/CCUUUG/ds-3_3-CCUUUG_x.pdb.gz
MCSYM-DB/3_3/CGAAGG/
MCSYM-DB/3_3/CGAAGG/3_3-CGAAGG.mcs
MCSYM-DB/3_3/CGAGAG/
MCSYM-DB/3_3/CGAGAG/3_3-CGAGAG.mcs
MCSYM-DB/3_3/CGAUAG/
MCSYM-DB/3_3/CGAUAG/3_3-CGAUAG.mcs
MCSYM-DB/3_3/CGAUAG/ds-3_3-CGAUAG_x.pdb.gz
MCSYM-DB/3_3/CGAUCG/
MCSYM-DB/3_3/CGAUCG/3_3-CGAUCG.mcs
MCSYM-DB/3_3/CGAUCG/ds-3_3-CGAUCG_x.pdb.gz
MCSYM-DB/3_3/CGAUGA/
MCSYM-DB/3_3/CGAUGA/3_3-CGAUGA.mcs
MCSYM-DB/3_3/CGAUGG/
MCSYM-DB/3_3/CGAUGG/3_3-CGAUGG.mcs
MCSYM-DB/3_3/CGAUGG/ds-3_3-CGAUGG_x.pdb.gz
MCSYM-DB/3_3/CGCAAG/
MCSYM-DB/3_3/CGCAAG/3_3-CGCAAG.mcs
MCSYM-DB/3_3/CGCACA/
MCSYM-DB/3_3/CGCACA/3_3-CGCACA.mcs
MCSYM-DB/3_3/CGCACG/
MCSYM-DB/3_3/CGCACG/3_3-CGCACG.mcs
MCSYM-DB/3_3/CGCCUG/
MCSYM-DB/3_3/CGCCUG/3_3-CGCCUG.mcs
MCSYM-DB/3_3/CGCCUG/ds-3_3-CGCCUG_x.pdb.gz
MCSYM-DB/3_3/CGCGAG/
MCSYM-DB/3_3/CGCGAG/1P5M_model_1.pdb.gz
MCSYM-DB/3_3/CGCGAG/1P5O_model_1.pdb.gz
MCSYM-DB/3_3/CGCGAG/3_3-CGCGAG.mcs
MCSYM-DB/3_3/CGCGAG/ds-3_3-CGCGAG_x.pdb.gz
MCSYM-DB/3_3/CGCGCG/
MCSYM-DB/3_3/CGCGCG/3_3-CGCGCG.mcs
MCSYM-DB/3_3/CGCGCG/ds-3_3-CGCGCG_x.pdb.gz
MCSYM-DB/3_3/CGCGGA/
MCSYM-DB/3_3/CGCGGA/3_3-CGCGGA.mcs
MCSYM-DB/3_3/CGCGGG/
MCSYM-DB/3_3/CGCGGG/3_3-CGCGGG.mcs
MCSYM-DB/3_3/CGCGGG/ds-3_3-CGCGGG_x.pdb.gz
MCSYM-DB/3_3/CGCGUG/
MCSYM-DB/3_3/CGCGUG/3_3-CGCGUG.mcs
MCSYM-DB/3_3/CGCGUG/ds-3_3-CGCGUG_x.pdb.gz
MCSYM-DB/3_3/CGCGUU/
MCSYM-DB/3_3/CGCGUU/3_3-CGCGUU.mcs
MCSYM-DB/3_3/CGGAAG/
MCSYM-DB/3_3/CGGAAG/3_3-CGGAAG.mcs
MCSYM-DB/3_3/CGGACG/
MCSYM-DB/3_3/CGGACG/3_3-CGGACG.mcs
MCSYM-DB/3_3/CGGAGG/
MCSYM-DB/3_3/CGGAGG/3_3-CGGAGG.mcs
MCSYM-DB/3_3/CGGAUG/
MCSYM-DB/3_3/CGGAUG/3_3-CGGAUG.mcs
MCSYM-DB/3_3/CGGCAA/
MCSYM-DB/3_3/CGGCAA/3_3-CGGCAA.mcs
MCSYM-DB/3_3/CGGCAA/ds-3_3-CGGCAA_x.pdb.gz
MCSYM-DB/3_3/CGGCAG/
MCSYM-DB/3_3/CGGCAG/3_3-CGGCAG.mcs
MCSYM-DB/3_3/CGGCCA/
MCSYM-DB/3_3/CGGCCA/3_3-CGGCCA.mcs
MCSYM-DB/3_3/CGGCCC/
MCSYM-DB/3_3/CGGCCC/3_3-CGGCCC.mcs
MCSYM-DB/3_3/CGGCCG/
MCSYM-DB/3_3/CGGCCG/3_3-CGGCCG.mcs
MCSYM-DB/3_3/CGGCGG/
MCSYM-DB/3_3/CGGCGG/3_3-CGGCGG.mcs
MCSYM-DB/3_3/CGGCGG/ds-3_3-CGGCGG_x.pdb.gz
MCSYM-DB/3_3/CGGCUG/
MCSYM-DB/3_3/CGGCUG/3_3-CGGCUG.mcs
MCSYM-DB/3_3/CGGCUG/ds-3_3-CGGCUG_x.pdb.gz
MCSYM-DB/3_3/CGGCUU/
MCSYM-DB/3_3/CGGCUU/3_3-CGGCUU.mcs
MCSYM-DB/3_3/CGGGAG/
MCSYM-DB/3_3/CGGGAG/3_3-CGGGAG.mcs
MCSYM-DB/3_3/CGGUAG/
MCSYM-DB/3_3/CGGUAG/3_3-CGGUAG.mcs
MCSYM-DB/3_3/CGGUAG/ds-3_3-CGGUAG_x.pdb.gz
MCSYM-DB/3_3/CGGUAU/
MCSYM-DB/3_3/CGGUAU/3_3-CGGUAU.mcs
MCSYM-DB/3_3/CGGUGG/
MCSYM-DB/3_3/CGGUGG/3_3-CGGUGG.mcs
MCSYM-DB/3_3/CGGUGG/ds-3_3-CGGUGG_x.pdb.gz
MCSYM-DB/3_3/CGGUUA/
MCSYM-DB/3_3/CGGUUA/3_3-CGGUUA.mcs
MCSYM-DB/3_3/CGGUUG/
MCSYM-DB/3_3/CGGUUG/3_3-CGGUUG.mcs
MCSYM-DB/3_3/CGUAAG/
MCSYM-DB/3_3/CGUAAG/3_3-CGUAAG.mcs
MCSYM-DB/3_3/CGUAAG/ds-3_3-CGUAAG_x.pdb.gz
MCSYM-DB/3_3/CGUACA/
MCSYM-DB/3_3/CGUACA/3_3-CGUACA.mcs
MCSYM-DB/3_3/CGUACG/
MCSYM-DB/3_3/CGUACG/3_3-CGUACG.mcs
MCSYM-DB/3_3/CGUAGA/
MCSYM-DB/3_3/CGUAGA/3_3-CGUAGA.mcs
MCSYM-DB/3_3/CGUAGG/
MCSYM-DB/3_3/CGUAGG/3_3-CGUAGG.mcs
MCSYM-DB/3_3/CGUAGG/ds-3_3-CGUAGG_x.pdb.gz
MCSYM-DB/3_3/CGUAUG/
MCSYM-DB/3_3/CGUAUG/3_3-CGUAUG.mcs
MCSYM-DB/3_3/CGUCUG/
MCSYM-DB/3_3/CGUCUG/3_3-CGUCUG.mcs
MCSYM-DB/3_3/CGUGAG/
MCSYM-DB/3_3/CGUGAG/3_3-CGUGAG.mcs
MCSYM-DB/3_3/CGUGCC/
MCSYM-DB/3_3/CGUGCC/3_3-CGUGCC.mcs
MCSYM-DB/3_3/CGUGCU/
MCSYM-DB/3_3/CGUGCU/3_3-CGUGCU.mcs
MCSYM-DB/3_3/CGUGGG/
MCSYM-DB/3_3/CGUGGG/3_3-CGUGGG.mcs
MCSYM-DB/3_3/CGUGGG/ds-3_3-CGUGGG_x.pdb.gz
MCSYM-DB/3_3/CGUUAG/
MCSYM-DB/3_3/CGUUAG/3_3-CGUUAG.mcs
MCSYM-DB/3_3/CGUUCG/
MCSYM-DB/3_3/CGUUCG/3_3-CGUUCG.mcs
MCSYM-DB/3_3/CGUUCU/
MCSYM-DB/3_3/CGUUCU/3_3-CGUUCU.mcs
MCSYM-DB/3_3/CGUUGG/
MCSYM-DB/3_3/CGUUGG/3_3-CGUUGG.mcs
MCSYM-DB/3_3/CGUUUG/
MCSYM-DB/3_3/CGUUUG/3_3-CGUUUG.mcs
MCSYM-DB/3_3/CUAAAG/
MCSYM-DB/3_3/CUAAAG/3_3-CUAAAG.mcs
MCSYM-DB/3_3/CUAAAG/ds-3_3-CUAAAG_x.pdb.gz
MCSYM-DB/3_3/CUAAUG/
MCSYM-DB/3_3/CUAAUG/3_3-CUAAUG.mcs
MCSYM-DB/3_3/CUACAG/
MCSYM-DB/3_3/CUACAG/3_3-CUACAG.mcs
MCSYM-DB/3_3/CUACCC/
MCSYM-DB/3_3/CUACCC/3_3-CUACCC.mcs
MCSYM-DB/3_3/CUACCG/
MCSYM-DB/3_3/CUACCG/3_3-CUACCG.mcs
MCSYM-DB/3_3/CUACCG/ds-3_3-CUACCG_x.pdb.gz
MCSYM-DB/3_3/CUACGG/
MCSYM-DB/3_3/CUACGG/3_3-CUACGG.mcs
MCSYM-DB/3_3/CUACGG/ds-3_3-CUACGG_x.pdb.gz
MCSYM-DB/3_3/CUAGAG/
MCSYM-DB/3_3/CUAGAG/3_3-CUAGAG.mcs
MCSYM-DB/3_3/CUAGGA/
MCSYM-DB/3_3/CUAGGA/3_3-CUAGGA.mcs
MCSYM-DB/3_3/CUAGGG/
MCSYM-DB/3_3/CUAGGG/3_3-CUAGGG.mcs
MCSYM-DB/3_3/CUAGUG/
MCSYM-DB/3_3/CUAGUG/3_3-CUAGUG.mcs
MCSYM-DB/3_3/CUAUAA/
MCSYM-DB/3_3/CUAUAA/3_3-CUAUAA.mcs
MCSYM-DB/3_3/CUAUAC/
MCSYM-DB/3_3/CUAUAC/3_3-CUAUAC.mcs
MCSYM-DB/3_3/CUAUAG/
MCSYM-DB/3_3/CUAUAG/3_3-CUAUAG.mcs
MCSYM-DB/3_3/CUAUAG/ds-3_3-CUAUAG_x.pdb.gz
MCSYM-DB/3_3/CUAUAU/
MCSYM-DB/3_3/CUAUAU/3_3-CUAUAU.mcs
MCSYM-DB/3_3/CUAUCA/
MCSYM-DB/3_3/CUAUCA/3_3-CUAUCA.mcs
MCSYM-DB/3_3/CUAUCC/
MCSYM-DB/3_3/CUAUCC/3_3-CUAUCC.mcs
MCSYM-DB/3_3/CUAUCG/
MCSYM-DB/3_3/CUAUCG/3_3-CUAUCG.mcs
MCSYM-DB/3_3/CUAUCG/ds-3_3-CUAUCG_x.pdb.gz
MCSYM-DB/3_3/CUAUCU/
MCSYM-DB/3_3/CUAUCU/3_3-CUAUCU.mcs
MCSYM-DB/3_3/CUAUGC/
MCSYM-DB/3_3/CUAUGC/3_3-CUAUGC.mcs
MCSYM-DB/3_3/CUAUGG/
MCSYM-DB/3_3/CUAUGG/3_3-CUAUGG.mcs
MCSYM-DB/3_3/CUAUGU/
MCSYM-DB/3_3/CUAUGU/3_3-CUAUGU.mcs
MCSYM-DB/3_3/CUAUUC/
MCSYM-DB/3_3/CUAUUC/3_3-CUAUUC.mcs
MCSYM-DB/3_3/CUAUUG/
MCSYM-DB/3_3/CUAUUG/3_3-CUAUUG.mcs
MCSYM-DB/3_3/CUAUUG/ds-3_3-CUAUUG_x.pdb.gz
MCSYM-DB/3_3/CUAUUU/
MCSYM-DB/3_3/CUAUUU/3_3-CUAUUU.mcs
MCSYM-DB/3_3/CUCAAA/
MCSYM-DB/3_3/CUCAAA/3_3-CUCAAA.mcs
MCSYM-DB/3_3/CUCAAG/
MCSYM-DB/3_3/CUCAAG/3_3-CUCAAG.mcs
MCSYM-DB/3_3/CUCAAU/
MCSYM-DB/3_3/CUCAAU/3_3-CUCAAU.mcs
MCSYM-DB/3_3/CUCACC/
MCSYM-DB/3_3/CUCACC/3_3-CUCACC.mcs
MCSYM-DB/3_3/CUCACU/
MCSYM-DB/3_3/CUCACU/3_3-CUCACU.mcs
MCSYM-DB/3_3/CUCAGG/
MCSYM-DB/3_3/CUCAGG/3_3-CUCAGG.mcs
MCSYM-DB/3_3/CUCAUG/
MCSYM-DB/3_3/CUCAUG/3_3-CUCAUG.mcs
MCSYM-DB/3_3/CUCCAG/
MCSYM-DB/3_3/CUCCAG/3_3-CUCCAG.mcs
MCSYM-DB/3_3/CUCCCG/
MCSYM-DB/3_3/CUCCCG/3_3-CUCCCG.mcs
MCSYM-DB/3_3/CUCCUA/
MCSYM-DB/3_3/CUCCUA/3_3-CUCCUA.mcs
MCSYM-DB/3_3/CUCCUC/
MCSYM-DB/3_3/CUCCUC/3_3-CUCCUC.mcs
MCSYM-DB/3_3/CUCCUG/
MCSYM-DB/3_3/CUCCUG/3_3-CUCCUG.mcs
MCSYM-DB/3_3/CUCCUG/ds-3_3-CUCCUG_x.pdb.gz
MCSYM-DB/3_3/CUCGAA/
MCSYM-DB/3_3/CUCGAA/3_3-CUCGAA.mcs
MCSYM-DB/3_3/CUCGAC/
MCSYM-DB/3_3/CUCGAC/3_3-CUCGAC.mcs
MCSYM-DB/3_3/CUCGAG/
MCSYM-DB/3_3/CUCGAG/3_3-CUCGAG.mcs
MCSYM-DB/3_3/CUCGAU/
MCSYM-DB/3_3/CUCGAU/3_3-CUCGAU.mcs
MCSYM-DB/3_3/CUCGCA/
MCSYM-DB/3_3/CUCGCA/3_3-CUCGCA.mcs
MCSYM-DB/3_3/CUCGCG/
MCSYM-DB/3_3/CUCGCG/3_3-CUCGCG.mcs
MCSYM-DB/3_3/CUCGCG/ds-3_3-CUCGCG_x.pdb.gz
MCSYM-DB/3_3/CUCGCU/
MCSYM-DB/3_3/CUCGCU/3_3-CUCGCU.mcs
MCSYM-DB/3_3/CUCGGC/
MCSYM-DB/3_3/CUCGGC/3_3-CUCGGC.mcs
MCSYM-DB/3_3/CUCGGG/
MCSYM-DB/3_3/CUCGGG/3_3-CUCGGG.mcs
MCSYM-DB/3_3/CUCGGG/ds-3_3-CUCGGG_x.pdb.gz
MCSYM-DB/3_3/CUCGUC/
MCSYM-DB/3_3/CUCGUC/3_3-CUCGUC.mcs
MCSYM-DB/3_3/CUCGUG/
MCSYM-DB/3_3/CUCGUG/3_3-CUCGUG.mcs
MCSYM-DB/3_3/CUCGUG/ds-3_3-CUCGUG_x.pdb.gz
MCSYM-DB/3_3/CUCUAG/
MCSYM-DB/3_3/CUCUAG/3_3-CUCUAG.mcs
MCSYM-DB/3_3/CUCUCU/
MCSYM-DB/3_3/CUCUCU/3_3-CUCUCU.mcs
MCSYM-DB/3_3/CUCUGG/
MCSYM-DB/3_3/CUCUGG/3_3-CUCUGG.mcs
MCSYM-DB/3_3/CUGAAA/
MCSYM-DB/3_3/CUGAAA/3_3-CUGAAA.mcs
MCSYM-DB/3_3/CUGAAC/
MCSYM-DB/3_3/CUGAAC/3_3-CUGAAC.mcs
MCSYM-DB/3_3/CUGAAG/
MCSYM-DB/3_3/CUGAAG/3_3-CUGAAG.mcs
MCSYM-DB/3_3/CUGAAU/
MCSYM-DB/3_3/CUGAAU/3_3-CUGAAU.mcs
MCSYM-DB/3_3/CUGACA/
MCSYM-DB/3_3/CUGACA/3_3-CUGACA.mcs
MCSYM-DB/3_3/CUGACC/
MCSYM-DB/3_3/CUGACC/3_3-CUGACC.mcs
MCSYM-DB/3_3/CUGAGA/
MCSYM-DB/3_3/CUGAGA/3_3-CUGAGA.mcs
MCSYM-DB/3_3/CUGAGG/
MCSYM-DB/3_3/CUGAGG/3_3-CUGAGG.mcs
MCSYM-DB/3_3/CUGAUG/
MCSYM-DB/3_3/CUGAUG/3_3-CUGAUG.mcs
MCSYM-DB/3_3/CUGAUG/ds-3_3-CUGAUG_x.pdb.gz
MCSYM-DB/3_3/CUGAUU/
MCSYM-DB/3_3/CUGAUU/3_3-CUGAUU.mcs
MCSYM-DB/3_3/CUGCAA/
MCSYM-DB/3_3/CUGCAA/3_3-CUGCAA.mcs
MCSYM-DB/3_3/CUGCAC/
MCSYM-DB/3_3/CUGCAC/3_3-CUGCAC.mcs
MCSYM-DB/3_3/CUGCAG/
MCSYM-DB/3_3/CUGCAG/3_3-CUGCAG.mcs
MCSYM-DB/3_3/CUGCCA/
MCSYM-DB/3_3/CUGCCA/3_3-CUGCCA.mcs
MCSYM-DB/3_3/CUGCCC/
MCSYM-DB/3_3/CUGCCC/3_3-CUGCCC.mcs
MCSYM-DB/3_3/CUGCCG/
MCSYM-DB/3_3/CUGCCG/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/CUGCCG/3_3-CUGCCG.mcs
MCSYM-DB/3_3/CUGCCG/ds-3_3-CUGCCG_x.pdb.gz
MCSYM-DB/3_3/CUGCGC/
MCSYM-DB/3_3/CUGCGC/3_3-CUGCGC.mcs
MCSYM-DB/3_3/CUGCGG/
MCSYM-DB/3_3/CUGCGG/3_3-CUGCGG.mcs
MCSYM-DB/3_3/CUGCUC/
MCSYM-DB/3_3/CUGCUC/3_3-CUGCUC.mcs
MCSYM-DB/3_3/CUGCUC/ds-3_3-CUGCUC_x.pdb.gz
MCSYM-DB/3_3/CUGCUG/
MCSYM-DB/3_3/CUGCUG/1YTY_model_1.pdb.gz
MCSYM-DB/3_3/CUGCUG/1ZEV_model_1.pdb.gz
MCSYM-DB/3_3/CUGCUG/3_3-CUGCUG.mcs
MCSYM-DB/3_3/CUGCUG/ds-3_3-CUGCUG_x.pdb.gz
MCSYM-DB/3_3/CUGCUU/
MCSYM-DB/3_3/CUGCUU/3_3-CUGCUU.mcs
MCSYM-DB/3_3/CUGGAG/
MCSYM-DB/3_3/CUGGAG/3_3-CUGGAG.mcs
MCSYM-DB/3_3/CUGGCC/
MCSYM-DB/3_3/CUGGCC/3_3-CUGGCC.mcs
MCSYM-DB/3_3/CUGGGG/
MCSYM-DB/3_3/CUGGGG/3_3-CUGGGG.mcs
MCSYM-DB/3_3/CUGGUG/
MCSYM-DB/3_3/CUGGUG/3_3-CUGGUG.mcs
MCSYM-DB/3_3/CUGUAC/
MCSYM-DB/3_3/CUGUAC/3_3-CUGUAC.mcs
MCSYM-DB/3_3/CUGUAG/
MCSYM-DB/3_3/CUGUAG/3_3-CUGUAG.mcs
MCSYM-DB/3_3/CUGUCA/
MCSYM-DB/3_3/CUGUCA/3_3-CUGUCA.mcs
MCSYM-DB/3_3/CUGUCG/
MCSYM-DB/3_3/CUGUCG/3_3-CUGUCG.mcs
MCSYM-DB/3_3/CUGUCG/ds-3_3-CUGUCG_x.pdb.gz
MCSYM-DB/3_3/CUGUCU/
MCSYM-DB/3_3/CUGUCU/3_3-CUGUCU.mcs
MCSYM-DB/3_3/CUGUGA/
MCSYM-DB/3_3/CUGUGA/3_3-CUGUGA.mcs
MCSYM-DB/3_3/CUGUGG/
MCSYM-DB/3_3/CUGUGG/3_3-CUGUGG.mcs
MCSYM-DB/3_3/CUGUGG/ds-3_3-CUGUGG_x.pdb.gz
MCSYM-DB/3_3/CUGUUC/
MCSYM-DB/3_3/CUGUUC/3_3-CUGUUC.mcs
MCSYM-DB/3_3/CUGUUG/
MCSYM-DB/3_3/CUGUUG/3_3-CUGUUG.mcs
MCSYM-DB/3_3/CUGUUG/ds-3_3-CUGUUG_x.pdb.gz
MCSYM-DB/3_3/CUGUUU/
MCSYM-DB/3_3/CUGUUU/3_3-CUGUUU.mcs
MCSYM-DB/3_3/CUUAAA/
MCSYM-DB/3_3/CUUAAA/3_3-CUUAAA.mcs
MCSYM-DB/3_3/CUUAAA/ds-3_3-CUUAAA_x.pdb.gz
MCSYM-DB/3_3/CUUAAG/
MCSYM-DB/3_3/CUUAAG/3_3-CUUAAG.mcs
MCSYM-DB/3_3/CUUAAG/ds-3_3-CUUAAG_x.pdb.gz
MCSYM-DB/3_3/CUUACA/
MCSYM-DB/3_3/CUUACA/3_3-CUUACA.mcs
MCSYM-DB/3_3/CUUACC/
MCSYM-DB/3_3/CUUACC/3_3-CUUACC.mcs
MCSYM-DB/3_3/CUUACG/
MCSYM-DB/3_3/CUUACG/3_3-CUUACG.mcs
MCSYM-DB/3_3/CUUACG/ds-3_3-CUUACG_x.pdb.gz
MCSYM-DB/3_3/CUUACU/
MCSYM-DB/3_3/CUUACU/3_3-CUUACU.mcs
MCSYM-DB/3_3/CUUAGA/
MCSYM-DB/3_3/CUUAGA/3_3-CUUAGA.mcs
MCSYM-DB/3_3/CUUAGG/
MCSYM-DB/3_3/CUUAGG/3_3-CUUAGG.mcs
MCSYM-DB/3_3/CUUAGG/ds-3_3-CUUAGG_x.pdb.gz
MCSYM-DB/3_3/CUUAGU/
MCSYM-DB/3_3/CUUAGU/3_3-CUUAGU.mcs
MCSYM-DB/3_3/CUUAUA/
MCSYM-DB/3_3/CUUAUA/3_3-CUUAUA.mcs
MCSYM-DB/3_3/CUUAUG/
MCSYM-DB/3_3/CUUAUG/3_3-CUUAUG.mcs
MCSYM-DB/3_3/CUUAUG/ds-3_3-CUUAUG_x.pdb.gz
MCSYM-DB/3_3/CUUAUU/
MCSYM-DB/3_3/CUUAUU/3_3-CUUAUU.mcs
MCSYM-DB/3_3/CUUCAG/
MCSYM-DB/3_3/CUUCAG/3_3-CUUCAG.mcs
MCSYM-DB/3_3/CUUCCG/
MCSYM-DB/3_3/CUUCCG/3_3-CUUCCG.mcs
MCSYM-DB/3_3/CUUCCU/
MCSYM-DB/3_3/CUUCCU/3_3-CUUCCU.mcs
MCSYM-DB/3_3/CUUCUG/
MCSYM-DB/3_3/CUUCUG/3_3-CUUCUG.mcs
MCSYM-DB/3_3/CUUGAA/
MCSYM-DB/3_3/CUUGAA/3_3-CUUGAA.mcs
MCSYM-DB/3_3/CUUGAC/
MCSYM-DB/3_3/CUUGAC/3_3-CUUGAC.mcs
MCSYM-DB/3_3/CUUGAG/
MCSYM-DB/3_3/CUUGAG/3_3-CUUGAG.mcs
MCSYM-DB/3_3/CUUGAG/ds-3_3-CUUGAG_x.pdb.gz
MCSYM-DB/3_3/CUUGCG/
MCSYM-DB/3_3/CUUGCG/3_3-CUUGCG.mcs
MCSYM-DB/3_3/CUUGGG/
MCSYM-DB/3_3/CUUGGG/3_3-CUUGGG.mcs
MCSYM-DB/3_3/CUUGGG/ds-3_3-CUUGGG_x.pdb.gz
MCSYM-DB/3_3/CUUGUG/
MCSYM-DB/3_3/CUUGUG/3_3-CUUGUG.mcs
MCSYM-DB/3_3/CUUGUG/ds-3_3-CUUGUG_x.pdb.gz
MCSYM-DB/3_3/CUUUAG/
MCSYM-DB/3_3/CUUUAG/3_3-CUUUAG.mcs
MCSYM-DB/3_3/CUUUCA/
MCSYM-DB/3_3/CUUUCA/3_3-CUUUCA.mcs
MCSYM-DB/3_3/CUUUCG/
MCSYM-DB/3_3/CUUUCG/3_3-CUUUCG.mcs
MCSYM-DB/3_3/CUUUCG/ds-3_3-CUUUCG_x.pdb.gz
MCSYM-DB/3_3/CUUUCU/
MCSYM-DB/3_3/CUUUCU/3_3-CUUUCU.mcs
MCSYM-DB/3_3/CUUUGA/
MCSYM-DB/3_3/CUUUGA/3_3-CUUUGA.mcs
MCSYM-DB/3_3/CUUUGG/
MCSYM-DB/3_3/CUUUGG/3_3-CUUUGG.mcs
MCSYM-DB/3_3/CUUUUA/
MCSYM-DB/3_3/CUUUUA/3_3-CUUUUA.mcs
MCSYM-DB/3_3/CUUUUC/
MCSYM-DB/3_3/CUUUUC/3_3-CUUUUC.mcs
MCSYM-DB/3_3/CUUUUG/
MCSYM-DB/3_3/CUUUUG/3_3-CUUUUG.mcs
MCSYM-DB/3_3/CUUUUG/ds-3_3-CUUUUG_x.pdb.gz
MCSYM-DB/3_3/GAAAAA/
MCSYM-DB/3_3/GAAAAA/3_3-GAAAAA.mcs
MCSYM-DB/3_3/GAAAAA/ds-3_3-GAAAAA_x.pdb.gz
MCSYM-DB/3_3/GAAAAC/
MCSYM-DB/3_3/GAAAAC/3_3-GAAAAC.mcs
MCSYM-DB/3_3/GAAACC/
MCSYM-DB/3_3/GAAACC/3_3-GAAACC.mcs
MCSYM-DB/3_3/GAAACC/ds-3_3-GAAACC_x.pdb.gz
MCSYM-DB/3_3/GAAAGA/
MCSYM-DB/3_3/GAAAGA/3_3-GAAAGA.mcs
MCSYM-DB/3_3/GAAAGA/ds-3_3-GAAAGA_x.pdb.gz
MCSYM-DB/3_3/GAAAGC/
MCSYM-DB/3_3/GAAAGC/3_3-GAAAGC.mcs
MCSYM-DB/3_3/GAAAGG/
MCSYM-DB/3_3/GAAAGG/3_3-GAAAGG.mcs
MCSYM-DB/3_3/GAAAGG/ds-3_3-GAAAGG_x.pdb.gz
MCSYM-DB/3_3/GAACAC/
MCSYM-DB/3_3/GAACAC/3_3-GAACAC.mcs
MCSYM-DB/3_3/GAACCC/
MCSYM-DB/3_3/GAACCC/3_3-GAACCC.mcs
MCSYM-DB/3_3/GAACUA/
MCSYM-DB/3_3/GAACUA/3_3-GAACUA.mcs
MCSYM-DB/3_3/GAACUC/
MCSYM-DB/3_3/GAACUC/3_3-GAACUC.mcs
MCSYM-DB/3_3/GAAGAA/
MCSYM-DB/3_3/GAAGAA/3_3-GAAGAA.mcs
MCSYM-DB/3_3/GAAGAA/ds-3_3-GAAGAA_x.pdb.gz
MCSYM-DB/3_3/GAAGAC/
MCSYM-DB/3_3/GAAGAC/3_3-GAAGAC.mcs
MCSYM-DB/3_3/GAAGAG/
MCSYM-DB/3_3/GAAGAG/3_3-GAAGAG.mcs
MCSYM-DB/3_3/GAAGAG/ds-3_3-GAAGAG_x.pdb.gz
MCSYM-DB/3_3/GAAGCA/
MCSYM-DB/3_3/GAAGCA/3_3-GAAGCA.mcs
MCSYM-DB/3_3/GAAGCC/
MCSYM-DB/3_3/GAAGCC/3_3-GAAGCC.mcs
MCSYM-DB/3_3/GAAGGA/
MCSYM-DB/3_3/GAAGGA/3_3-GAAGGA.mcs
MCSYM-DB/3_3/GAAGGA/ds-3_3-GAAGGA_x.pdb.gz
MCSYM-DB/3_3/GAAGGC/
MCSYM-DB/3_3/GAAGGC/3_3-GAAGGC.mcs
MCSYM-DB/3_3/GAAGGU/
MCSYM-DB/3_3/GAAGGU/3_3-GAAGGU.mcs
MCSYM-DB/3_3/GAAUAA/
MCSYM-DB/3_3/GAAUAA/3_3-GAAUAA.mcs
MCSYM-DB/3_3/GAAUAC/
MCSYM-DB/3_3/GAAUAC/3_3-GAAUAC.mcs
MCSYM-DB/3_3/GAAUAC/ds-3_3-GAAUAC_x.pdb.gz
MCSYM-DB/3_3/GAAUAU/
MCSYM-DB/3_3/GAAUAU/3_3-GAAUAU.mcs
MCSYM-DB/3_3/GAAUCA/
MCSYM-DB/3_3/GAAUCA/3_3-GAAUCA.mcs
MCSYM-DB/3_3/GAAUCC/
MCSYM-DB/3_3/GAAUCC/3_3-GAAUCC.mcs
MCSYM-DB/3_3/GAAUCC/ds-3_3-GAAUCC_x.pdb.gz
MCSYM-DB/3_3/GAAUCU/
MCSYM-DB/3_3/GAAUCU/3_3-GAAUCU.mcs
MCSYM-DB/3_3/GAAUCU/ds-3_3-GAAUCU_x.pdb.gz
MCSYM-DB/3_3/GAAUGA/
MCSYM-DB/3_3/GAAUGA/3_3-GAAUGA.mcs
MCSYM-DB/3_3/GAAUGC/
MCSYM-DB/3_3/GAAUGC/3_3-GAAUGC.mcs
MCSYM-DB/3_3/GAAUGC/ds-3_3-GAAUGC_x.pdb.gz
MCSYM-DB/3_3/GAAUGU/
MCSYM-DB/3_3/GAAUGU/3_3-GAAUGU.mcs
MCSYM-DB/3_3/GAAUGU/ds-3_3-GAAUGU_x.pdb.gz
MCSYM-DB/3_3/GAAUUC/
MCSYM-DB/3_3/GAAUUC/3_3-GAAUUC.mcs
MCSYM-DB/3_3/GAAUUG/
MCSYM-DB/3_3/GAAUUG/3_3-GAAUUG.mcs
MCSYM-DB/3_3/GAAUUU/
MCSYM-DB/3_3/GAAUUU/3_3-GAAUUU.mcs
MCSYM-DB/3_3/GAAUUU/ds-3_3-GAAUUU_x.pdb.gz
MCSYM-DB/3_3/GACAAG/
MCSYM-DB/3_3/GACAAG/3_3-GACAAG.mcs
MCSYM-DB/3_3/GACACC/
MCSYM-DB/3_3/GACACC/3_3-GACACC.mcs
MCSYM-DB/3_3/GACACC/ds-3_3-GACACC_x.pdb.gz
MCSYM-DB/3_3/GACAGC/
MCSYM-DB/3_3/GACAGC/3_3-GACAGC.mcs
MCSYM-DB/3_3/GACAUC/
MCSYM-DB/3_3/GACAUC/3_3-GACAUC.mcs
MCSYM-DB/3_3/GACCUC/
MCSYM-DB/3_3/GACCUC/3_3-GACCUC.mcs
MCSYM-DB/3_3/GACGAC/
MCSYM-DB/3_3/GACGAC/3_3-GACGAC.mcs
MCSYM-DB/3_3/GACGAC/ds-3_3-GACGAC_x.pdb.gz
MCSYM-DB/3_3/GACGAU/
MCSYM-DB/3_3/GACGAU/3_3-GACGAU.mcs
MCSYM-DB/3_3/GACGCA/
MCSYM-DB/3_3/GACGCA/3_3-GACGCA.mcs
MCSYM-DB/3_3/GACGCC/
MCSYM-DB/3_3/GACGCC/3_3-GACGCC.mcs
MCSYM-DB/3_3/GACGCC/ds-3_3-GACGCC_x.pdb.gz
MCSYM-DB/3_3/GACGCU/
MCSYM-DB/3_3/GACGCU/3_3-GACGCU.mcs
MCSYM-DB/3_3/GACGGA/
MCSYM-DB/3_3/GACGGA/3_3-GACGGA.mcs
MCSYM-DB/3_3/GACGGC/
MCSYM-DB/3_3/GACGGC/3_3-GACGGC.mcs
MCSYM-DB/3_3/GACGGC/ds-3_3-GACGGC_x.pdb.gz
MCSYM-DB/3_3/GACGGU/
MCSYM-DB/3_3/GACGGU/3_3-GACGGU.mcs
MCSYM-DB/3_3/GACGUC/
MCSYM-DB/3_3/GACGUC/3_3-GACGUC.mcs
MCSYM-DB/3_3/GACGUC/ds-3_3-GACGUC_x.pdb.gz
MCSYM-DB/3_3/GACGUG/
MCSYM-DB/3_3/GACGUG/3_3-GACGUG.mcs
MCSYM-DB/3_3/GACGUU/
MCSYM-DB/3_3/GACGUU/3_3-GACGUU.mcs
MCSYM-DB/3_3/GACUCC/
MCSYM-DB/3_3/GACUCC/3_3-GACUCC.mcs
MCSYM-DB/3_3/GACUCU/
MCSYM-DB/3_3/GACUCU/3_3-GACUCU.mcs
MCSYM-DB/3_3/GACUGC/
MCSYM-DB/3_3/GACUGC/3_3-GACUGC.mcs
MCSYM-DB/3_3/GACUUC/
MCSYM-DB/3_3/GACUUC/3_3-GACUUC.mcs
MCSYM-DB/3_3/GAGAAA/
MCSYM-DB/3_3/GAGAAA/3_3-GAGAAA.mcs
MCSYM-DB/3_3/GAGAAA/ds-3_3-GAGAAA_x.pdb.gz
MCSYM-DB/3_3/GAGAAC/
MCSYM-DB/3_3/GAGAAC/3_3-GAGAAC.mcs
MCSYM-DB/3_3/GAGAAC/ds-3_3-GAGAAC_x.pdb.gz
MCSYM-DB/3_3/GAGAAU/
MCSYM-DB/3_3/GAGAAU/3_3-GAGAAU.mcs
MCSYM-DB/3_3/GAGAAU/ds-3_3-GAGAAU_x.pdb.gz
MCSYM-DB/3_3/GAGACC/
MCSYM-DB/3_3/GAGACC/3_3-GAGACC.mcs
MCSYM-DB/3_3/GAGAGA/
MCSYM-DB/3_3/GAGAGA/3_3-GAGAGA.mcs
MCSYM-DB/3_3/GAGAGC/
MCSYM-DB/3_3/GAGAGC/3_3-GAGAGC.mcs
MCSYM-DB/3_3/GAGAUA/
MCSYM-DB/3_3/GAGAUA/3_3-GAGAUA.mcs
MCSYM-DB/3_3/GAGAUC/
MCSYM-DB/3_3/GAGAUC/3_3-GAGAUC.mcs
MCSYM-DB/3_3/GAGAUC/ds-3_3-GAGAUC_x.pdb.gz
MCSYM-DB/3_3/GAGCAA/
MCSYM-DB/3_3/GAGCAA/3_3-GAGCAA.mcs
MCSYM-DB/3_3/GAGCAA/ds-3_3-GAGCAA_x.pdb.gz
MCSYM-DB/3_3/GAGCAC/
MCSYM-DB/3_3/GAGCAC/3_3-GAGCAC.mcs
MCSYM-DB/3_3/GAGCAC/ds-3_3-GAGCAC_x.pdb.gz
MCSYM-DB/3_3/GAGCAG/
MCSYM-DB/3_3/GAGCAG/3_3-GAGCAG.mcs
MCSYM-DB/3_3/GAGCAU/
MCSYM-DB/3_3/GAGCAU/3_3-GAGCAU.mcs
MCSYM-DB/3_3/GAGCAU/ds-3_3-GAGCAU_x.pdb.gz
MCSYM-DB/3_3/GAGCCA/
MCSYM-DB/3_3/GAGCCA/3_3-GAGCCA.mcs
MCSYM-DB/3_3/GAGCCC/
MCSYM-DB/3_3/GAGCCC/3_3-GAGCCC.mcs
MCSYM-DB/3_3/GAGCCC/ds-3_3-GAGCCC_x.pdb.gz
MCSYM-DB/3_3/GAGCCU/
MCSYM-DB/3_3/GAGCCU/3_3-GAGCCU.mcs
MCSYM-DB/3_3/GAGCGA/
MCSYM-DB/3_3/GAGCGA/3_3-GAGCGA.mcs
MCSYM-DB/3_3/GAGCGA/ds-3_3-GAGCGA_x.pdb.gz
MCSYM-DB/3_3/GAGCGC/
MCSYM-DB/3_3/GAGCGC/3_3-GAGCGC.mcs
MCSYM-DB/3_3/GAGCGU/
MCSYM-DB/3_3/GAGCGU/3_3-GAGCGU.mcs
MCSYM-DB/3_3/GAGCGU/ds-3_3-GAGCGU_x.pdb.gz
MCSYM-DB/3_3/GAGCUA/
MCSYM-DB/3_3/GAGCUA/3_3-GAGCUA.mcs
MCSYM-DB/3_3/GAGCUC/
MCSYM-DB/3_3/GAGCUC/3_3-GAGCUC.mcs
MCSYM-DB/3_3/GAGCUC/ds-3_3-GAGCUC_x.pdb.gz
MCSYM-DB/3_3/GAGCUG/
MCSYM-DB/3_3/GAGCUG/3_3-GAGCUG.mcs
MCSYM-DB/3_3/GAGCUU/
MCSYM-DB/3_3/GAGCUU/3_3-GAGCUU.mcs
MCSYM-DB/3_3/GAGCUU/ds-3_3-GAGCUU_x.pdb.gz
MCSYM-DB/3_3/GAGGAG/
MCSYM-DB/3_3/GAGGAG/3_3-GAGGAG.mcs
MCSYM-DB/3_3/GAGGAG/ds-3_3-GAGGAG_x.pdb.gz
MCSYM-DB/3_3/GAGGCA/
MCSYM-DB/3_3/GAGGCA/3_3-GAGGCA.mcs
MCSYM-DB/3_3/GAGGCC/
MCSYM-DB/3_3/GAGGCC/3_3-GAGGCC.mcs
MCSYM-DB/3_3/GAGGGC/
MCSYM-DB/3_3/GAGGGC/3_3-GAGGGC.mcs
MCSYM-DB/3_3/GAGGUC/
MCSYM-DB/3_3/GAGGUC/3_3-GAGGUC.mcs
MCSYM-DB/3_3/GAGUAA/
MCSYM-DB/3_3/GAGUAA/3_3-GAGUAA.mcs
MCSYM-DB/3_3/GAGUAA/ds-3_3-GAGUAA_x.pdb.gz
MCSYM-DB/3_3/GAGUAC/
MCSYM-DB/3_3/GAGUAC/3_3-GAGUAC.mcs
MCSYM-DB/3_3/GAGUAC/ds-3_3-GAGUAC_x.pdb.gz
MCSYM-DB/3_3/GAGUCC/
MCSYM-DB/3_3/GAGUCC/3_3-GAGUCC.mcs
MCSYM-DB/3_3/GAGUCC/ds-3_3-GAGUCC_x.pdb.gz
MCSYM-DB/3_3/GAGUGA/
MCSYM-DB/3_3/GAGUGA/3_3-GAGUGA.mcs
MCSYM-DB/3_3/GAGUGC/
MCSYM-DB/3_3/GAGUGC/3_3-GAGUGC.mcs
MCSYM-DB/3_3/GAGUGC/ds-3_3-GAGUGC_x.pdb.gz
MCSYM-DB/3_3/GAGUGU/
MCSYM-DB/3_3/GAGUGU/3_3-GAGUGU.mcs
MCSYM-DB/3_3/GAGUGU/ds-3_3-GAGUGU_x.pdb.gz
MCSYM-DB/3_3/GAGUUA/
MCSYM-DB/3_3/GAGUUA/3_3-GAGUUA.mcs
MCSYM-DB/3_3/GAGUUC/
MCSYM-DB/3_3/GAGUUC/3_3-GAGUUC.mcs
MCSYM-DB/3_3/GAGUUU/
MCSYM-DB/3_3/GAGUUU/3_3-GAGUUU.mcs
MCSYM-DB/3_3/GAUAAA/
MCSYM-DB/3_3/GAUAAA/3_3-GAUAAA.mcs
MCSYM-DB/3_3/GAUAAC/
MCSYM-DB/3_3/GAUAAC/3_3-GAUAAC.mcs
MCSYM-DB/3_3/GAUAAC/ds-3_3-GAUAAC_x.pdb.gz
MCSYM-DB/3_3/GAUAAG/
MCSYM-DB/3_3/GAUAAG/3_3-GAUAAG.mcs
MCSYM-DB/3_3/GAUAAG/ds-3_3-GAUAAG_x.pdb.gz
MCSYM-DB/3_3/GAUAAU/
MCSYM-DB/3_3/GAUAAU/3_3-GAUAAU.mcs
MCSYM-DB/3_3/GAUACA/
MCSYM-DB/3_3/GAUACA/3_3-GAUACA.mcs
MCSYM-DB/3_3/GAUACC/
MCSYM-DB/3_3/GAUACC/3_3-GAUACC.mcs
MCSYM-DB/3_3/GAUACC/ds-3_3-GAUACC_x.pdb.gz
MCSYM-DB/3_3/GAUACU/
MCSYM-DB/3_3/GAUACU/3_3-GAUACU.mcs
MCSYM-DB/3_3/GAUAGA/
MCSYM-DB/3_3/GAUAGA/3_3-GAUAGA.mcs
MCSYM-DB/3_3/GAUAGC/
MCSYM-DB/3_3/GAUAGC/3_3-GAUAGC.mcs
MCSYM-DB/3_3/GAUAGC/ds-3_3-GAUAGC_x.pdb.gz
MCSYM-DB/3_3/GAUAGG/
MCSYM-DB/3_3/GAUAGG/3_3-GAUAGG.mcs
MCSYM-DB/3_3/GAUAGU/
MCSYM-DB/3_3/GAUAGU/3_3-GAUAGU.mcs
MCSYM-DB/3_3/GAUAUC/
MCSYM-DB/3_3/GAUAUC/3_3-GAUAUC.mcs
MCSYM-DB/3_3/GAUAUC/ds-3_3-GAUAUC_x.pdb.gz
MCSYM-DB/3_3/GAUAUU/
MCSYM-DB/3_3/GAUAUU/3_3-GAUAUU.mcs
MCSYM-DB/3_3/GAUCAC/
MCSYM-DB/3_3/GAUCAC/3_3-GAUCAC.mcs
MCSYM-DB/3_3/GAUCCA/
MCSYM-DB/3_3/GAUCCA/3_3-GAUCCA.mcs
MCSYM-DB/3_3/GAUCCC/
MCSYM-DB/3_3/GAUCCC/3_3-GAUCCC.mcs
MCSYM-DB/3_3/GAUCCU/
MCSYM-DB/3_3/GAUCCU/3_3-GAUCCU.mcs
MCSYM-DB/3_3/GAUCCU/ds-3_3-GAUCCU_x.pdb.gz
MCSYM-DB/3_3/GAUCUA/
MCSYM-DB/3_3/GAUCUA/3_3-GAUCUA.mcs
MCSYM-DB/3_3/GAUCUC/
MCSYM-DB/3_3/GAUCUC/3_3-GAUCUC.mcs
MCSYM-DB/3_3/GAUGAA/
MCSYM-DB/3_3/GAUGAA/3_3-GAUGAA.mcs
MCSYM-DB/3_3/GAUGAC/
MCSYM-DB/3_3/GAUGAC/3_3-GAUGAC.mcs
MCSYM-DB/3_3/GAUGAC/ds-3_3-GAUGAC_x.pdb.gz
MCSYM-DB/3_3/GAUGC/
MCSYM-DB/3_3/GAUGCC/
MCSYM-DB/3_3/GAUGCC/3_3-GAUGCC.mcs
MCSYM-DB/3_3/GAUGCC/ds-3_3-GAUGCC_x.pdb.gz
MCSYM-DB/3_3/GAUGCU/
MCSYM-DB/3_3/GAUGCU/3_3-GAUGCU.mcs
MCSYM-DB/3_3/GAUGCU/ds-3_3-GAUGCU_x.pdb.gz
MCSYM-DB/3_3/GAUGGA/
MCSYM-DB/3_3/GAUGGA/3_3-GAUGGA.mcs
MCSYM-DB/3_3/GAUGGA/ds-3_3-GAUGGA_x.pdb.gz
MCSYM-DB/3_3/GAUGGU/
MCSYM-DB/3_3/GAUGGU/3_3-GAUGGU.mcs
MCSYM-DB/3_3/GAUGUC/
MCSYM-DB/3_3/GAUGUC/3_3-GAUGUC.mcs
MCSYM-DB/3_3/GAUGUU/
MCSYM-DB/3_3/GAUGUU/3_3-GAUGUU.mcs
MCSYM-DB/3_3/GAUUCC/
MCSYM-DB/3_3/GAUUCC/3_3-GAUUCC.mcs
MCSYM-DB/3_3/GAUUCU/
MCSYM-DB/3_3/GAUUCU/3_3-GAUUCU.mcs
MCSYM-DB/3_3/GAUUGA/
MCSYM-DB/3_3/GAUUGA/3_3-GAUUGA.mcs
MCSYM-DB/3_3/GAUUUC/
MCSYM-DB/3_3/GAUUUC/3_3-GAUUUC.mcs
MCSYM-DB/3_3/GAUUUG/
MCSYM-DB/3_3/GAUUUG/3_3-GAUUUG.mcs
MCSYM-DB/3_3/GAUUUG/ds-3_3-GAUUUG_x.pdb.gz
MCSYM-DB/3_3/GAUUUU/
MCSYM-DB/3_3/GAUUUU/3_3-GAUUUU.mcs
MCSYM-DB/3_3/GCAAAC/
MCSYM-DB/3_3/GCAAAC/3_3-GCAAAC.mcs
MCSYM-DB/3_3/GCAACC/
MCSYM-DB/3_3/GCAACC/3_3-GCAACC.mcs
MCSYM-DB/3_3/GCAACC/ds-3_3-GCAACC_x.pdb.gz
MCSYM-DB/3_3/GCAAGC/
MCSYM-DB/3_3/GCAAGC/3_3-GCAAGC.mcs
MCSYM-DB/3_3/GCAAUC/
MCSYM-DB/3_3/GCAAUC/3_3-GCAAUC.mcs
MCSYM-DB/3_3/GCAAUC/ds-3_3-GCAAUC_x.pdb.gz
MCSYM-DB/3_3/GCACAC/
MCSYM-DB/3_3/GCACAC/3_3-GCACAC.mcs
MCSYM-DB/3_3/GCACAC/ds-3_3-GCACAC_x.pdb.gz
MCSYM-DB/3_3/GCACAU/
MCSYM-DB/3_3/GCACAU/3_3-GCACAU.mcs
MCSYM-DB/3_3/GCACCA/
MCSYM-DB/3_3/GCACCA/3_3-GCACCA.mcs
MCSYM-DB/3_3/GCACCC/
MCSYM-DB/3_3/GCACCC/3_3-GCACCC.mcs
MCSYM-DB/3_3/GCACCC/ds-3_3-GCACCC_x.pdb.gz
MCSYM-DB/3_3/GCACUC/
MCSYM-DB/3_3/GCACUC/3_3-GCACUC.mcs
MCSYM-DB/3_3/GCACUU/
MCSYM-DB/3_3/GCACUU/3_3-GCACUU.mcs
MCSYM-DB/3_3/GCACUU/ds-3_3-GCACUU_x.pdb.gz
MCSYM-DB/3_3/GCAGAC/
MCSYM-DB/3_3/GCAGAC/3_3-GCAGAC.mcs
MCSYM-DB/3_3/GCAGAC/ds-3_3-GCAGAC_x.pdb.gz
MCSYM-DB/3_3/GCAGCC/
MCSYM-DB/3_3/GCAGCC/3_3-GCAGCC.mcs
MCSYM-DB/3_3/GCAGCC/ds-3_3-GCAGCC_x.pdb.gz
MCSYM-DB/3_3/GCAGGC/
MCSYM-DB/3_3/GCAGGC/3_3-GCAGGC.mcs
MCSYM-DB/3_3/GCAGUC/
MCSYM-DB/3_3/GCAGUC/3_3-GCAGUC.mcs
MCSYM-DB/3_3/GCAGUC/ds-3_3-GCAGUC_x.pdb.gz
MCSYM-DB/3_3/GCAUAC/
MCSYM-DB/3_3/GCAUAC/3_3-GCAUAC.mcs
MCSYM-DB/3_3/GCAUAC/ds-3_3-GCAUAC_x.pdb.gz
MCSYM-DB/3_3/GCAUAU/
MCSYM-DB/3_3/GCAUAU/3_3-GCAUAU.mcs
MCSYM-DB/3_3/GCAUAU/ds-3_3-GCAUAU_x.pdb.gz
MCSYM-DB/3_3/GCAUCA/
MCSYM-DB/3_3/GCAUCA/3_3-GCAUCA.mcs
MCSYM-DB/3_3/GCAUCC/
MCSYM-DB/3_3/GCAUCC/3_3-GCAUCC.mcs
MCSYM-DB/3_3/GCAUCC/ds-3_3-GCAUCC_x.pdb.gz
MCSYM-DB/3_3/GCAUCU/
MCSYM-DB/3_3/GCAUCU/3_3-GCAUCU.mcs
MCSYM-DB/3_3/GCAUGC/
MCSYM-DB/3_3/GCAUGC/3_3-GCAUGC.mcs
MCSYM-DB/3_3/GCAUGC/ds-3_3-GCAUGC_x.pdb.gz
MCSYM-DB/3_3/GCAUGU/
MCSYM-DB/3_3/GCAUGU/3_3-GCAUGU.mcs
MCSYM-DB/3_3/GCAUUA/
MCSYM-DB/3_3/GCAUUA/3_3-GCAUUA.mcs
MCSYM-DB/3_3/GCAUUC/
MCSYM-DB/3_3/GCAUUC/3_3-GCAUUC.mcs
MCSYM-DB/3_3/GCAUUC/ds-3_3-GCAUUC_x.pdb.gz
MCSYM-DB/3_3/GCAUUG/
MCSYM-DB/3_3/GCAUUG/3_3-GCAUUG.mcs
MCSYM-DB/3_3/GCAUUU/
MCSYM-DB/3_3/GCAUUU/3_3-GCAUUU.mcs
MCSYM-DB/3_3/GCAUUU/ds-3_3-GCAUUU_x.pdb.gz
MCSYM-DB/3_3/GCCAAC/
MCSYM-DB/3_3/GCCAAC/3_3-GCCAAC.mcs
MCSYM-DB/3_3/GCCACC/
MCSYM-DB/3_3/GCCACC/3_3-GCCACC.mcs
MCSYM-DB/3_3/GCCACC/ds-3_3-GCCACC_x.pdb.gz
MCSYM-DB/3_3/GCCAGU/
MCSYM-DB/3_3/GCCAGU/3_3-GCCAGU.mcs
MCSYM-DB/3_3/GCCAUA/
MCSYM-DB/3_3/GCCAUA/3_3-GCCAUA.mcs
MCSYM-DB/3_3/GCCAUC/
MCSYM-DB/3_3/GCCAUC/3_3-GCCAUC.mcs
MCSYM-DB/3_3/GCCCAA/
MCSYM-DB/3_3/GCCCAA/3_3-GCCCAA.mcs
MCSYM-DB/3_3/GCCCAC/
MCSYM-DB/3_3/GCCCAC/3_3-GCCCAC.mcs
MCSYM-DB/3_3/GCCCCC/
MCSYM-DB/3_3/GCCCCC/3_3-GCCCCC.mcs
MCSYM-DB/3_3/GCCCUC/
MCSYM-DB/3_3/GCCCUC/3_3-GCCCUC.mcs
MCSYM-DB/3_3/GCCCUC/ds-3_3-GCCCUC_x.pdb.gz
MCSYM-DB/3_3/GCCGAA/
MCSYM-DB/3_3/GCCGAA/3_3-GCCGAA.mcs
MCSYM-DB/3_3/GCCGAC/
MCSYM-DB/3_3/GCCGAC/3_3-GCCGAC.mcs
MCSYM-DB/3_3/GCCGAC/ds-3_3-GCCGAC_x.pdb.gz
MCSYM-DB/3_3/GCCGCA/
MCSYM-DB/3_3/GCCGCA/3_3-GCCGCA.mcs
MCSYM-DB/3_3/GCCGCC/
MCSYM-DB/3_3/GCCGCC/3_3-GCCGCC.mcs
MCSYM-DB/3_3/GCCGCC/ds-3_3-GCCGCC_x.pdb.gz
MCSYM-DB/3_3/GCCGCG/
MCSYM-DB/3_3/GCCGCG/3_3-GCCGCG.mcs
MCSYM-DB/3_3/GCCGCU/
MCSYM-DB/3_3/GCCGCU/3_3-GCCGCU.mcs
MCSYM-DB/3_3/GCCGCU/ds-3_3-GCCGCU_x.pdb.gz
MCSYM-DB/3_3/GCCGGC/
MCSYM-DB/3_3/GCCGGC/3_3-GCCGGC.mcs
MCSYM-DB/3_3/GCCGGU/
MCSYM-DB/3_3/GCCGGU/3_3-GCCGGU.mcs
MCSYM-DB/3_3/GCCGUC/
MCSYM-DB/3_3/GCCGUC/3_3-GCCGUC.mcs
MCSYM-DB/3_3/GCCGUC/ds-3_3-GCCGUC_x.pdb.gz
MCSYM-DB/3_3/GCCGUG/
MCSYM-DB/3_3/GCCGUG/3_3-GCCGUG.mcs
MCSYM-DB/3_3/GCCGUU/
MCSYM-DB/3_3/GCCGUU/3_3-GCCGUU.mcs
MCSYM-DB/3_3/GCCGUU/ds-3_3-GCCGUU_x.pdb.gz
MCSYM-DB/3_3/GCCUAC/
MCSYM-DB/3_3/GCCUAC/3_3-GCCUAC.mcs
MCSYM-DB/3_3/GCCUAU/
MCSYM-DB/3_3/GCCUAU/3_3-GCCUAU.mcs
MCSYM-DB/3_3/GCCUGC/
MCSYM-DB/3_3/GCCUGC/3_3-GCCUGC.mcs
MCSYM-DB/3_3/GCCUUC/
MCSYM-DB/3_3/GCCUUC/3_3-GCCUUC.mcs
MCSYM-DB/3_3/GCGAAA/
MCSYM-DB/3_3/GCGAAA/3_3-GCGAAA.mcs
MCSYM-DB/3_3/GCGAAC/
MCSYM-DB/3_3/GCGAAC/3_3-GCGAAC.mcs
MCSYM-DB/3_3/GCGACA/
MCSYM-DB/3_3/GCGACA/3_3-GCGACA.mcs
MCSYM-DB/3_3/GCGAGC/
MCSYM-DB/3_3/GCGAGC/3_3-GCGAGC.mcs
MCSYM-DB/3_3/GCGAUU/
MCSYM-DB/3_3/GCGAUU/3_3-GCGAUU.mcs
MCSYM-DB/3_3/GCGCAA/
MCSYM-DB/3_3/GCGCAA/3_3-GCGCAA.mcs
MCSYM-DB/3_3/GCGCAC/
MCSYM-DB/3_3/GCGCAC/3_3-GCGCAC.mcs
MCSYM-DB/3_3/GCGCAC/ds-3_3-GCGCAC_x.pdb.gz
MCSYM-DB/3_3/GCGCAU/
MCSYM-DB/3_3/GCGCAU/3_3-GCGCAU.mcs
MCSYM-DB/3_3/GCGCAU/ds-3_3-GCGCAU_x.pdb.gz
MCSYM-DB/3_3/GCGCCA/
MCSYM-DB/3_3/GCGCCA/3_3-GCGCCA.mcs
MCSYM-DB/3_3/GCGCCC/
MCSYM-DB/3_3/GCGCCC/3_3-GCGCCC.mcs
MCSYM-DB/3_3/GCGCCU/
MCSYM-DB/3_3/GCGCCU/3_3-GCGCCU.mcs
MCSYM-DB/3_3/GCGCCU/ds-3_3-GCGCCU_x.pdb.gz
MCSYM-DB/3_3/GCGCGC/
MCSYM-DB/3_3/GCGCGC/3_3-GCGCGC.mcs
MCSYM-DB/3_3/GCGCGC/ds-3_3-GCGCGC_x.pdb.gz
MCSYM-DB/3_3/GCGCGU/
MCSYM-DB/3_3/GCGCGU/3_3-GCGCGU.mcs
MCSYM-DB/3_3/GCGCUC/
MCSYM-DB/3_3/GCGCUC/3_3-GCGCUC.mcs
MCSYM-DB/3_3/GCGCUC/ds-3_3-GCGCUC_x.pdb.gz
MCSYM-DB/3_3/GCGCUU/
MCSYM-DB/3_3/GCGCUU/3_3-GCGCUU.mcs
MCSYM-DB/3_3/GCGGGA/
MCSYM-DB/3_3/GCGGGA/3_3-GCGGGA.mcs
MCSYM-DB/3_3/GCGUAC/
MCSYM-DB/3_3/GCGUAC/3_3-GCGUAC.mcs
MCSYM-DB/3_3/GCGUAC/ds-3_3-GCGUAC_x.pdb.gz
MCSYM-DB/3_3/GCGUAU/
MCSYM-DB/3_3/GCGUAU/3_3-GCGUAU.mcs
MCSYM-DB/3_3/GCGUCC/
MCSYM-DB/3_3/GCGUCC/3_3-GCGUCC.mcs
MCSYM-DB/3_3/GCGUGC/
MCSYM-DB/3_3/GCGUGC/3_3-GCGUGC.mcs
MCSYM-DB/3_3/GCGUUC/
MCSYM-DB/3_3/GCGUUC/3_3-GCGUUC.mcs
MCSYM-DB/3_3/GCGUUC/ds-3_3-GCGUUC_x.pdb.gz
MCSYM-DB/3_3/GCUAAA/
MCSYM-DB/3_3/GCUAAA/3_3-GCUAAA.mcs
MCSYM-DB/3_3/GCUAAC/
MCSYM-DB/3_3/GCUAAC/1JO7_model_1.pdb.gz
MCSYM-DB/3_3/GCUAAC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/GCUAAC/3_3-GCUAAC.mcs
MCSYM-DB/3_3/GCUAAC/ds-3_3-GCUAAC_x.pdb.gz
MCSYM-DB/3_3/GCUAAU/
MCSYM-DB/3_3/GCUAAU/3_3-GCUAAU.mcs
MCSYM-DB/3_3/GCUAAU/ds-3_3-GCUAAU_x.pdb.gz
MCSYM-DB/3_3/GCUACA/
MCSYM-DB/3_3/GCUACA/3_3-GCUACA.mcs
MCSYM-DB/3_3/GCUACC/
MCSYM-DB/3_3/GCUACC/3_3-GCUACC.mcs
MCSYM-DB/3_3/GCUACC/ds-3_3-GCUACC_x.pdb.gz
MCSYM-DB/3_3/GCUACU/
MCSYM-DB/3_3/GCUACU/3_3-GCUACU.mcs
MCSYM-DB/3_3/GCUACU/ds-3_3-GCUACU_x.pdb.gz
MCSYM-DB/3_3/GCUAGA/
MCSYM-DB/3_3/GCUAGA/3_3-GCUAGA.mcs
MCSYM-DB/3_3/GCUAGC/
MCSYM-DB/3_3/GCUAGC/3_3-GCUAGC.mcs
MCSYM-DB/3_3/GCUAGG/
MCSYM-DB/3_3/GCUAGG/3_3-GCUAGG.mcs
MCSYM-DB/3_3/GCUAGG/ds-3_3-GCUAGG_x.pdb.gz
MCSYM-DB/3_3/GCUAGU/
MCSYM-DB/3_3/GCUAGU/3_3-GCUAGU.mcs
MCSYM-DB/3_3/GCUAUA/
MCSYM-DB/3_3/GCUAUA/3_3-GCUAUA.mcs
MCSYM-DB/3_3/GCUAUA/ds-3_3-GCUAUA_x.pdb.gz
MCSYM-DB/3_3/GCUAUC/
MCSYM-DB/3_3/GCUAUC/3_3-GCUAUC.mcs
MCSYM-DB/3_3/GCUAUC/ds-3_3-GCUAUC_x.pdb.gz
MCSYM-DB/3_3/GCUAUU/
MCSYM-DB/3_3/GCUAUU/3_3-GCUAUU.mcs
MCSYM-DB/3_3/GCUAUU/ds-3_3-GCUAUU_x.pdb.gz
MCSYM-DB/3_3/GCUCAC/
MCSYM-DB/3_3/GCUCAC/3_3-GCUCAC.mcs
MCSYM-DB/3_3/GCUCAG/
MCSYM-DB/3_3/GCUCAG/3_3-GCUCAG.mcs
MCSYM-DB/3_3/GCUCAU/
MCSYM-DB/3_3/GCUCAU/3_3-GCUCAU.mcs
MCSYM-DB/3_3/GCUCCC/
MCSYM-DB/3_3/GCUCCC/3_3-GCUCCC.mcs
MCSYM-DB/3_3/GCUCCC/ds-3_3-GCUCCC_x.pdb.gz
MCSYM-DB/3_3/GCUCUC/
MCSYM-DB/3_3/GCUCUC/3_3-GCUCUC.mcs
MCSYM-DB/3_3/GCUCUG/
MCSYM-DB/3_3/GCUCUG/3_3-GCUCUG.mcs
MCSYM-DB/3_3/GCUGAC/
MCSYM-DB/3_3/GCUGAC/3_3-GCUGAC.mcs
MCSYM-DB/3_3/GCUGAC/ds-3_3-GCUGAC_x.pdb.gz
MCSYM-DB/3_3/GCUGCA/
MCSYM-DB/3_3/GCUGCA/3_3-GCUGCA.mcs
MCSYM-DB/3_3/GCUGCC/
MCSYM-DB/3_3/GCUGCC/3_3-GCUGCC.mcs
MCSYM-DB/3_3/GCUGCC/ds-3_3-GCUGCC_x.pdb.gz
MCSYM-DB/3_3/GCUGCU/
MCSYM-DB/3_3/GCUGCU/3_3-GCUGCU.mcs
MCSYM-DB/3_3/GCUGCU/ds-3_3-GCUGCU_x.pdb.gz
MCSYM-DB/3_3/GCUGGC/
MCSYM-DB/3_3/GCUGGC/3_3-GCUGGC.mcs
MCSYM-DB/3_3/GCUGGU/
MCSYM-DB/3_3/GCUGGU/3_3-GCUGGU.mcs
MCSYM-DB/3_3/GCUGUA/
MCSYM-DB/3_3/GCUGUA/3_3-GCUGUA.mcs
MCSYM-DB/3_3/GCUGUC/
MCSYM-DB/3_3/GCUGUC/3_3-GCUGUC.mcs
MCSYM-DB/3_3/GCUGUC/ds-3_3-GCUGUC_x.pdb.gz
MCSYM-DB/3_3/GCUUAC/
MCSYM-DB/3_3/GCUUAC/3_3-GCUUAC.mcs
MCSYM-DB/3_3/GCUUCC/
MCSYM-DB/3_3/GCUUCC/3_3-GCUUCC.mcs
MCSYM-DB/3_3/GCUUCU/
MCSYM-DB/3_3/GCUUCU/3_3-GCUUCU.mcs
MCSYM-DB/3_3/GCUUGC/
MCSYM-DB/3_3/GCUUGC/3_3-GCUUGC.mcs
MCSYM-DB/3_3/GCUUGG/
MCSYM-DB/3_3/GCUUGG/3_3-GCUUGG.mcs
MCSYM-DB/3_3/GCUUUC/
MCSYM-DB/3_3/GCUUUC/3_3-GCUUUC.mcs
MCSYM-DB/3_3/GGAAAU/
MCSYM-DB/3_3/GGAAAU/3_3-GGAAAU.mcs
MCSYM-DB/3_3/GGAACC/
MCSYM-DB/3_3/GGAACC/3_3-GGAACC.mcs
MCSYM-DB/3_3/GGAAGG/
MCSYM-DB/3_3/GGAAGG/3_3-GGAAGG.mcs
MCSYM-DB/3_3/GGAAGU/
MCSYM-DB/3_3/GGAAGU/3_3-GGAAGU.mcs
MCSYM-DB/3_3/GGAAGU/ds-3_3-GGAAGU_x.pdb.gz
MCSYM-DB/3_3/GGACAC/
MCSYM-DB/3_3/GGACAC/3_3-GGACAC.mcs
MCSYM-DB/3_3/GGACCC/
MCSYM-DB/3_3/GGACCC/3_3-GGACCC.mcs
MCSYM-DB/3_3/GGACUC/
MCSYM-DB/3_3/GGACUC/3_3-GGACUC.mcs
MCSYM-DB/3_3/GGAGAC/
MCSYM-DB/3_3/GGAGAC/3_3-GGAGAC.mcs
MCSYM-DB/3_3/GGAGGC/
MCSYM-DB/3_3/GGAGGC/3_3-GGAGGC.mcs
MCSYM-DB/3_3/GGAGGU/
MCSYM-DB/3_3/GGAGGU/3_3-GGAGGU.mcs
MCSYM-DB/3_3/GGAGUG/
MCSYM-DB/3_3/GGAGUG/3_3-GGAGUG.mcs
MCSYM-DB/3_3/GGAGUU/
MCSYM-DB/3_3/GGAGUU/3_3-GGAGUU.mcs
MCSYM-DB/3_3/GGAUAC/
MCSYM-DB/3_3/GGAUAC/3_3-GGAUAC.mcs
MCSYM-DB/3_3/GGAUAC/ds-3_3-GGAUAC_x.pdb.gz
MCSYM-DB/3_3/GGAUCA/
MCSYM-DB/3_3/GGAUCA/3_3-GGAUCA.mcs
MCSYM-DB/3_3/GGAUCC/
MCSYM-DB/3_3/GGAUCC/1QET_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1A60_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1R7W_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1ATV_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1QWB_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1ATW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1R7Z_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1AUD_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1RAW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1B23_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1RKJ_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1BGZ_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1U6P_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1BN0_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1U8D_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1C0A_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1CK5_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1WTS_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1CQ5_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1CX0_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1XSG_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1DUL_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1XSH_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1E95_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1XWP_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1EFW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1Y26_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1EKZ_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1YNC_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1EUY_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1YNE_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1EXD_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1Z2J_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1F27_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1Z43_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1F5U_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1ZC5_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1F6X_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1ZJW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1F6Z_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/28SP_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1F7U_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2ADT_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1FG0_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2AU4_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1H4S_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2CSX_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1HLX_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2ES5_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1IL2_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2FK6_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1J1U_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2FQN_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1J4Y_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/2TRA_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1JBR_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/353D_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1JBT_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/3PHP_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1K5I_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/3_3-GGAUCC.mcs
MCSYM-DB/3_3/GGAUCC/1KPY_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/429D_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1L8V_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1M82_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1ME1_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1MSY_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1MZP_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1N66_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1N8X_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1NBK_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1NBR_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1NC0_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1NEM_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1NUJ_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1OSW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1PJY_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1Q8N_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1Q9A_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1QES_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1S03_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1SDR_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1SJ3_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1TFW_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1U0B_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCC/1U3K_model_1.pdb.gz
MCSYM-DB/3_3/GGAUCG/
MCSYM-DB/3_3/GGAUCG/3_3-GGAUCG.mcs
MCSYM-DB/3_3/GGAUGC/
MCSYM-DB/3_3/GGAUGC/3_3-GGAUGC.mcs
MCSYM-DB/3_3/GGAUGC/ds-3_3-GGAUGC_x.pdb.gz
MCSYM-DB/3_3/GGAUGU/
MCSYM-DB/3_3/GGAUGU/3_3-GGAUGU.mcs
MCSYM-DB/3_3/GGAUGU/ds-3_3-GGAUGU_x.pdb.gz
MCSYM-DB/3_3/GGAUUC/
MCSYM-DB/3_3/GGAUUC/3_3-GGAUUC.mcs
MCSYM-DB/3_3/GGAUUG/
MCSYM-DB/3_3/GGAUUG/3_3-GGAUUG.mcs
MCSYM-DB/3_3/GGAUUU/
MCSYM-DB/3_3/GGAUUU/3_3-GGAUUU.mcs
MCSYM-DB/3_3/GGCACC/
MCSYM-DB/3_3/GGCACC/3_3-GGCACC.mcs
MCSYM-DB/3_3/GGCAUG/
MCSYM-DB/3_3/GGCAUG/3_3-GGCAUG.mcs
MCSYM-DB/3_3/GGCCGC/
MCSYM-DB/3_3/GGCCGC/3_3-GGCCGC.mcs
MCSYM-DB/3_3/GGCGAA/
MCSYM-DB/3_3/GGCGAA/3_3-GGCGAA.mcs
MCSYM-DB/3_3/GGCGAC/
MCSYM-DB/3_3/GGCGAC/3_3-GGCGAC.mcs
MCSYM-DB/3_3/GGCGAC/ds-3_3-GGCGAC_x.pdb.gz
MCSYM-DB/3_3/GGCGCA/
MCSYM-DB/3_3/GGCGCA/3_3-GGCGCA.mcs
MCSYM-DB/3_3/GGCGCC/
MCSYM-DB/3_3/GGCGCC/3_3-GGCGCC.mcs
MCSYM-DB/3_3/GGCGCC/ds-3_3-GGCGCC_x.pdb.gz
MCSYM-DB/3_3/GGCGCU/
MCSYM-DB/3_3/GGCGCU/3_3-GGCGCU.mcs
MCSYM-DB/3_3/GGCGGA/
MCSYM-DB/3_3/GGCGGA/3_3-GGCGGA.mcs
MCSYM-DB/3_3/GGCGGC/
MCSYM-DB/3_3/GGCGGC/3_3-GGCGGC.mcs
MCSYM-DB/3_3/GGCGGC/ds-3_3-GGCGGC_x.pdb.gz
MCSYM-DB/3_3/GGCGGG/
MCSYM-DB/3_3/GGCGGG/3_3-GGCGGG.mcs
MCSYM-DB/3_3/GGCGUC/
MCSYM-DB/3_3/GGCGUC/3_3-GGCGUC.mcs
MCSYM-DB/3_3/GGCGUC/ds-3_3-GGCGUC_x.pdb.gz
MCSYM-DB/3_3/GGCGUU/
MCSYM-DB/3_3/GGCGUU/3_3-GGCGUU.mcs
MCSYM-DB/3_3/GGCUCC/
MCSYM-DB/3_3/GGCUCC/3_3-GGCUCC.mcs
MCSYM-DB/3_3/GGGAAA/
MCSYM-DB/3_3/GGGAAA/3_3-GGGAAA.mcs
MCSYM-DB/3_3/GGGACC/
MCSYM-DB/3_3/GGGACC/3_3-GGGACC.mcs
MCSYM-DB/3_3/GGGAGA/
MCSYM-DB/3_3/GGGAGA/3_3-GGGAGA.mcs
MCSYM-DB/3_3/GGGAGC/
MCSYM-DB/3_3/GGGAGC/3_3-GGGAGC.mcs
MCSYM-DB/3_3/GGGAGU/
MCSYM-DB/3_3/GGGAGU/3_3-GGGAGU.mcs
MCSYM-DB/3_3/GGGAUC/
MCSYM-DB/3_3/GGGAUC/3_3-GGGAUC.mcs
MCSYM-DB/3_3/GGGAUC/ds-3_3-GGGAUC_x.pdb.gz
MCSYM-DB/3_3/GGGAUU/
MCSYM-DB/3_3/GGGAUU/3_3-GGGAUU.mcs
MCSYM-DB/3_3/GGGCAC/
MCSYM-DB/3_3/GGGCAC/3_3-GGGCAC.mcs
MCSYM-DB/3_3/GGGCAC/ds-3_3-GGGCAC_x.pdb.gz
MCSYM-DB/3_3/GGGCCA/
MCSYM-DB/3_3/GGGCCA/3_3-GGGCCA.mcs
MCSYM-DB/3_3/GGGCCC/
MCSYM-DB/3_3/GGGCCC/3_3-GGGCCC.mcs
MCSYM-DB/3_3/GGGCCC/ds-3_3-GGGCCC_x.pdb.gz
MCSYM-DB/3_3/GGGCCG/
MCSYM-DB/3_3/GGGCCG/3_3-GGGCCG.mcs
MCSYM-DB/3_3/GGGCCU/
MCSYM-DB/3_3/GGGCCU/3_3-GGGCCU.mcs
MCSYM-DB/3_3/GGGCGC/
MCSYM-DB/3_3/GGGCGC/3_3-GGGCGC.mcs
MCSYM-DB/3_3/GGGCGC/ds-3_3-GGGCGC_x.pdb.gz
MCSYM-DB/3_3/GGGCUA/
MCSYM-DB/3_3/GGGCUA/3_3-GGGCUA.mcs
MCSYM-DB/3_3/GGGCUC/
MCSYM-DB/3_3/GGGCUC/3_3-GGGCUC.mcs
MCSYM-DB/3_3/GGGCUC/ds-3_3-GGGCUC_x.pdb.gz
MCSYM-DB/3_3/GGGCUG/
MCSYM-DB/3_3/GGGCUG/3_3-GGGCUG.mcs
MCSYM-DB/3_3/GGGCUG/ds-3_3-GGGCUG_x.pdb.gz
MCSYM-DB/3_3/GGGCUU/
MCSYM-DB/3_3/GGGCUU/3_3-GGGCUU.mcs
MCSYM-DB/3_3/GGGGAA/
MCSYM-DB/3_3/GGGGAA/3_3-GGGGAA.mcs
MCSYM-DB/3_3/GGGGAC/
MCSYM-DB/3_3/GGGGAC/3_3-GGGGAC.mcs
MCSYM-DB/3_3/GGGGCC/
MCSYM-DB/3_3/GGGGCC/3_3-GGGGCC.mcs
MCSYM-DB/3_3/GGGGGC/
MCSYM-DB/3_3/GGGGGC/3_3-GGGGGC.mcs
MCSYM-DB/3_3/GGGUAC/
MCSYM-DB/3_3/GGGUAC/3_3-GGGUAC.mcs
MCSYM-DB/3_3/GGGUCC/
MCSYM-DB/3_3/GGGUCC/3_3-GGGUCC.mcs
MCSYM-DB/3_3/GGGUCU/
MCSYM-DB/3_3/GGGUCU/3_3-GGGUCU.mcs
MCSYM-DB/3_3/GGGUGA/
MCSYM-DB/3_3/GGGUGA/3_3-GGGUGA.mcs
MCSYM-DB/3_3/GGGUGC/
MCSYM-DB/3_3/GGGUGC/3_3-GGGUGC.mcs
MCSYM-DB/3_3/GGGUGC/ds-3_3-GGGUGC_x.pdb.gz
MCSYM-DB/3_3/GGGUGU/
MCSYM-DB/3_3/GGGUGU/3_3-GGGUGU.mcs
MCSYM-DB/3_3/GGGUGU/ds-3_3-GGGUGU_x.pdb.gz
MCSYM-DB/3_3/GGGUUC/
MCSYM-DB/3_3/GGGUUC/3_3-GGGUUC.mcs
MCSYM-DB/3_3/GGGUUC/ds-3_3-GGGUUC_x.pdb.gz
MCSYM-DB/3_3/GGGUUU/
MCSYM-DB/3_3/GGGUUU/3_3-GGGUUU.mcs
MCSYM-DB/3_3/GGUAAC/
MCSYM-DB/3_3/GGUAAC/3_3-GGUAAC.mcs
MCSYM-DB/3_3/GGUAAC/ds-3_3-GGUAAC_x.pdb.gz
MCSYM-DB/3_3/GGUAAU/
MCSYM-DB/3_3/GGUAAU/3_3-GGUAAU.mcs
MCSYM-DB/3_3/GGUACC/
MCSYM-DB/3_3/GGUACC/3_3-GGUACC.mcs
MCSYM-DB/3_3/GGUACC/ds-3_3-GGUACC_x.pdb.gz
MCSYM-DB/3_3/GGUACG/
MCSYM-DB/3_3/GGUACG/3_3-GGUACG.mcs
MCSYM-DB/3_3/GGUACU/
MCSYM-DB/3_3/GGUACU/3_3-GGUACU.mcs
MCSYM-DB/3_3/GGUAGA/
MCSYM-DB/3_3/GGUAGA/3_3-GGUAGA.mcs
MCSYM-DB/3_3/GGUAGA/ds-3_3-GGUAGA_x.pdb.gz
MCSYM-DB/3_3/GGUAGC/
MCSYM-DB/3_3/GGUAGC/3_3-GGUAGC.mcs
MCSYM-DB/3_3/GGUAGC/ds-3_3-GGUAGC_x.pdb.gz
MCSYM-DB/3_3/GGUAGU/
MCSYM-DB/3_3/GGUAGU/3_3-GGUAGU.mcs
MCSYM-DB/3_3/GGUAGU/ds-3_3-GGUAGU_x.pdb.gz
MCSYM-DB/3_3/GGUAUA/
MCSYM-DB/3_3/GGUAUA/3_3-GGUAUA.mcs
MCSYM-DB/3_3/GGUAUC/
MCSYM-DB/3_3/GGUAUC/3_3-GGUAUC.mcs
MCSYM-DB/3_3/GGUAUC/ds-3_3-GGUAUC_x.pdb.gz
MCSYM-DB/3_3/GGUAUG/
MCSYM-DB/3_3/GGUAUG/3_3-GGUAUG.mcs
MCSYM-DB/3_3/GGUAUU/
MCSYM-DB/3_3/GGUAUU/3_3-GGUAUU.mcs
MCSYM-DB/3_3/GGUCAC/
MCSYM-DB/3_3/GGUCAC/3_3-GGUCAC.mcs
MCSYM-DB/3_3/GGUCCC/
MCSYM-DB/3_3/GGUCCC/3_3-GGUCCC.mcs
MCSYM-DB/3_3/GGUCCU/
MCSYM-DB/3_3/GGUCCU/3_3-GGUCCU.mcs
MCSYM-DB/3_3/GGUCUC/
MCSYM-DB/3_3/GGUCUC/3_3-GGUCUC.mcs
MCSYM-DB/3_3/GGUGAA/
MCSYM-DB/3_3/GGUGAA/3_3-GGUGAA.mcs
MCSYM-DB/3_3/GGUGAC/
MCSYM-DB/3_3/GGUGAC/3_3-GGUGAC.mcs
MCSYM-DB/3_3/GGUGAC/ds-3_3-GGUGAC_x.pdb.gz
MCSYM-DB/3_3/GGUGAU/
MCSYM-DB/3_3/GGUGAU/3_3-GGUGAU.mcs
MCSYM-DB/3_3/GGUGAU/ds-3_3-GGUGAU_x.pdb.gz
MCSYM-DB/3_3/GGUGCC/
MCSYM-DB/3_3/GGUGCC/3_3-GGUGCC.mcs
MCSYM-DB/3_3/GGUGGA/
MCSYM-DB/3_3/GGUGGA/3_3-GGUGGA.mcs
MCSYM-DB/3_3/GGUGGC/
MCSYM-DB/3_3/GGUGGC/3_3-GGUGGC.mcs
MCSYM-DB/3_3/GGUGGC/ds-3_3-GGUGGC_x.pdb.gz
MCSYM-DB/3_3/GGUGUC/
MCSYM-DB/3_3/GGUGUC/3_3-GGUGUC.mcs
MCSYM-DB/3_3/GGUGUU/
MCSYM-DB/3_3/GGUGUU/3_3-GGUGUU.mcs
MCSYM-DB/3_3/GGUUAU/
MCSYM-DB/3_3/GGUUAU/3_3-GGUUAU.mcs
MCSYM-DB/3_3/GGUUGA/
MCSYM-DB/3_3/GGUUGA/3_3-GGUUGA.mcs
MCSYM-DB/3_3/GGUUGC/
MCSYM-DB/3_3/GGUUGC/3_3-GGUUGC.mcs
MCSYM-DB/3_3/GGUUUC/
MCSYM-DB/3_3/GGUUUC/3_3-GGUUUC.mcs
MCSYM-DB/3_3/GGUUUU/
MCSYM-DB/3_3/GGUUUU/3_3-GGUUUU.mcs
MCSYM-DB/3_3/GUAAAA/
MCSYM-DB/3_3/GUAAAA/3_3-GUAAAA.mcs
MCSYM-DB/3_3/GUAAAC/
MCSYM-DB/3_3/GUAAAC/3_3-GUAAAC.mcs
MCSYM-DB/3_3/GUAAGC/
MCSYM-DB/3_3/GUAAGC/3_3-GUAAGC.mcs
MCSYM-DB/3_3/GUAAUC/
MCSYM-DB/3_3/GUAAUC/3_3-GUAAUC.mcs
MCSYM-DB/3_3/GUACAC/
MCSYM-DB/3_3/GUACAC/3_3-GUACAC.mcs
MCSYM-DB/3_3/GUACCA/
MCSYM-DB/3_3/GUACCA/3_3-GUACCA.mcs
MCSYM-DB/3_3/GUACCC/
MCSYM-DB/3_3/GUACCC/3_3-GUACCC.mcs
MCSYM-DB/3_3/GUACUC/
MCSYM-DB/3_3/GUACUC/3_3-GUACUC.mcs
MCSYM-DB/3_3/GUAGAC/
MCSYM-DB/3_3/GUAGAC/3_3-GUAGAC.mcs
MCSYM-DB/3_3/GUAGAC/ds-3_3-GUAGAC_x.pdb.gz
MCSYM-DB/3_3/GUAGAU/
MCSYM-DB/3_3/GUAGAU/3_3-GUAGAU.mcs
MCSYM-DB/3_3/GUAGCC/
MCSYM-DB/3_3/GUAGCC/3_3-GUAGCC.mcs
MCSYM-DB/3_3/GUAGCC/ds-3_3-GUAGCC_x.pdb.gz
MCSYM-DB/3_3/GUAGGC/
MCSYM-DB/3_3/GUAGGC/3_3-GUAGGC.mcs
MCSYM-DB/3_3/GUAGUC/
MCSYM-DB/3_3/GUAGUC/3_3-GUAGUC.mcs
MCSYM-DB/3_3/GUAGUU/
MCSYM-DB/3_3/GUAGUU/3_3-GUAGUU.mcs
MCSYM-DB/3_3/GUAUAA/
MCSYM-DB/3_3/GUAUAA/3_3-GUAUAA.mcs
MCSYM-DB/3_3/GUAUAC/
MCSYM-DB/3_3/GUAUAC/1EUY_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1EXD_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1EXY_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1IK1_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1IVS_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1KXK_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1LMV_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1LPW_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1MT4_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1OOA_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1QC0_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1R2P_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1RFR_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1ROQ_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1RPU_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1SLP_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1T4L_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1TXS_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1ULL_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1UUU_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1YSV_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/1ZJW_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/377D_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/3_3-GUAUAC.mcs
MCSYM-DB/3_3/GUAUAC/433D_model_1.pdb.gz
MCSYM-DB/3_3/GUAUAC/ds-3_3-GUAUAC_x.pdb.gz
MCSYM-DB/3_3/GUAUAG/
MCSYM-DB/3_3/GUAUAG/3_3-GUAUAG.mcs
MCSYM-DB/3_3/GUAUAU/
MCSYM-DB/3_3/GUAUAU/3_3-GUAUAU.mcs
MCSYM-DB/3_3/GUAUCA/
MCSYM-DB/3_3/GUAUCA/3_3-GUAUCA.mcs
MCSYM-DB/3_3/GUAUCC/
MCSYM-DB/3_3/GUAUCC/3_3-GUAUCC.mcs
MCSYM-DB/3_3/GUAUCC/ds-3_3-GUAUCC_x.pdb.gz
MCSYM-DB/3_3/GUAUCU/
MCSYM-DB/3_3/GUAUCU/3_3-GUAUCU.mcs
MCSYM-DB/3_3/GUAUCU/ds-3_3-GUAUCU_x.pdb.gz
MCSYM-DB/3_3/GUAUGA/
MCSYM-DB/3_3/GUAUGA/3_3-GUAUGA.mcs
MCSYM-DB/3_3/GUAUGC/
MCSYM-DB/3_3/GUAUGC/3_3-GUAUGC.mcs
MCSYM-DB/3_3/GUAUGC/ds-3_3-GUAUGC_x.pdb.gz
MCSYM-DB/3_3/GUAUGG/
MCSYM-DB/3_3/GUAUGG/3_3-GUAUGG.mcs
MCSYM-DB/3_3/GUAUGU/
MCSYM-DB/3_3/GUAUGU/3_3-GUAUGU.mcs
MCSYM-DB/3_3/GUAUUA/
MCSYM-DB/3_3/GUAUUA/3_3-GUAUUA.mcs
MCSYM-DB/3_3/GUAUUC/
MCSYM-DB/3_3/GUAUUC/3_3-GUAUUC.mcs
MCSYM-DB/3_3/GUAUUC/ds-3_3-GUAUUC_x.pdb.gz
MCSYM-DB/3_3/GUAUUU/
MCSYM-DB/3_3/GUAUUU/3_3-GUAUUU.mcs
MCSYM-DB/3_3/GUAUUU/ds-3_3-GUAUUU_x.pdb.gz
MCSYM-DB/3_3/GUCAAC/
MCSYM-DB/3_3/GUCAAC/3_3-GUCAAC.mcs
MCSYM-DB/3_3/GUCAAG/
MCSYM-DB/3_3/GUCAAG/3_3-GUCAAG.mcs
MCSYM-DB/3_3/GUCACC/
MCSYM-DB/3_3/GUCACC/3_3-GUCACC.mcs
MCSYM-DB/3_3/GUCACU/
MCSYM-DB/3_3/GUCACU/3_3-GUCACU.mcs
MCSYM-DB/3_3/GUCCAC/
MCSYM-DB/3_3/GUCCAC/3_3-GUCCAC.mcs
MCSYM-DB/3_3/GUCCCC/
MCSYM-DB/3_3/GUCCCC/3_3-GUCCCC.mcs
MCSYM-DB/3_3/GUCCUC/
MCSYM-DB/3_3/GUCCUC/3_3-GUCCUC.mcs
MCSYM-DB/3_3/GUCGAA/
MCSYM-DB/3_3/GUCGAA/3_3-GUCGAA.mcs
MCSYM-DB/3_3/GUCGAC/
MCSYM-DB/3_3/GUCGAC/3_3-GUCGAC.mcs
MCSYM-DB/3_3/GUCGAC/ds-3_3-GUCGAC_x.pdb.gz
MCSYM-DB/3_3/GUCGAG/
MCSYM-DB/3_3/GUCGAG/3_3-GUCGAG.mcs
MCSYM-DB/3_3/GUCGAU/
MCSYM-DB/3_3/GUCGAU/3_3-GUCGAU.mcs
MCSYM-DB/3_3/GUCGCA/
MCSYM-DB/3_3/GUCGCA/3_3-GUCGCA.mcs
MCSYM-DB/3_3/GUCGCC/
MCSYM-DB/3_3/GUCGCC/3_3-GUCGCC.mcs
MCSYM-DB/3_3/GUCGCC/ds-3_3-GUCGCC_x.pdb.gz
MCSYM-DB/3_3/GUCGCU/
MCSYM-DB/3_3/GUCGCU/3_3-GUCGCU.mcs
MCSYM-DB/3_3/GUCGGA/
MCSYM-DB/3_3/GUCGGA/3_3-GUCGGA.mcs
MCSYM-DB/3_3/GUCGGC/
MCSYM-DB/3_3/GUCGGC/3_3-GUCGGC.mcs
MCSYM-DB/3_3/GUCGGC/ds-3_3-GUCGGC_x.pdb.gz
MCSYM-DB/3_3/GUCGGU/
MCSYM-DB/3_3/GUCGGU/3_3-GUCGGU.mcs
MCSYM-DB/3_3/GUCGUC/
MCSYM-DB/3_3/GUCGUC/3_3-GUCGUC.mcs
MCSYM-DB/3_3/GUCGUC/ds-3_3-GUCGUC_x.pdb.gz
MCSYM-DB/3_3/GUCGUG/
MCSYM-DB/3_3/GUCGUG/3_3-GUCGUG.mcs
MCSYM-DB/3_3/GUCGUU/
MCSYM-DB/3_3/GUCGUU/3_3-GUCGUU.mcs
MCSYM-DB/3_3/GUCGUU/ds-3_3-GUCGUU_x.pdb.gz
MCSYM-DB/3_3/GUCUAC/
MCSYM-DB/3_3/GUCUAC/3_3-GUCUAC.mcs
MCSYM-DB/3_3/GUCUCC/
MCSYM-DB/3_3/GUCUCC/3_3-GUCUCC.mcs
MCSYM-DB/3_3/GUCUCU/
MCSYM-DB/3_3/GUCUCU/3_3-GUCUCU.mcs
MCSYM-DB/3_3/GUCUGU/
MCSYM-DB/3_3/GUCUGU/3_3-GUCUGU.mcs
MCSYM-DB/3_3/GUCUUC/
MCSYM-DB/3_3/GUCUUC/3_3-GUCUUC.mcs
MCSYM-DB/3_3/GUGAAC/
MCSYM-DB/3_3/GUGAAC/3_3-GUGAAC.mcs
MCSYM-DB/3_3/GUGAAU/
MCSYM-DB/3_3/GUGAAU/3_3-GUGAAU.mcs
MCSYM-DB/3_3/GUGACA/
MCSYM-DB/3_3/GUGACA/3_3-GUGACA.mcs
MCSYM-DB/3_3/GUGAGA/
MCSYM-DB/3_3/GUGAGA/3_3-GUGAGA.mcs
MCSYM-DB/3_3/GUGAGC/
MCSYM-DB/3_3/GUGAGC/3_3-GUGAGC.mcs
MCSYM-DB/3_3/GUGAGU/
MCSYM-DB/3_3/GUGAGU/3_3-GUGAGU.mcs
MCSYM-DB/3_3/GUGAUA/
MCSYM-DB/3_3/GUGAUA/3_3-GUGAUA.mcs
MCSYM-DB/3_3/GUGAUC/
MCSYM-DB/3_3/GUGAUC/3_3-GUGAUC.mcs
MCSYM-DB/3_3/GUGAUC/ds-3_3-GUGAUC_x.pdb.gz
MCSYM-DB/3_3/GUGCAA/
MCSYM-DB/3_3/GUGCAA/3_3-GUGCAA.mcs
MCSYM-DB/3_3/GUGCAC/
MCSYM-DB/3_3/GUGCAC/3_3-GUGCAC.mcs
MCSYM-DB/3_3/GUGCAC/ds-3_3-GUGCAC_x.pdb.gz
MCSYM-DB/3_3/GUGCAG/
MCSYM-DB/3_3/GUGCAG/3_3-GUGCAG.mcs
MCSYM-DB/3_3/GUGCAU/
MCSYM-DB/3_3/GUGCAU/3_3-GUGCAU.mcs
MCSYM-DB/3_3/GUGCCA/
MCSYM-DB/3_3/GUGCCA/3_3-GUGCCA.mcs
MCSYM-DB/3_3/GUGCCC/
MCSYM-DB/3_3/GUGCCC/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/GUGCCC/3_3-GUGCCC.mcs
MCSYM-DB/3_3/GUGCCC/ds-3_3-GUGCCC_x.pdb.gz
MCSYM-DB/3_3/GUGCCU/
MCSYM-DB/3_3/GUGCCU/3_3-GUGCCU.mcs
MCSYM-DB/3_3/GUGCCU/ds-3_3-GUGCCU_x.pdb.gz
MCSYM-DB/3_3/GUGCGA/
MCSYM-DB/3_3/GUGCGA/3_3-GUGCGA.mcs
MCSYM-DB/3_3/GUGCGC/
MCSYM-DB/3_3/GUGCGC/3_3-GUGCGC.mcs
MCSYM-DB/3_3/GUGCGG/
MCSYM-DB/3_3/GUGCGG/3_3-GUGCGG.mcs
MCSYM-DB/3_3/GUGCGU/
MCSYM-DB/3_3/GUGCGU/3_3-GUGCGU.mcs
MCSYM-DB/3_3/GUGCUA/
MCSYM-DB/3_3/GUGCUA/3_3-GUGCUA.mcs
MCSYM-DB/3_3/GUGCUA/ds-3_3-GUGCUA_x.pdb.gz
MCSYM-DB/3_3/GUGCUC/
MCSYM-DB/3_3/GUGCUC/1VQ7_model_1.pdb.gz
MCSYM-DB/3_3/GUGCUC/3_3-GUGCUC.mcs
MCSYM-DB/3_3/GUGCUC/ds-3_3-GUGCUC_x.pdb.gz
MCSYM-DB/3_3/GUGCUG/
MCSYM-DB/3_3/GUGCUG/3_3-GUGCUG.mcs
MCSYM-DB/3_3/GUGCUU/
MCSYM-DB/3_3/GUGCUU/3_3-GUGCUU.mcs
MCSYM-DB/3_3/GUGCUU/ds-3_3-GUGCUU_x.pdb.gz
MCSYM-DB/3_3/GUGGAC/
MCSYM-DB/3_3/GUGGAC/3_3-GUGGAC.mcs
MCSYM-DB/3_3/GUGGGA/
MCSYM-DB/3_3/GUGGGA/3_3-GUGGGA.mcs
MCSYM-DB/3_3/GUGGGC/
MCSYM-DB/3_3/GUGGGC/3_3-GUGGGC.mcs
MCSYM-DB/3_3/GUGUAA/
MCSYM-DB/3_3/GUGUAA/3_3-GUGUAA.mcs
MCSYM-DB/3_3/GUGUAC/
MCSYM-DB/3_3/GUGUAC/3_3-GUGUAC.mcs
MCSYM-DB/3_3/GUGUAC/ds-3_3-GUGUAC_x.pdb.gz
MCSYM-DB/3_3/GUGUAG/
MCSYM-DB/3_3/GUGUAG/3_3-GUGUAG.mcs
MCSYM-DB/3_3/GUGUAU/
MCSYM-DB/3_3/GUGUAU/3_3-GUGUAU.mcs
MCSYM-DB/3_3/GUGUCA/
MCSYM-DB/3_3/GUGUCA/3_3-GUGUCA.mcs
MCSYM-DB/3_3/GUGUCC/
MCSYM-DB/3_3/GUGUCC/3_3-GUGUCC.mcs
MCSYM-DB/3_3/GUGUCC/ds-3_3-GUGUCC_x.pdb.gz
MCSYM-DB/3_3/GUGUCU/
MCSYM-DB/3_3/GUGUCU/3_3-GUGUCU.mcs
MCSYM-DB/3_3/GUGUGA/
MCSYM-DB/3_3/GUGUGA/3_3-GUGUGA.mcs
MCSYM-DB/3_3/GUGUGC/
MCSYM-DB/3_3/GUGUGC/3_3-GUGUGC.mcs
MCSYM-DB/3_3/GUGUGG/
MCSYM-DB/3_3/GUGUGG/3_3-GUGUGG.mcs
MCSYM-DB/3_3/GUGUGU/
MCSYM-DB/3_3/GUGUGU/3_3-GUGUGU.mcs
MCSYM-DB/3_3/GUGUUC/
MCSYM-DB/3_3/GUGUUC/3_3-GUGUUC.mcs
MCSYM-DB/3_3/GUGUUC/ds-3_3-GUGUUC_x.pdb.gz
MCSYM-DB/3_3/GUGUUU/
MCSYM-DB/3_3/GUGUUU/3_3-GUGUUU.mcs
MCSYM-DB/3_3/GUGUUU/ds-3_3-GUGUUU_x.pdb.gz
MCSYM-DB/3_3/GUUAAA/
MCSYM-DB/3_3/GUUAAA/3_3-GUUAAA.mcs
MCSYM-DB/3_3/GUUAAC/
MCSYM-DB/3_3/GUUAAC/3_3-GUUAAC.mcs
MCSYM-DB/3_3/GUUAAU/
MCSYM-DB/3_3/GUUAAU/3_3-GUUAAU.mcs
MCSYM-DB/3_3/GUUACA/
MCSYM-DB/3_3/GUUACA/3_3-GUUACA.mcs
MCSYM-DB/3_3/GUUACC/
MCSYM-DB/3_3/GUUACC/3_3-GUUACC.mcs
MCSYM-DB/3_3/GUUACC/ds-3_3-GUUACC_x.pdb.gz
MCSYM-DB/3_3/GUUACU/
MCSYM-DB/3_3/GUUACU/3_3-GUUACU.mcs
MCSYM-DB/3_3/GUUACU/ds-3_3-GUUACU_x.pdb.gz
MCSYM-DB/3_3/GUUAGC/
MCSYM-DB/3_3/GUUAGC/3_3-GUUAGC.mcs
MCSYM-DB/3_3/GUUAGC/ds-3_3-GUUAGC_x.pdb.gz
MCSYM-DB/3_3/GUUAGG/
MCSYM-DB/3_3/GUUAGG/3_3-GUUAGG.mcs
MCSYM-DB/3_3/GUUAGU/
MCSYM-DB/3_3/GUUAGU/3_3-GUUAGU.mcs
MCSYM-DB/3_3/GUUAUA/
MCSYM-DB/3_3/GUUAUA/3_3-GUUAUA.mcs
MCSYM-DB/3_3/GUUAUC/
MCSYM-DB/3_3/GUUAUC/3_3-GUUAUC.mcs
MCSYM-DB/3_3/GUUAUC/ds-3_3-GUUAUC_x.pdb.gz
MCSYM-DB/3_3/GUUAUU/
MCSYM-DB/3_3/GUUAUU/3_3-GUUAUU.mcs
MCSYM-DB/3_3/GUUAUU/ds-3_3-GUUAUU_x.pdb
MCSYM-DB/3_3/GUUAUU/ds-3_3-GUUAUU_x.pdb.gz
MCSYM-DB/3_3/GUUCAC/
MCSYM-DB/3_3/GUUCAC/3_3-GUUCAC.mcs
MCSYM-DB/3_3/GUUCCC/
MCSYM-DB/3_3/GUUCCC/3_3-GUUCCC.mcs
MCSYM-DB/3_3/GUUCCU/
MCSYM-DB/3_3/GUUCCU/3_3-GUUCCU.mcs
MCSYM-DB/3_3/GUUCGU/
MCSYM-DB/3_3/GUUCGU/3_3-GUUCGU.mcs
MCSYM-DB/3_3/GUUCUC/
MCSYM-DB/3_3/GUUCUC/3_3-GUUCUC.mcs
MCSYM-DB/3_3/GUUCUU/
MCSYM-DB/3_3/GUUCUU/3_3-GUUCUU.mcs
MCSYM-DB/3_3/GUUGAC/
MCSYM-DB/3_3/GUUGAC/3_3-GUUGAC.mcs
MCSYM-DB/3_3/GUUGAU/
MCSYM-DB/3_3/GUUGAU/3_3-GUUGAU.mcs
MCSYM-DB/3_3/GUUGCA/
MCSYM-DB/3_3/GUUGCA/3_3-GUUGCA.mcs
MCSYM-DB/3_3/GUUGCC/
MCSYM-DB/3_3/GUUGCC/3_3-GUUGCC.mcs
MCSYM-DB/3_3/GUUGGC/
MCSYM-DB/3_3/GUUGGC/3_3-GUUGGC.mcs
MCSYM-DB/3_3/GUUGGU/
MCSYM-DB/3_3/GUUGGU/3_3-GUUGGU.mcs
MCSYM-DB/3_3/GUUGUA/
MCSYM-DB/3_3/GUUGUA/3_3-GUUGUA.mcs
MCSYM-DB/3_3/GUUGUC/
MCSYM-DB/3_3/GUUGUC/3_3-GUUGUC.mcs
MCSYM-DB/3_3/GUUGUC/ds-3_3-GUUGUC_x.pdb.gz
MCSYM-DB/3_3/GUUUAG/
MCSYM-DB/3_3/GUUUAG/3_3-GUUUAG.mcs
MCSYM-DB/3_3/GUUUAG/ds-3_3-GUUUAG_x.pdb.gz
MCSYM-DB/3_3/GUUUCA/
MCSYM-DB/3_3/GUUUCA/3_3-GUUUCA.mcs
MCSYM-DB/3_3/GUUUCC/
MCSYM-DB/3_3/GUUUCC/3_3-GUUUCC.mcs
MCSYM-DB/3_3/GUUUGA/
MCSYM-DB/3_3/GUUUGA/3_3-GUUUGA.mcs
MCSYM-DB/3_3/GUUUGC/
MCSYM-DB/3_3/GUUUGC/3_3-GUUUGC.mcs
MCSYM-DB/3_3/GUUUGG/
MCSYM-DB/3_3/GUUUGG/3_3-GUUUGG.mcs
MCSYM-DB/3_3/GUUUUC/
MCSYM-DB/3_3/GUUUUC/3_3-GUUUUC.mcs
MCSYM-DB/3_3/GUUUUC/ds-3_3-GUUUUC_x.pdb.gz
MCSYM-DB/3_3/GUUUUG/
MCSYM-DB/3_3/GUUUUG/3_3-GUUUUG.mcs
MCSYM-DB/3_3/GUUUUG/ds-3_3-GUUUUG_x.pdb.gz
MCSYM-DB/3_3/UAAAAA/
MCSYM-DB/3_3/UAAAAA/3_3-UAAAAA.mcs
MCSYM-DB/3_3/UAAAAA/ds-3_3-UAAAAA_x.pdb.gz
MCSYM-DB/3_3/UAAACA/
MCSYM-DB/3_3/UAAACA/3_3-UAAACA.mcs
MCSYM-DB/3_3/UAAAUA/
MCSYM-DB/3_3/UAAAUA/3_3-UAAAUA.mcs
MCSYM-DB/3_3/UAAAUG/
MCSYM-DB/3_3/UAAAUG/3_3-UAAAUG.mcs
MCSYM-DB/3_3/UAACAA/
MCSYM-DB/3_3/UAACAA/3_3-UAACAA.mcs
MCSYM-DB/3_3/UAACCA/
MCSYM-DB/3_3/UAACCA/3_3-UAACCA.mcs
MCSYM-DB/3_3/UAACCA/ds-3_3-UAACCA_x.pdb.gz
MCSYM-DB/3_3/UAACGG/
MCSYM-DB/3_3/UAACGG/3_3-UAACGG.mcs
MCSYM-DB/3_3/UAAGAA/
MCSYM-DB/3_3/UAAGAA/3_3-UAAGAA.mcs
MCSYM-DB/3_3/UAAGAG/
MCSYM-DB/3_3/UAAGAG/3_3-UAAGAG.mcs
MCSYM-DB/3_3/UAAGGA/
MCSYM-DB/3_3/UAAGGA/3_3-UAAGGA.mcs
MCSYM-DB/3_3/UAAGGG/
MCSYM-DB/3_3/UAAGGG/3_3-UAAGGG.mcs
MCSYM-DB/3_3/UAAGGG/ds-3_3-UAAGGG_x.pdb.gz
MCSYM-DB/3_3/UAAGGU/
MCSYM-DB/3_3/UAAGGU/3_3-UAAGGU.mcs
MCSYM-DB/3_3/UAAGUA/
MCSYM-DB/3_3/UAAGUA/3_3-UAAGUA.mcs
MCSYM-DB/3_3/UAAGUG/
MCSYM-DB/3_3/UAAGUG/3_3-UAAGUG.mcs
MCSYM-DB/3_3/UAAUAA/
MCSYM-DB/3_3/UAAUAA/3_3-UAAUAA.mcs
MCSYM-DB/3_3/UAAUAA/ds-3_3-UAAUAA_x.pdb.gz
MCSYM-DB/3_3/UAAUAC/
MCSYM-DB/3_3/UAAUAC/3_3-UAAUAC.mcs
MCSYM-DB/3_3/UAAUAU/
MCSYM-DB/3_3/UAAUAU/3_3-UAAUAU.mcs
MCSYM-DB/3_3/UAAUAU/ds-3_3-UAAUAU_x.pdb.gz
MCSYM-DB/3_3/UAAUCA/
MCSYM-DB/3_3/UAAUCA/3_3-UAAUCA.mcs
MCSYM-DB/3_3/UAAUCA/ds-3_3-UAAUCA_x.pdb.gz
MCSYM-DB/3_3/UAAUCU/
MCSYM-DB/3_3/UAAUCU/3_3-UAAUCU.mcs
MCSYM-DB/3_3/UAAUGA/
MCSYM-DB/3_3/UAAUGA/3_3-UAAUGA.mcs
MCSYM-DB/3_3/UAAUGA/ds-3_3-UAAUGA_x.pdb.gz
MCSYM-DB/3_3/UAAUGG/
MCSYM-DB/3_3/UAAUGG/3_3-UAAUGG.mcs
MCSYM-DB/3_3/UAAUGU/
MCSYM-DB/3_3/UAAUGU/3_3-UAAUGU.mcs
MCSYM-DB/3_3/UAAUUA/
MCSYM-DB/3_3/UAAUUA/3_3-UAAUUA.mcs
MCSYM-DB/3_3/UAAUUA/ds-3_3-UAAUUA_x.pdb.gz
MCSYM-DB/3_3/UAAUUG/
MCSYM-DB/3_3/UAAUUG/3_3-UAAUUG.mcs
MCSYM-DB/3_3/UAAUUU/
MCSYM-DB/3_3/UAAUUU/3_3-UAAUUU.mcs
MCSYM-DB/3_3/UACAAA/
MCSYM-DB/3_3/UACAAA/3_3-UACAAA.mcs
MCSYM-DB/3_3/UACACA/
MCSYM-DB/3_3/UACACA/3_3-UACACA.mcs
MCSYM-DB/3_3/UACACU/
MCSYM-DB/3_3/UACACU/3_3-UACACU.mcs
MCSYM-DB/3_3/UACAUA/
MCSYM-DB/3_3/UACAUA/3_3-UACAUA.mcs
MCSYM-DB/3_3/UACAUG/
MCSYM-DB/3_3/UACAUG/3_3-UACAUG.mcs
MCSYM-DB/3_3/UACCAA/
MCSYM-DB/3_3/UACCAA/3_3-UACCAA.mcs
MCSYM-DB/3_3/UACCUA/
MCSYM-DB/3_3/UACCUA/3_3-UACCUA.mcs
MCSYM-DB/3_3/UACCUG/
MCSYM-DB/3_3/UACCUG/3_3-UACCUG.mcs
MCSYM-DB/3_3/UACCUU/
MCSYM-DB/3_3/UACCUU/3_3-UACCUU.mcs
MCSYM-DB/3_3/UACGAA/
MCSYM-DB/3_3/UACGAA/1MNX_model_1.pdb.gz
MCSYM-DB/3_3/UACGAA/3_3-UACGAA.mcs
MCSYM-DB/3_3/UACGAA/ds-3_3-UACGAA_x.pdb.gz
MCSYM-DB/3_3/UACGAC/
MCSYM-DB/3_3/UACGAC/3_3-UACGAC.mcs
MCSYM-DB/3_3/UACGAG/
MCSYM-DB/3_3/UACGAG/3_3-UACGAG.mcs
MCSYM-DB/3_3/UACGAG/ds-3_3-UACGAG_x.pdb.gz
MCSYM-DB/3_3/UACGCA/
MCSYM-DB/3_3/UACGCA/3_3-UACGCA.mcs
MCSYM-DB/3_3/UACGCA/ds-3_3-UACGCA_x.pdb.gz
MCSYM-DB/3_3/UACGCC/
MCSYM-DB/3_3/UACGCC/3_3-UACGCC.mcs
MCSYM-DB/3_3/UACGCG/
MCSYM-DB/3_3/UACGCG/3_3-UACGCG.mcs
MCSYM-DB/3_3/UACGCU/
MCSYM-DB/3_3/UACGCU/3_3-UACGCU.mcs
MCSYM-DB/3_3/UACGGA/
MCSYM-DB/3_3/UACGGA/3_3-UACGGA.mcs
MCSYM-DB/3_3/UACGGA/ds-3_3-UACGGA_x.pdb.gz
MCSYM-DB/3_3/UACGGG/
MCSYM-DB/3_3/UACGGG/3_3-UACGGG.mcs
MCSYM-DB/3_3/UACGUA/
MCSYM-DB/3_3/UACGUA/3_3-UACGUA.mcs
MCSYM-DB/3_3/UACGUA/ds-3_3-UACGUA_x.pdb.gz
MCSYM-DB/3_3/UACGUG/
MCSYM-DB/3_3/UACGUG/3_3-UACGUG.mcs
MCSYM-DB/3_3/UACGUU/
MCSYM-DB/3_3/UACGUU/3_3-UACGUU.mcs
MCSYM-DB/3_3/UACUAA/
MCSYM-DB/3_3/UACUAA/3_3-UACUAA.mcs
MCSYM-DB/3_3/UACUCA/
MCSYM-DB/3_3/UACUCA/3_3-UACUCA.mcs
MCSYM-DB/3_3/UACUGA/
MCSYM-DB/3_3/UACUGA/3_3-UACUGA.mcs
MCSYM-DB/3_3/UACUGG/
MCSYM-DB/3_3/UACUGG/3_3-UACUGG.mcs
MCSYM-DB/3_3/UACUUA/
MCSYM-DB/3_3/UACUUA/3_3-UACUUA.mcs
MCSYM-DB/3_3/UACUUU/
MCSYM-DB/3_3/UACUUU/3_3-UACUUU.mcs
MCSYM-DB/3_3/UAGAAA/
MCSYM-DB/3_3/UAGAAA/3_3-UAGAAA.mcs
MCSYM-DB/3_3/UAGAAA/ds-3_3-UAGAAA_x.pdb.gz
MCSYM-DB/3_3/UAGAAG/
MCSYM-DB/3_3/UAGAAG/3_3-UAGAAG.mcs
MCSYM-DB/3_3/UAGAAG/ds-3_3-UAGAAG_x.pdb.gz
MCSYM-DB/3_3/UAGACA/
MCSYM-DB/3_3/UAGACA/3_3-UAGACA.mcs
MCSYM-DB/3_3/UAGACG/
MCSYM-DB/3_3/UAGACG/3_3-UAGACG.mcs
MCSYM-DB/3_3/UAGAGA/
MCSYM-DB/3_3/UAGAGA/3_3-UAGAGA.mcs
MCSYM-DB/3_3/UAGAGC/
MCSYM-DB/3_3/UAGAGC/3_3-UAGAGC.mcs
MCSYM-DB/3_3/UAGAGU/
MCSYM-DB/3_3/UAGAGU/3_3-UAGAGU.mcs
MCSYM-DB/3_3/UAGAUA/
MCSYM-DB/3_3/UAGAUA/3_3-UAGAUA.mcs
MCSYM-DB/3_3/UAGAUA/ds-3_3-UAGAUA_x.pdb.gz
MCSYM-DB/3_3/UAGCAA/
MCSYM-DB/3_3/UAGCAA/3_3-UAGCAA.mcs
MCSYM-DB/3_3/UAGCAA/ds-3_3-UAGCAA_x.pdb.gz
MCSYM-DB/3_3/UAGCAG/
MCSYM-DB/3_3/UAGCAG/3_3-UAGCAG.mcs
MCSYM-DB/3_3/UAGCAG/ds-3_3-UAGCAG_x.pdb.gz
MCSYM-DB/3_3/UAGCCA/
MCSYM-DB/3_3/UAGCCA/3_3-UAGCCA.mcs
MCSYM-DB/3_3/UAGCCA/ds-3_3-UAGCCA_x.pdb.gz
MCSYM-DB/3_3/UAGCCC/
MCSYM-DB/3_3/UAGCCC/3_3-UAGCCC.mcs
MCSYM-DB/3_3/UAGCCC/ds-3_3-UAGCCC_x.pdb.gz
MCSYM-DB/3_3/UAGCCG/
MCSYM-DB/3_3/UAGCCG/3_3-UAGCCG.mcs
MCSYM-DB/3_3/UAGCCG/ds-3_3-UAGCCG_x.pdb.gz
MCSYM-DB/3_3/UAGCCU/
MCSYM-DB/3_3/UAGCCU/3_3-UAGCCU.mcs
MCSYM-DB/3_3/UAGCGA/
MCSYM-DB/3_3/UAGCGA/3_3-UAGCGA.mcs
MCSYM-DB/3_3/UAGCGA/ds-3_3-UAGCGA_x.pdb.gz
MCSYM-DB/3_3/UAGCGG/
MCSYM-DB/3_3/UAGCGG/3_3-UAGCGG.mcs
MCSYM-DB/3_3/UAGCUA/
MCSYM-DB/3_3/UAGCUA/3_3-UAGCUA.mcs
MCSYM-DB/3_3/UAGCUA/ds-3_3-UAGCUA_x.pdb.gz
MCSYM-DB/3_3/UAGCUG/
MCSYM-DB/3_3/UAGCUG/3_3-UAGCUG.mcs
MCSYM-DB/3_3/UAGCUU/
MCSYM-DB/3_3/UAGCUU/3_3-UAGCUU.mcs
MCSYM-DB/3_3/UAGGCA/
MCSYM-DB/3_3/UAGGCA/3_3-UAGGCA.mcs
MCSYM-DB/3_3/UAGGGA/
MCSYM-DB/3_3/UAGGGA/3_3-UAGGGA.mcs
MCSYM-DB/3_3/UAGGUA/
MCSYM-DB/3_3/UAGGUA/3_3-UAGGUA.mcs
MCSYM-DB/3_3/UAGUAA/
MCSYM-DB/3_3/UAGUAA/3_3-UAGUAA.mcs
MCSYM-DB/3_3/UAGUAA/ds-3_3-UAGUAA_x.pdb.gz
MCSYM-DB/3_3/UAGUCA/
MCSYM-DB/3_3/UAGUCA/3_3-UAGUCA.mcs
MCSYM-DB/3_3/UAGUCA/ds-3_3-UAGUCA_x.pdb.gz
MCSYM-DB/3_3/UAGUCU/
MCSYM-DB/3_3/UAGUCU/3_3-UAGUCU.mcs
MCSYM-DB/3_3/UAGUGA/
MCSYM-DB/3_3/UAGUGA/3_3-UAGUGA.mcs
MCSYM-DB/3_3/UAGUGG/
MCSYM-DB/3_3/UAGUGG/3_3-UAGUGG.mcs
MCSYM-DB/3_3/UAGUUA/
MCSYM-DB/3_3/UAGUUA/3_3-UAGUUA.mcs
MCSYM-DB/3_3/UAGUUC/
MCSYM-DB/3_3/UAGUUC/3_3-UAGUUC.mcs
MCSYM-DB/3_3/UAGUUG/
MCSYM-DB/3_3/UAGUUG/3_3-UAGUUG.mcs
MCSYM-DB/3_3/UAGUUU/
MCSYM-DB/3_3/UAGUUU/3_3-UAGUUU.mcs
MCSYM-DB/3_3/UAUAAA/
MCSYM-DB/3_3/UAUAAA/3_3-UAUAAA.mcs
MCSYM-DB/3_3/UAUAAG/
MCSYM-DB/3_3/UAUAAG/3_3-UAUAAG.mcs
MCSYM-DB/3_3/UAUAAG/ds-3_3-UAUAAG_x.pdb.gz
MCSYM-DB/3_3/UAUAAU/
MCSYM-DB/3_3/UAUAAU/3_3-UAUAAU.mcs
MCSYM-DB/3_3/UAUACA/
MCSYM-DB/3_3/UAUACA/3_3-UAUACA.mcs
MCSYM-DB/3_3/UAUACA/ds-3_3-UAUACA_x.pdb.gz
MCSYM-DB/3_3/UAUACC/
MCSYM-DB/3_3/UAUACC/3_3-UAUACC.mcs
MCSYM-DB/3_3/UAUACG/
MCSYM-DB/3_3/UAUACG/3_3-UAUACG.mcs
MCSYM-DB/3_3/UAUACG/ds-3_3-UAUACG_x.pdb.gz
MCSYM-DB/3_3/UAUAGA/
MCSYM-DB/3_3/UAUAGA/3_3-UAUAGA.mcs
MCSYM-DB/3_3/UAUAGA/ds-3_3-UAUAGA_x.pdb.gz
MCSYM-DB/3_3/UAUAGG/
MCSYM-DB/3_3/UAUAGG/3_3-UAUAGG.mcs
MCSYM-DB/3_3/UAUAGG/ds-3_3-UAUAGG_x.pdb.gz
MCSYM-DB/3_3/UAUAGU/
MCSYM-DB/3_3/UAUAGU/3_3-UAUAGU.mcs
MCSYM-DB/3_3/UAUAUA/
MCSYM-DB/3_3/UAUAUA/3_3-UAUAUA.mcs
MCSYM-DB/3_3/UAUAUA/ds-3_3-UAUAUA_x.pdb.gz
MCSYM-DB/3_3/UAUAUC/
MCSYM-DB/3_3/UAUAUC/3_3-UAUAUC.mcs
MCSYM-DB/3_3/UAUAUG/
MCSYM-DB/3_3/UAUAUG/3_3-UAUAUG.mcs
MCSYM-DB/3_3/UAUAUG/ds-3_3-UAUAUG_x.pdb.gz
MCSYM-DB/3_3/UAUAUU/
MCSYM-DB/3_3/UAUAUU/3_3-UAUAUU.mcs
MCSYM-DB/3_3/UAUCAA/
MCSYM-DB/3_3/UAUCAA/3_3-UAUCAA.mcs
MCSYM-DB/3_3/UAUCCA/
MCSYM-DB/3_3/UAUCCA/3_3-UAUCCA.mcs
MCSYM-DB/3_3/UAUCUA/
MCSYM-DB/3_3/UAUCUA/3_3-UAUCUA.mcs
MCSYM-DB/3_3/UAUCUC/
MCSYM-DB/3_3/UAUCUC/3_3-UAUCUC.mcs
MCSYM-DB/3_3/UAUGAA/
MCSYM-DB/3_3/UAUGAA/3_3-UAUGAA.mcs
MCSYM-DB/3_3/UAUGCA/
MCSYM-DB/3_3/UAUGCA/3_3-UAUGCA.mcs
MCSYM-DB/3_3/UAUGGA/
MCSYM-DB/3_3/UAUGGA/3_3-UAUGGA.mcs
MCSYM-DB/3_3/UAUGGA/ds-3_3-UAUGGA_x.pdb.gz
MCSYM-DB/3_3/UAUGGG/
MCSYM-DB/3_3/UAUGGG/3_3-UAUGGG.mcs
MCSYM-DB/3_3/UAUGGG/ds-3_3-UAUGGG_x.pdb.gz
MCSYM-DB/3_3/UAUGUA/
MCSYM-DB/3_3/UAUGUA/3_3-UAUGUA.mcs
MCSYM-DB/3_3/UAUGUA/ds-3_3-UAUGUA_x.pdb.gz
MCSYM-DB/3_3/UAUGUG/
MCSYM-DB/3_3/UAUGUG/3_3-UAUGUG.mcs
MCSYM-DB/3_3/UAUUAA/
MCSYM-DB/3_3/UAUUAA/3_3-UAUUAA.mcs
MCSYM-DB/3_3/UAUUCA/
MCSYM-DB/3_3/UAUUCA/3_3-UAUUCA.mcs
MCSYM-DB/3_3/UAUUCA/ds-3_3-UAUUCA_x.pdb.gz
MCSYM-DB/3_3/UAUUGA/
MCSYM-DB/3_3/UAUUGA/3_3-UAUUGA.mcs
MCSYM-DB/3_3/UAUUGA/ds-3_3-UAUUGA_x.pdb.gz
MCSYM-DB/3_3/UAUUGG/
MCSYM-DB/3_3/UAUUGG/3_3-UAUUGG.mcs
MCSYM-DB/3_3/UAUUGU/
MCSYM-DB/3_3/UAUUGU/3_3-UAUUGU.mcs
MCSYM-DB/3_3/UAUUUA/
MCSYM-DB/3_3/UAUUUA/3_3-UAUUUA.mcs
MCSYM-DB/3_3/UCAAAA/
MCSYM-DB/3_3/UCAAAA/3_3-UCAAAA.mcs
MCSYM-DB/3_3/UCAAAU/
MCSYM-DB/3_3/UCAAAU/3_3-UCAAAU.mcs
MCSYM-DB/3_3/UCAACA/
MCSYM-DB/3_3/UCAACA/3_3-UCAACA.mcs
MCSYM-DB/3_3/UCAACC/
MCSYM-DB/3_3/UCAACC/3_3-UCAACC.mcs
MCSYM-DB/3_3/UCAACC/ds-3_3-UCAACC_x.pdb.gz
MCSYM-DB/3_3/UCAAUA/
MCSYM-DB/3_3/UCAAUA/3_3-UCAAUA.mcs
MCSYM-DB/3_3/UCACAA/
MCSYM-DB/3_3/UCACAA/3_3-UCACAA.mcs
MCSYM-DB/3_3/UCACCA/
MCSYM-DB/3_3/UCACCA/3_3-UCACCA.mcs
MCSYM-DB/3_3/UCACGA/
MCSYM-DB/3_3/UCACGA/3_3-UCACGA.mcs
MCSYM-DB/3_3/UCACGU/
MCSYM-DB/3_3/UCACGU/3_3-UCACGU.mcs
MCSYM-DB/3_3/UCACUC/
MCSYM-DB/3_3/UCACUC/3_3-UCACUC.mcs
MCSYM-DB/3_3/UCACUG/
MCSYM-DB/3_3/UCACUG/3_3-UCACUG.mcs
MCSYM-DB/3_3/UCAGCA/
MCSYM-DB/3_3/UCAGCA/3_3-UCAGCA.mcs
MCSYM-DB/3_3/UCAGGA/
MCSYM-DB/3_3/UCAGGA/3_3-UCAGGA.mcs
MCSYM-DB/3_3/UCAGUA/
MCSYM-DB/3_3/UCAGUA/3_3-UCAGUA.mcs
MCSYM-DB/3_3/UCAGUC/
MCSYM-DB/3_3/UCAGUC/3_3-UCAGUC.mcs
MCSYM-DB/3_3/UCAGUG/
MCSYM-DB/3_3/UCAGUG/3_3-UCAGUG.mcs
MCSYM-DB/3_3/UCAUAA/
MCSYM-DB/3_3/UCAUAA/3_3-UCAUAA.mcs
MCSYM-DB/3_3/UCAUAA/ds-3_3-UCAUAA_x.pdb.gz
MCSYM-DB/3_3/UCAUAG/
MCSYM-DB/3_3/UCAUAG/3_3-UCAUAG.mcs
MCSYM-DB/3_3/UCAUAG/ds-3_3-UCAUAG_x.pdb
MCSYM-DB/3_3/UCAUAG/ds-3_3-UCAUAG_x.pdb.gz
MCSYM-DB/3_3/UCAUAU/
MCSYM-DB/3_3/UCAUAU/3_3-UCAUAU.mcs
MCSYM-DB/3_3/UCAUCA/
MCSYM-DB/3_3/UCAUCA/3_3-UCAUCA.mcs
MCSYM-DB/3_3/UCAUCA/ds-3_3-UCAUCA_x.pdb.gz
MCSYM-DB/3_3/UCAUCG/
MCSYM-DB/3_3/UCAUCG/3_3-UCAUCG.mcs
MCSYM-DB/3_3/UCAUCU/
MCSYM-DB/3_3/UCAUCU/3_3-UCAUCU.mcs
MCSYM-DB/3_3/UCAUGA/
MCSYM-DB/3_3/UCAUGA/3_3-UCAUGA.mcs
MCSYM-DB/3_3/UCAUGG/
MCSYM-DB/3_3/UCAUGG/3_3-UCAUGG.mcs
MCSYM-DB/3_3/UCAUGG/ds-3_3-UCAUGG_x.pdb.gz
MCSYM-DB/3_3/UCAUGU/
MCSYM-DB/3_3/UCAUGU/3_3-UCAUGU.mcs
MCSYM-DB/3_3/UCAUUA/
MCSYM-DB/3_3/UCAUUA/3_3-UCAUUA.mcs
MCSYM-DB/3_3/UCAUUA/ds-3_3-UCAUUA_x.pdb.gz
MCSYM-DB/3_3/UCAUUC/
MCSYM-DB/3_3/UCAUUC/3_3-UCAUUC.mcs
MCSYM-DB/3_3/UCAUUG/
MCSYM-DB/3_3/UCAUUG/3_3-UCAUUG.mcs
MCSYM-DB/3_3/UCAUUG/ds-3_3-UCAUUG_x.pdb.gz
MCSYM-DB/3_3/UCAUUU/
MCSYM-DB/3_3/UCAUUU/3_3-UCAUUU.mcs
MCSYM-DB/3_3/UCCAAA/
MCSYM-DB/3_3/UCCAAA/3_3-UCCAAA.mcs
MCSYM-DB/3_3/UCCAAG/
MCSYM-DB/3_3/UCCAAG/3_3-UCCAAG.mcs
MCSYM-DB/3_3/UCCACA/
MCSYM-DB/3_3/UCCACA/3_3-UCCACA.mcs
MCSYM-DB/3_3/UCCACC/
MCSYM-DB/3_3/UCCACC/3_3-UCCACC.mcs
MCSYM-DB/3_3/UCCACG/
MCSYM-DB/3_3/UCCACG/3_3-UCCACG.mcs
MCSYM-DB/3_3/UCCAGA/
MCSYM-DB/3_3/UCCAGA/3_3-UCCAGA.mcs
MCSYM-DB/3_3/UCCAGC/
MCSYM-DB/3_3/UCCAGC/3_3-UCCAGC.mcs
MCSYM-DB/3_3/UCCCAA/
MCSYM-DB/3_3/UCCCAA/3_3-UCCCAA.mcs
MCSYM-DB/3_3/UCCCAC/
MCSYM-DB/3_3/UCCCAC/3_3-UCCCAC.mcs
MCSYM-DB/3_3/UCCCCC/
MCSYM-DB/3_3/UCCCCC/3_3-UCCCCC.mcs
MCSYM-DB/3_3/UCCCCU/
MCSYM-DB/3_3/UCCCCU/3_3-UCCCCU.mcs
MCSYM-DB/3_3/UCCCCU/ds-3_3-UCCCCU_x.pdb.gz
MCSYM-DB/3_3/UCCCUA/
MCSYM-DB/3_3/UCCCUA/3_3-UCCCUA.mcs
MCSYM-DB/3_3/UCCGAA/
MCSYM-DB/3_3/UCCGAA/3_3-UCCGAA.mcs
MCSYM-DB/3_3/UCCGAA/ds-3_3-UCCGAA_x.pdb.gz
MCSYM-DB/3_3/UCCGAC/
MCSYM-DB/3_3/UCCGAC/3_3-UCCGAC.mcs
MCSYM-DB/3_3/UCCGAG/
MCSYM-DB/3_3/UCCGAG/3_3-UCCGAG.mcs
MCSYM-DB/3_3/UCCGAU/
MCSYM-DB/3_3/UCCGAU/3_3-UCCGAU.mcs
MCSYM-DB/3_3/UCCGCA/
MCSYM-DB/3_3/UCCGCA/3_3-UCCGCA.mcs
MCSYM-DB/3_3/UCCGCA/ds-3_3-UCCGCA_x.pdb.gz
MCSYM-DB/3_3/UCCGCG/
MCSYM-DB/3_3/UCCGCG/3_3-UCCGCG.mcs
MCSYM-DB/3_3/UCCGCU/
MCSYM-DB/3_3/UCCGCU/3_3-UCCGCU.mcs
MCSYM-DB/3_3/UCCGCU/ds-3_3-UCCGCU_x.pdb.gz
MCSYM-DB/3_3/UCCGGA/
MCSYM-DB/3_3/UCCGGA/3_3-UCCGGA.mcs
MCSYM-DB/3_3/UCCGGA/ds-3_3-UCCGGA_x.pdb.gz
MCSYM-DB/3_3/UCCGGC/
MCSYM-DB/3_3/UCCGGC/3_3-UCCGGC.mcs
MCSYM-DB/3_3/UCCGGG/
MCSYM-DB/3_3/UCCGGG/3_3-UCCGGG.mcs
MCSYM-DB/3_3/UCCGUA/
MCSYM-DB/3_3/UCCGUA/3_3-UCCGUA.mcs
MCSYM-DB/3_3/UCCGUA/ds-3_3-UCCGUA_x.pdb.gz
MCSYM-DB/3_3/UCCGUC/
MCSYM-DB/3_3/UCCGUC/3_3-UCCGUC.mcs
MCSYM-DB/3_3/UCCGUC/ds-3_3-UCCGUC_x.pdb.gz
MCSYM-DB/3_3/UCCGUG/
MCSYM-DB/3_3/UCCGUG/3_3-UCCGUG.mcs
MCSYM-DB/3_3/UCCGUG/ds-3_3-UCCGUG_x.pdb.gz
MCSYM-DB/3_3/UCCGUU/
MCSYM-DB/3_3/UCCGUU/3_3-UCCGUU.mcs
MCSYM-DB/3_3/UCCGUU/ds-3_3-UCCGUU_x.pdb.gz
MCSYM-DB/3_3/UCCUGA/
MCSYM-DB/3_3/UCCUGA/3_3-UCCUGA.mcs
MCSYM-DB/3_3/UCCUUA/
MCSYM-DB/3_3/UCCUUA/3_3-UCCUUA.mcs
MCSYM-DB/3_3/UCGAUA/
MCSYM-DB/3_3/UCGAUA/3_3-UCGAUA.mcs
MCSYM-DB/3_3/UCGCAA/
MCSYM-DB/3_3/UCGCAA/3_3-UCGCAA.mcs
MCSYM-DB/3_3/UCGCAA/ds-3_3-UCGCAA_x.pdb.gz
MCSYM-DB/3_3/UCGCAU/
MCSYM-DB/3_3/UCGCAU/3_3-UCGCAU.mcs
MCSYM-DB/3_3/UCGCCA/
MCSYM-DB/3_3/UCGCCA/3_3-UCGCCA.mcs
MCSYM-DB/3_3/UCGCCA/ds-3_3-UCGCCA_x.pdb.gz
MCSYM-DB/3_3/UCGCCC/
MCSYM-DB/3_3/UCGCCC/3_3-UCGCCC.mcs
MCSYM-DB/3_3/UCGCGA/
MCSYM-DB/3_3/UCGCGA/3_3-UCGCGA.mcs
MCSYM-DB/3_3/UCGCGA/ds-3_3-UCGCGA_x.pdb.gz
MCSYM-DB/3_3/UCGCGG/
MCSYM-DB/3_3/UCGCGG/3_3-UCGCGG.mcs
MCSYM-DB/3_3/UCGCGG/ds-3_3-UCGCGG_x.pdb.gz
MCSYM-DB/3_3/UCGCUA/
MCSYM-DB/3_3/UCGCUA/3_3-UCGCUA.mcs
MCSYM-DB/3_3/UCGCUA/ds-3_3-UCGCUA_x.pdb.gz
MCSYM-DB/3_3/UCGCUC/
MCSYM-DB/3_3/UCGCUC/3_3-UCGCUC.mcs
MCSYM-DB/3_3/UCGCUG/
MCSYM-DB/3_3/UCGCUG/3_3-UCGCUG.mcs
MCSYM-DB/3_3/UCGCUG/ds-3_3-UCGCUG_x.pdb.gz
MCSYM-DB/3_3/UCGCUU/
MCSYM-DB/3_3/UCGCUU/3_3-UCGCUU.mcs
MCSYM-DB/3_3/UCGCUU/ds-3_3-UCGCUU_x.pdb.gz
MCSYM-DB/3_3/UCGGAA/
MCSYM-DB/3_3/UCGGAA/3_3-UCGGAA.mcs
MCSYM-DB/3_3/UCGUAA/
MCSYM-DB/3_3/UCGUAA/3_3-UCGUAA.mcs
MCSYM-DB/3_3/UCGUAC/
MCSYM-DB/3_3/UCGUAC/3_3-UCGUAC.mcs
MCSYM-DB/3_3/UCGUCA/
MCSYM-DB/3_3/UCGUCA/3_3-UCGUCA.mcs
MCSYM-DB/3_3/UCGUCG/
MCSYM-DB/3_3/UCGUCG/3_3-UCGUCG.mcs
MCSYM-DB/3_3/UCGUCU/
MCSYM-DB/3_3/UCGUCU/3_3-UCGUCU.mcs
MCSYM-DB/3_3/UCGUUA/
MCSYM-DB/3_3/UCGUUA/3_3-UCGUUA.mcs
MCSYM-DB/3_3/UCGUUU/
MCSYM-DB/3_3/UCGUUU/3_3-UCGUUU.mcs
MCSYM-DB/3_3/UCUAAA/
MCSYM-DB/3_3/UCUAAA/3_3-UCUAAA.mcs
MCSYM-DB/3_3/UCUAAA/ds-3_3-UCUAAA_x.pdb.gz
MCSYM-DB/3_3/UCUAAC/
MCSYM-DB/3_3/UCUAAC/3_3-UCUAAC.mcs
MCSYM-DB/3_3/UCUAAG/
MCSYM-DB/3_3/UCUAAG/3_3-UCUAAG.mcs
MCSYM-DB/3_3/UCUAAG/ds-3_3-UCUAAG_x.pdb.gz
MCSYM-DB/3_3/UCUAAU/
MCSYM-DB/3_3/UCUAAU/3_3-UCUAAU.mcs
MCSYM-DB/3_3/UCUACA/
MCSYM-DB/3_3/UCUACA/3_3-UCUACA.mcs
MCSYM-DB/3_3/UCUACA/ds-3_3-UCUACA_x.pdb.gz
MCSYM-DB/3_3/UCUACG/
MCSYM-DB/3_3/UCUACG/3_3-UCUACG.mcs
MCSYM-DB/3_3/UCUACU/
MCSYM-DB/3_3/UCUACU/3_3-UCUACU.mcs
MCSYM-DB/3_3/UCUAGA/
MCSYM-DB/3_3/UCUAGA/3_3-UCUAGA.mcs
MCSYM-DB/3_3/UCUAGC/
MCSYM-DB/3_3/UCUAGC/3_3-UCUAGC.mcs
MCSYM-DB/3_3/UCUAGG/
MCSYM-DB/3_3/UCUAGG/3_3-UCUAGG.mcs
MCSYM-DB/3_3/UCUAGU/
MCSYM-DB/3_3/UCUAGU/3_3-UCUAGU.mcs
MCSYM-DB/3_3/UCUAUA/
MCSYM-DB/3_3/UCUAUA/3_3-UCUAUA.mcs
MCSYM-DB/3_3/UCUAUA/ds-3_3-UCUAUA_x.pdb.gz
MCSYM-DB/3_3/UCUAUC/
MCSYM-DB/3_3/UCUAUC/3_3-UCUAUC.mcs
MCSYM-DB/3_3/UCUAUC/ds-3_3-UCUAUC_x.pdb.gz
MCSYM-DB/3_3/UCUAUG/
MCSYM-DB/3_3/UCUAUG/3_3-UCUAUG.mcs
MCSYM-DB/3_3/UCUAUG/ds-3_3-UCUAUG_x.pdb.gz
MCSYM-DB/3_3/UCUAUU/
MCSYM-DB/3_3/UCUAUU/3_3-UCUAUU.mcs
MCSYM-DB/3_3/UCUAUU/ds-3_3-UCUAUU_x.pdb.gz
MCSYM-DB/3_3/UCUCAA/
MCSYM-DB/3_3/UCUCAA/3_3-UCUCAA.mcs
MCSYM-DB/3_3/UCUCAC/
MCSYM-DB/3_3/UCUCAC/3_3-UCUCAC.mcs
MCSYM-DB/3_3/UCUCAG/
MCSYM-DB/3_3/UCUCAG/3_3-UCUCAG.mcs
MCSYM-DB/3_3/UCUCCA/
MCSYM-DB/3_3/UCUCCA/3_3-UCUCCA.mcs
MCSYM-DB/3_3/UCUCUA/
MCSYM-DB/3_3/UCUCUA/3_3-UCUCUA.mcs
MCSYM-DB/3_3/UCUCUC/
MCSYM-DB/3_3/UCUCUC/3_3-UCUCUC.mcs
MCSYM-DB/3_3/UCUCUG/
MCSYM-DB/3_3/UCUCUG/3_3-UCUCUG.mcs
MCSYM-DB/3_3/UCUGAA/
MCSYM-DB/3_3/UCUGAA/3_3-UCUGAA.mcs
MCSYM-DB/3_3/UCUGCA/
MCSYM-DB/3_3/UCUGCA/3_3-UCUGCA.mcs
MCSYM-DB/3_3/UCUGGA/
MCSYM-DB/3_3/UCUGGA/3_3-UCUGGA.mcs
MCSYM-DB/3_3/UCUGGU/
MCSYM-DB/3_3/UCUGGU/3_3-UCUGGU.mcs
MCSYM-DB/3_3/UCUGUA/
MCSYM-DB/3_3/UCUGUA/3_3-UCUGUA.mcs
MCSYM-DB/3_3/UCUGUC/
MCSYM-DB/3_3/UCUGUC/3_3-UCUGUC.mcs
MCSYM-DB/3_3/UCUGUG/
MCSYM-DB/3_3/UCUGUG/3_3-UCUGUG.mcs
MCSYM-DB/3_3/UCUUAC/
MCSYM-DB/3_3/UCUUAC/3_3-UCUUAC.mcs
MCSYM-DB/3_3/UCUUCA/
MCSYM-DB/3_3/UCUUCA/3_3-UCUUCA.mcs
MCSYM-DB/3_3/UCUUGA/
MCSYM-DB/3_3/UCUUGA/3_3-UCUUGA.mcs
MCSYM-DB/3_3/UCUUGG/
MCSYM-DB/3_3/UCUUGG/3_3-UCUUGG.mcs
MCSYM-DB/3_3/UCUUUA/
MCSYM-DB/3_3/UCUUUA/3_3-UCUUUA.mcs
MCSYM-DB/3_3/UCUUUA/ds-3_3-UCUUUA_x.pdb.gz
MCSYM-DB/3_3/UCUUUG/
MCSYM-DB/3_3/UCUUUG/3_3-UCUUUG.mcs
MCSYM-DB/3_3/UCUUUG/ds-3_3-UCUUUG_x.pdb.gz
MCSYM-DB/3_3/UCUUUU/
MCSYM-DB/3_3/UCUUUU/3_3-UCUUUU.mcs
MCSYM-DB/3_3/UCUUUU/ds-3_3-UCUUUU_x.pdb.gz
MCSYM-DB/3_3/UGAAAA/
MCSYM-DB/3_3/UGAAAA/3_3-UGAAAA.mcs
MCSYM-DB/3_3/UGAAAG/
MCSYM-DB/3_3/UGAAAG/3_3-UGAAAG.mcs
MCSYM-DB/3_3/UGAAAU/
MCSYM-DB/3_3/UGAAAU/3_3-UGAAAU.mcs
MCSYM-DB/3_3/UGAACA/
MCSYM-DB/3_3/UGAACA/3_3-UGAACA.mcs
MCSYM-DB/3_3/UGAACG/
MCSYM-DB/3_3/UGAACG/3_3-UGAACG.mcs
MCSYM-DB/3_3/UGAACU/
MCSYM-DB/3_3/UGAACU/3_3-UGAACU.mcs
MCSYM-DB/3_3/UGAAGA/
MCSYM-DB/3_3/UGAAGA/3_3-UGAAGA.mcs
MCSYM-DB/3_3/UGAAGA/ds-3_3-UGAAGA_x.pdb.gz
MCSYM-DB/3_3/UGACAA/
MCSYM-DB/3_3/UGACAA/3_3-UGACAA.mcs
MCSYM-DB/3_3/UGACCA/
MCSYM-DB/3_3/UGACCA/3_3-UGACCA.mcs
MCSYM-DB/3_3/UGAGAA/
MCSYM-DB/3_3/UGAGAA/3_3-UGAGAA.mcs
MCSYM-DB/3_3/UGAGAG/
MCSYM-DB/3_3/UGAGAG/3_3-UGAGAG.mcs
MCSYM-DB/3_3/UGAGAU/
MCSYM-DB/3_3/UGAGAU/3_3-UGAGAU.mcs
MCSYM-DB/3_3/UGAGCA/
MCSYM-DB/3_3/UGAGCA/3_3-UGAGCA.mcs
MCSYM-DB/3_3/UGAGCC/
MCSYM-DB/3_3/UGAGCC/3_3-UGAGCC.mcs
MCSYM-DB/3_3/UGAGGA/
MCSYM-DB/3_3/UGAGGA/3_3-UGAGGA.mcs
MCSYM-DB/3_3/UGAGGG/
MCSYM-DB/3_3/UGAGGG/3_3-UGAGGG.mcs
MCSYM-DB/3_3/UGAGUA/
MCSYM-DB/3_3/UGAGUA/3_3-UGAGUA.mcs
MCSYM-DB/3_3/UGAUAA/
MCSYM-DB/3_3/UGAUAA/3_3-UGAUAA.mcs
MCSYM-DB/3_3/UGAUAA/ds-3_3-UGAUAA_x.pdb.gz
MCSYM-DB/3_3/UGAUAG/
MCSYM-DB/3_3/UGAUAG/3_3-UGAUAG.mcs
MCSYM-DB/3_3/UGAUAG/ds-3_3-UGAUAG_x.pdb.gz
MCSYM-DB/3_3/UGAUCA/
MCSYM-DB/3_3/UGAUCA/3_3-UGAUCA.mcs
MCSYM-DB/3_3/UGAUCC/
MCSYM-DB/3_3/UGAUCC/3_3-UGAUCC.mcs
MCSYM-DB/3_3/UGAUCG/
MCSYM-DB/3_3/UGAUCG/3_3-UGAUCG.mcs
MCSYM-DB/3_3/UGAUGA/
MCSYM-DB/3_3/UGAUGA/3_3-UGAUGA.mcs
MCSYM-DB/3_3/UGAUGA/ds-3_3-UGAUGA_x.pdb.gz
MCSYM-DB/3_3/UGAUGC/
MCSYM-DB/3_3/UGAUGC/3_3-UGAUGC.mcs
MCSYM-DB/3_3/UGAUGG/
MCSYM-DB/3_3/UGAUGG/3_3-UGAUGG.mcs
MCSYM-DB/3_3/UGAUUA/
MCSYM-DB/3_3/UGAUUA/3_3-UGAUUA.mcs
MCSYM-DB/3_3/UGAUUA/ds-3_3-UGAUUA_x.pdb.gz
MCSYM-DB/3_3/UGAUUC/
MCSYM-DB/3_3/UGAUUC/3_3-UGAUUC.mcs
MCSYM-DB/3_3/UGAUUG/
MCSYM-DB/3_3/UGAUUG/3_3-UGAUUG.mcs
MCSYM-DB/3_3/UGAUUG/ds-3_3-UGAUUG_x.pdb.gz
MCSYM-DB/3_3/UGAUUU/
MCSYM-DB/3_3/UGAUUU/3_3-UGAUUU.mcs
MCSYM-DB/3_3/UGCACA/
MCSYM-DB/3_3/UGCACA/3_3-UGCACA.mcs
MCSYM-DB/3_3/UGCAGA/
MCSYM-DB/3_3/UGCAGA/3_3-UGCAGA.mcs
MCSYM-DB/3_3/UGCAUA/
MCSYM-DB/3_3/UGCAUA/3_3-UGCAUA.mcs
MCSYM-DB/3_3/UGCAUA/ds-3_3-UGCAUA_x.pdb.gz
MCSYM-DB/3_3/UGCAUC/
MCSYM-DB/3_3/UGCAUC/3_3-UGCAUC.mcs
MCSYM-DB/3_3/UGCAUU/
MCSYM-DB/3_3/UGCAUU/3_3-UGCAUU.mcs
MCSYM-DB/3_3/UGCCAA/
MCSYM-DB/3_3/UGCCAA/3_3-UGCCAA.mcs
MCSYM-DB/3_3/UGCCCA/
MCSYM-DB/3_3/UGCCCA/3_3-UGCCCA.mcs
MCSYM-DB/3_3/UGCCUG/
MCSYM-DB/3_3/UGCCUG/3_3-UGCCUG.mcs
MCSYM-DB/3_3/UGCCUU/
MCSYM-DB/3_3/UGCCUU/3_3-UGCCUU.mcs
MCSYM-DB/3_3/UGCGAA/
MCSYM-DB/3_3/UGCGAA/3_3-UGCGAA.mcs
MCSYM-DB/3_3/UGCGAA/ds-3_3-UGCGAA_x.pdb.gz
MCSYM-DB/3_3/UGCGAG/
MCSYM-DB/3_3/UGCGAG/3_3-UGCGAG.mcs
MCSYM-DB/3_3/UGCGAG/ds-3_3-UGCGAG_x.pdb.gz
MCSYM-DB/3_3/UGCGCA/
MCSYM-DB/3_3/UGCGCA/3_3-UGCGCA.mcs
MCSYM-DB/3_3/UGCGCA/ds-3_3-UGCGCA_x.pdb.gz
MCSYM-DB/3_3/UGCGCG/
MCSYM-DB/3_3/UGCGCG/3_3-UGCGCG.mcs
MCSYM-DB/3_3/UGCGCG/ds-3_3-UGCGCG_x.pdb.gz
MCSYM-DB/3_3/UGCGCU/
MCSYM-DB/3_3/UGCGCU/3_3-UGCGCU.mcs
MCSYM-DB/3_3/UGCGGA/
MCSYM-DB/3_3/UGCGGA/3_3-UGCGGA.mcs
MCSYM-DB/3_3/UGCGGA/ds-3_3-UGCGGA_x.pdb.gz
MCSYM-DB/3_3/UGCGGC/
MCSYM-DB/3_3/UGCGGC/3_3-UGCGGC.mcs
MCSYM-DB/3_3/UGCGGG/
MCSYM-DB/3_3/UGCGGG/3_3-UGCGGG.mcs
MCSYM-DB/3_3/UGCGGU/
MCSYM-DB/3_3/UGCGGU/3_3-UGCGGU.mcs
MCSYM-DB/3_3/UGCGUA/
MCSYM-DB/3_3/UGCGUA/3_3-UGCGUA.mcs
MCSYM-DB/3_3/UGCGUG/
MCSYM-DB/3_3/UGCGUG/3_3-UGCGUG.mcs
MCSYM-DB/3_3/UGCGUG/ds-3_3-UGCGUG_x.pdb.gz
MCSYM-DB/3_3/UGCGUU/
MCSYM-DB/3_3/UGCGUU/3_3-UGCGUU.mcs
MCSYM-DB/3_3/UGCUCA/
MCSYM-DB/3_3/UGCUCA/3_3-UGCUCA.mcs
MCSYM-DB/3_3/UGCUGA/
MCSYM-DB/3_3/UGCUGA/3_3-UGCUGA.mcs
MCSYM-DB/3_3/UGCUGG/
MCSYM-DB/3_3/UGCUGG/3_3-UGCUGG.mcs
MCSYM-DB/3_3/UGCUUG/
MCSYM-DB/3_3/UGCUUG/3_3-UGCUUG.mcs
MCSYM-DB/3_3/UGCUUU/
MCSYM-DB/3_3/UGCUUU/3_3-UGCUUU.mcs
MCSYM-DB/3_3/UGGAAA/
MCSYM-DB/3_3/UGGAAA/3_3-UGGAAA.mcs
MCSYM-DB/3_3/UGGAAA/ds-3_3-UGGAAA_x.pdb.gz
MCSYM-DB/3_3/UGGAAU/
MCSYM-DB/3_3/UGGAAU/3_3-UGGAAU.mcs
MCSYM-DB/3_3/UGGACA/
MCSYM-DB/3_3/UGGACA/3_3-UGGACA.mcs
MCSYM-DB/3_3/UGGAGA/
MCSYM-DB/3_3/UGGAGA/3_3-UGGAGA.mcs
MCSYM-DB/3_3/UGGAGG/
MCSYM-DB/3_3/UGGAGG/3_3-UGGAGG.mcs
MCSYM-DB/3_3/UGGAGG/ds-3_3-UGGAGG_x.pdb.gz
MCSYM-DB/3_3/UGGAUA/
MCSYM-DB/3_3/UGGAUA/3_3-UGGAUA.mcs
MCSYM-DB/3_3/UGGAUA/ds-3_3-UGGAUA_x.pdb.gz
MCSYM-DB/3_3/UGGAUG/
MCSYM-DB/3_3/UGGAUG/1XMQ_model_1.pdb.gz
MCSYM-DB/3_3/UGGAUG/2TOB_model_1.pdb.gz
MCSYM-DB/3_3/UGGAUG/3_3-UGGAUG.mcs
MCSYM-DB/3_3/UGGAUU/
MCSYM-DB/3_3/UGGAUU/3_3-UGGAUU.mcs
MCSYM-DB/3_3/UGGCAA/
MCSYM-DB/3_3/UGGCAA/3_3-UGGCAA.mcs
MCSYM-DB/3_3/UGGCAA/ds-3_3-UGGCAA_x.pdb.gz
MCSYM-DB/3_3/UGGCAC/
MCSYM-DB/3_3/UGGCAC/3_3-UGGCAC.mcs
MCSYM-DB/3_3/UGGCAG/
MCSYM-DB/3_3/UGGCAG/3_3-UGGCAG.mcs
MCSYM-DB/3_3/UGGCAU/
MCSYM-DB/3_3/UGGCAU/3_3-UGGCAU.mcs
MCSYM-DB/3_3/UGGCCA/
MCSYM-DB/3_3/UGGCCA/3_3-UGGCCA.mcs
MCSYM-DB/3_3/UGGCCA/ds-3_3-UGGCCA_x.pdb.gz
MCSYM-DB/3_3/UGGCCC/
MCSYM-DB/3_3/UGGCCC/3_3-UGGCCC.mcs
MCSYM-DB/3_3/UGGCCG/
MCSYM-DB/3_3/UGGCCG/3_3-UGGCCG.mcs
MCSYM-DB/3_3/UGGCGA/
MCSYM-DB/3_3/UGGCGA/3_3-UGGCGA.mcs
MCSYM-DB/3_3/UGGCGA/ds-3_3-UGGCGA_x.pdb.gz
MCSYM-DB/3_3/UGGCGG/
MCSYM-DB/3_3/UGGCGG/3_3-UGGCGG.mcs
MCSYM-DB/3_3/UGGCGG/ds-3_3-UGGCGG_x.pdb.gz
MCSYM-DB/3_3/UGGCUA/
MCSYM-DB/3_3/UGGCUA/3_3-UGGCUA.mcs
MCSYM-DB/3_3/UGGCUA/ds-3_3-UGGCUA_x.pdb.gz
MCSYM-DB/3_3/UGGCUG/
MCSYM-DB/3_3/UGGCUG/3_3-UGGCUG.mcs
MCSYM-DB/3_3/UGGCUU/
MCSYM-DB/3_3/UGGCUU/3_3-UGGCUU.mcs
MCSYM-DB/3_3/UGGGAG/
MCSYM-DB/3_3/UGGGAG/3_3-UGGGAG.mcs
MCSYM-DB/3_3/UGGGUA/
MCSYM-DB/3_3/UGGGUA/3_3-UGGGUA.mcs
MCSYM-DB/3_3/UGGGUG/
MCSYM-DB/3_3/UGGGUG/3_3-UGGGUG.mcs
MCSYM-DB/3_3/UGGUAG/
MCSYM-DB/3_3/UGGUAG/3_3-UGGUAG.mcs
MCSYM-DB/3_3/UGGUCA/
MCSYM-DB/3_3/UGGUCA/3_3-UGGUCA.mcs
MCSYM-DB/3_3/UGGUGA/
MCSYM-DB/3_3/UGGUGA/3_3-UGGUGA.mcs
MCSYM-DB/3_3/UGGUGA/ds-3_3-UGGUGA_x.pdb.gz
MCSYM-DB/3_3/UGGUGC/
MCSYM-DB/3_3/UGGUGC/3_3-UGGUGC.mcs
MCSYM-DB/3_3/UGGUGG/
MCSYM-DB/3_3/UGGUGG/3_3-UGGUGG.mcs
MCSYM-DB/3_3/UGGUGU/
MCSYM-DB/3_3/UGGUGU/3_3-UGGUGU.mcs
MCSYM-DB/3_3/UGGUUA/
MCSYM-DB/3_3/UGGUUA/3_3-UGGUUA.mcs
MCSYM-DB/3_3/UGGUUG/
MCSYM-DB/3_3/UGGUUG/3_3-UGGUUG.mcs
MCSYM-DB/3_3/UGGUUU/
MCSYM-DB/3_3/UGGUUU/3_3-UGGUUU.mcs
MCSYM-DB/3_3/UGUAAA/
MCSYM-DB/3_3/UGUAAA/3_3-UGUAAA.mcs
MCSYM-DB/3_3/UGUAAA/ds-3_3-UGUAAA_x.pdb.gz
MCSYM-DB/3_3/UGUAAU/
MCSYM-DB/3_3/UGUAAU/3_3-UGUAAU.mcs
MCSYM-DB/3_3/UGUACA/
MCSYM-DB/3_3/UGUACA/3_3-UGUACA.mcs
MCSYM-DB/3_3/UGUACC/
MCSYM-DB/3_3/UGUACC/3_3-UGUACC.mcs
MCSYM-DB/3_3/UGUACG/
MCSYM-DB/3_3/UGUACG/3_3-UGUACG.mcs
MCSYM-DB/3_3/UGUACU/
MCSYM-DB/3_3/UGUACU/3_3-UGUACU.mcs
MCSYM-DB/3_3/UGUAGA/
MCSYM-DB/3_3/UGUAGA/3_3-UGUAGA.mcs
MCSYM-DB/3_3/UGUAGA/ds-3_3-UGUAGA_x.pdb.gz
MCSYM-DB/3_3/UGUAGG/
MCSYM-DB/3_3/UGUAGG/3_3-UGUAGG.mcs
MCSYM-DB/3_3/UGUAGG/ds-3_3-UGUAGG_x.pdb.gz
MCSYM-DB/3_3/UGUAGU/
MCSYM-DB/3_3/UGUAGU/3_3-UGUAGU.mcs
MCSYM-DB/3_3/UGUAUA/
MCSYM-DB/3_3/UGUAUA/3_3-UGUAUA.mcs
MCSYM-DB/3_3/UGUAUA/ds-3_3-UGUAUA_x.pdb.gz
MCSYM-DB/3_3/UGUAUC/
MCSYM-DB/3_3/UGUAUC/3_3-UGUAUC.mcs
MCSYM-DB/3_3/UGUAUG/
MCSYM-DB/3_3/UGUAUG/3_3-UGUAUG.mcs
MCSYM-DB/3_3/UGUAUG/ds-3_3-UGUAUG_x.pdb.gz
MCSYM-DB/3_3/UGUAUU/
MCSYM-DB/3_3/UGUAUU/3_3-UGUAUU.mcs
MCSYM-DB/3_3/UGUCAA/
MCSYM-DB/3_3/UGUCAA/3_3-UGUCAA.mcs
MCSYM-DB/3_3/UGUCAU/
MCSYM-DB/3_3/UGUCAU/3_3-UGUCAU.mcs
MCSYM-DB/3_3/UGUCCA/
MCSYM-DB/3_3/UGUCCA/3_3-UGUCCA.mcs
MCSYM-DB/3_3/UGUGAA/
MCSYM-DB/3_3/UGUGAA/3_3-UGUGAA.mcs
MCSYM-DB/3_3/UGUGCA/
MCSYM-DB/3_3/UGUGCA/3_3-UGUGCA.mcs
MCSYM-DB/3_3/UGUGGA/
MCSYM-DB/3_3/UGUGGA/3_3-UGUGGA.mcs
MCSYM-DB/3_3/UGUGGG/
MCSYM-DB/3_3/UGUGGG/3_3-UGUGGG.mcs
MCSYM-DB/3_3/UGUGGG/ds-3_3-UGUGGG_x.pdb.gz
MCSYM-DB/3_3/UGUGGU/
MCSYM-DB/3_3/UGUGGU/3_3-UGUGGU.mcs
MCSYM-DB/3_3/UGUGUA/
MCSYM-DB/3_3/UGUGUA/3_3-UGUGUA.mcs
MCSYM-DB/3_3/UGUGUG/
MCSYM-DB/3_3/UGUGUG/3_3-UGUGUG.mcs
MCSYM-DB/3_3/UGUGUU/
MCSYM-DB/3_3/UGUGUU/3_3-UGUGUU.mcs
MCSYM-DB/3_3/UGUUAA/
MCSYM-DB/3_3/UGUUAA/3_3-UGUUAA.mcs
MCSYM-DB/3_3/UGUUAG/
MCSYM-DB/3_3/UGUUAG/3_3-UGUUAG.mcs
MCSYM-DB/3_3/UGUUCA/
MCSYM-DB/3_3/UGUUCA/3_3-UGUUCA.mcs
MCSYM-DB/3_3/UGUUGA/
MCSYM-DB/3_3/UGUUGA/3_3-UGUUGA.mcs
MCSYM-DB/3_3/UGUUGG/
MCSYM-DB/3_3/UGUUGG/3_3-UGUUGG.mcs
MCSYM-DB/3_3/UGUUUA/
MCSYM-DB/3_3/UGUUUA/3_3-UGUUUA.mcs
MCSYM-DB/3_3/UGUUUA/ds-3_3-UGUUUA_x.pdb.gz
MCSYM-DB/3_3/UUAAAA/
MCSYM-DB/3_3/UUAAAA/3_3-UUAAAA.mcs
MCSYM-DB/3_3/UUAAAC/
MCSYM-DB/3_3/UUAAAC/3_3-UUAAAC.mcs
MCSYM-DB/3_3/UUAAAG/
MCSYM-DB/3_3/UUAAAG/3_3-UUAAAG.mcs
MCSYM-DB/3_3/UUAAAU/
MCSYM-DB/3_3/UUAAAU/3_3-UUAAAU.mcs
MCSYM-DB/3_3/UUAACA/
MCSYM-DB/3_3/UUAACA/3_3-UUAACA.mcs
MCSYM-DB/3_3/UUAACU/
MCSYM-DB/3_3/UUAACU/3_3-UUAACU.mcs
MCSYM-DB/3_3/UUAAGA/
MCSYM-DB/3_3/UUAAGA/3_3-UUAAGA.mcs
MCSYM-DB/3_3/UUAAUA/
MCSYM-DB/3_3/UUAAUA/3_3-UUAAUA.mcs
MCSYM-DB/3_3/UUAAUA/ds-3_3-UUAAUA_x.pdb.gz
MCSYM-DB/3_3/UUAAUG/
MCSYM-DB/3_3/UUAAUG/3_3-UUAAUG.mcs
MCSYM-DB/3_3/UUACAA/
MCSYM-DB/3_3/UUACAA/3_3-UUACAA.mcs
MCSYM-DB/3_3/UUACAC/
MCSYM-DB/3_3/UUACAC/3_3-UUACAC.mcs
MCSYM-DB/3_3/UUACCA/
MCSYM-DB/3_3/UUACCA/3_3-UUACCA.mcs
MCSYM-DB/3_3/UUACCG/
MCSYM-DB/3_3/UUACCG/3_3-UUACCG.mcs
MCSYM-DB/3_3/UUACCG/ds-3_3-UUACCG_x.pdb.gz
MCSYM-DB/3_3/UUACCU/
MCSYM-DB/3_3/UUACCU/3_3-UUACCU.mcs
MCSYM-DB/3_3/UUACCU/ds-3_3-UUACCU_x.pdb.gz
MCSYM-DB/3_3/UUACGG/
MCSYM-DB/3_3/UUACGG/3_3-UUACGG.mcs
MCSYM-DB/3_3/UUACGU/
MCSYM-DB/3_3/UUACGU/3_3-UUACGU.mcs
MCSYM-DB/3_3/UUACGU/ds-3_3-UUACGU_x.pdb.gz
MCSYM-DB/3_3/UUACUA/
MCSYM-DB/3_3/UUACUA/3_3-UUACUA.mcs
MCSYM-DB/3_3/UUACUU/
MCSYM-DB/3_3/UUACUU/3_3-UUACUU.mcs
MCSYM-DB/3_3/UUAGGA/
MCSYM-DB/3_3/UUAGGA/3_3-UUAGGA.mcs
MCSYM-DB/3_3/UUAGUA/
MCSYM-DB/3_3/UUAGUA/3_3-UUAGUA.mcs
MCSYM-DB/3_3/UUAUAA/
MCSYM-DB/3_3/UUAUAA/3_3-UUAUAA.mcs
MCSYM-DB/3_3/UUAUAA/ds-3_3-UUAUAA_x.pdb.gz
MCSYM-DB/3_3/UUAUAC/
MCSYM-DB/3_3/UUAUAC/3_3-UUAUAC.mcs
MCSYM-DB/3_3/UUAUAG/
MCSYM-DB/3_3/UUAUAG/3_3-UUAUAG.mcs
MCSYM-DB/3_3/UUAUAG/ds-3_3-UUAUAG_x.pdb.gz
MCSYM-DB/3_3/UUAUAU/
MCSYM-DB/3_3/UUAUAU/3_3-UUAUAU.mcs
MCSYM-DB/3_3/UUAUCA/
MCSYM-DB/3_3/UUAUCA/3_3-UUAUCA.mcs
MCSYM-DB/3_3/UUAUCA/ds-3_3-UUAUCA_x.pdb.gz
MCSYM-DB/3_3/UUAUCU/
MCSYM-DB/3_3/UUAUCU/3_3-UUAUCU.mcs
MCSYM-DB/3_3/UUAUGA/
MCSYM-DB/3_3/UUAUGA/3_3-UUAUGA.mcs
MCSYM-DB/3_3/UUAUGA/ds-3_3-UUAUGA_x.pdb.gz
MCSYM-DB/3_3/UUAUGC/
MCSYM-DB/3_3/UUAUGC/3_3-UUAUGC.mcs
MCSYM-DB/3_3/UUAUGG/
MCSYM-DB/3_3/UUAUGG/3_3-UUAUGG.mcs
MCSYM-DB/3_3/UUAUGG/ds-3_3-UUAUGG_x.pdb.gz
MCSYM-DB/3_3/UUAUUA/
MCSYM-DB/3_3/UUAUUA/3_3-UUAUUA.mcs
MCSYM-DB/3_3/UUAUUA/ds-3_3-UUAUUA_x.pdb.gz
MCSYM-DB/3_3/UUAUUC/
MCSYM-DB/3_3/UUAUUC/3_3-UUAUUC.mcs
MCSYM-DB/3_3/UUAUUC/ds-3_3-UUAUUC_x.pdb.gz
MCSYM-DB/3_3/UUAUUG/
MCSYM-DB/3_3/UUAUUG/3_3-UUAUUG.mcs
MCSYM-DB/3_3/UUAUUG/ds-3_3-UUAUUG_x.pdb.gz
MCSYM-DB/3_3/UUAUUU/
MCSYM-DB/3_3/UUAUUU/3_3-UUAUUU.mcs
MCSYM-DB/3_3/UUAUUU/ds-3_3-UUAUUU_x.pdb.gz
MCSYM-DB/3_3/UUCAAA/
MCSYM-DB/3_3/UUCAAA/3_3-UUCAAA.mcs
MCSYM-DB/3_3/UUCAAG/
MCSYM-DB/3_3/UUCAAG/3_3-UUCAAG.mcs
MCSYM-DB/3_3/UUCACA/
MCSYM-DB/3_3/UUCACA/3_3-UUCACA.mcs
MCSYM-DB/3_3/UUCAGA/
MCSYM-DB/3_3/UUCAGA/3_3-UUCAGA.mcs
MCSYM-DB/3_3/UUCAUA/
MCSYM-DB/3_3/UUCAUA/3_3-UUCAUA.mcs
MCSYM-DB/3_3/UUCCAA/
MCSYM-DB/3_3/UUCCAA/3_3-UUCCAA.mcs
MCSYM-DB/3_3/UUCCGA/
MCSYM-DB/3_3/UUCCGA/3_3-UUCCGA.mcs
MCSYM-DB/3_3/UUCCUA/
MCSYM-DB/3_3/UUCCUA/3_3-UUCCUA.mcs
MCSYM-DB/3_3/UUCGAA/
MCSYM-DB/3_3/UUCGAA/3_3-UUCGAA.mcs
MCSYM-DB/3_3/UUCGAA/ds-3_3-UUCGAA_x.pdb.gz
MCSYM-DB/3_3/UUCGAC/
MCSYM-DB/3_3/UUCGAC/3_3-UUCGAC.mcs
MCSYM-DB/3_3/UUCGAG/
MCSYM-DB/3_3/UUCGAG/3_3-UUCGAG.mcs
MCSYM-DB/3_3/UUCGAU/
MCSYM-DB/3_3/UUCGAU/3_3-UUCGAU.mcs
MCSYM-DB/3_3/UUCGCA/
MCSYM-DB/3_3/UUCGCA/3_3-UUCGCA.mcs
MCSYM-DB/3_3/UUCGCA/ds-3_3-UUCGCA_x.pdb.gz
MCSYM-DB/3_3/UUCGCC/
MCSYM-DB/3_3/UUCGCC/3_3-UUCGCC.mcs
MCSYM-DB/3_3/UUCGCG/
MCSYM-DB/3_3/UUCGCG/3_3-UUCGCG.mcs
MCSYM-DB/3_3/UUCGCG/ds-3_3-UUCGCG_x.pdb.gz
MCSYM-DB/3_3/UUCGCU/
MCSYM-DB/3_3/UUCGCU/3_3-UUCGCU.mcs
MCSYM-DB/3_3/UUCGGA/
MCSYM-DB/3_3/UUCGGA/3_3-UUCGGA.mcs
MCSYM-DB/3_3/UUCGGA/ds-3_3-UUCGGA_x.pdb.gz
MCSYM-DB/3_3/UUCGGU/
MCSYM-DB/3_3/UUCGGU/3_3-UUCGGU.mcs
MCSYM-DB/3_3/UUCGUA/
MCSYM-DB/3_3/UUCGUA/3_3-UUCGUA.mcs
MCSYM-DB/3_3/UUCGUA/ds-3_3-UUCGUA_x.pdb.gz
MCSYM-DB/3_3/UUCGUC/
MCSYM-DB/3_3/UUCGUC/3_3-UUCGUC.mcs
MCSYM-DB/3_3/UUCGUC/ds-3_3-UUCGUC_x.pdb.gz
MCSYM-DB/3_3/UUCGUG/
MCSYM-DB/3_3/UUCGUG/3_3-UUCGUG.mcs
MCSYM-DB/3_3/UUCGUG/ds-3_3-UUCGUG_x.pdb.gz
MCSYM-DB/3_3/UUCGUU/
MCSYM-DB/3_3/UUCGUU/3_3-UUCGUU.mcs
MCSYM-DB/3_3/UUCGUU/ds-3_3-UUCGUU_x.pdb.gz
MCSYM-DB/3_3/UUCUAA/
MCSYM-DB/3_3/UUCUAA/3_3-UUCUAA.mcs
MCSYM-DB/3_3/UUCUAU/
MCSYM-DB/3_3/UUCUAU/3_3-UUCUAU.mcs
MCSYM-DB/3_3/UUCUCC/
MCSYM-DB/3_3/UUCUCC/3_3-UUCUCC.mcs
MCSYM-DB/3_3/UUCUGA/
MCSYM-DB/3_3/UUCUGA/3_3-UUCUGA.mcs
MCSYM-DB/3_3/UUGAAA/
MCSYM-DB/3_3/UUGAAA/3_3-UUGAAA.mcs
MCSYM-DB/3_3/UUGAAG/
MCSYM-DB/3_3/UUGAAG/3_3-UUGAAG.mcs
MCSYM-DB/3_3/UUGAAU/
MCSYM-DB/3_3/UUGAAU/3_3-UUGAAU.mcs
MCSYM-DB/3_3/UUGAAU/ds-3_3-UUGAAU_x.pdb.gz
MCSYM-DB/3_3/UUGACA/
MCSYM-DB/3_3/UUGACA/3_3-UUGACA.mcs
MCSYM-DB/3_3/UUGACU/
MCSYM-DB/3_3/UUGACU/3_3-UUGACU.mcs
MCSYM-DB/3_3/UUGAGA/
MCSYM-DB/3_3/UUGAGA/3_3-UUGAGA.mcs
MCSYM-DB/3_3/UUGAUA/
MCSYM-DB/3_3/UUGAUA/3_3-UUGAUA.mcs
MCSYM-DB/3_3/UUGAUA/ds-3_3-UUGAUA_x.pdb.gz
MCSYM-DB/3_3/UUGAUG/
MCSYM-DB/3_3/UUGAUG/3_3-UUGAUG.mcs
MCSYM-DB/3_3/UUGAUU/
MCSYM-DB/3_3/UUGAUU/3_3-UUGAUU.mcs
MCSYM-DB/3_3/UUGCAA/
MCSYM-DB/3_3/UUGCAA/3_3-UUGCAA.mcs
MCSYM-DB/3_3/UUGCAC/
MCSYM-DB/3_3/UUGCAC/3_3-UUGCAC.mcs
MCSYM-DB/3_3/UUGCAG/
MCSYM-DB/3_3/UUGCAG/3_3-UUGCAG.mcs
MCSYM-DB/3_3/UUGCAU/
MCSYM-DB/3_3/UUGCAU/3_3-UUGCAU.mcs
MCSYM-DB/3_3/UUGCCA/
MCSYM-DB/3_3/UUGCCA/3_3-UUGCCA.mcs
MCSYM-DB/3_3/UUGCCA/ds-3_3-UUGCCA_x.pdb.gz
MCSYM-DB/3_3/UUGCCG/
MCSYM-DB/3_3/UUGCCG/3_3-UUGCCG.mcs
MCSYM-DB/3_3/UUGCCG/ds-3_3-UUGCCG_x.pdb.gz
MCSYM-DB/3_3/UUGCCU/
MCSYM-DB/3_3/UUGCCU/3_3-UUGCCU.mcs
MCSYM-DB/3_3/UUGCGA/
MCSYM-DB/3_3/UUGCGA/3_3-UUGCGA.mcs
MCSYM-DB/3_3/UUGCGA/ds-3_3-UUGCGA_x.pdb.gz
MCSYM-DB/3_3/UUGCGG/
MCSYM-DB/3_3/UUGCGG/3_3-UUGCGG.mcs
MCSYM-DB/3_3/UUGCUA/
MCSYM-DB/3_3/UUGCUA/3_3-UUGCUA.mcs
MCSYM-DB/3_3/UUGCUA/ds-3_3-UUGCUA_x.pdb.gz
MCSYM-DB/3_3/UUGCUC/
MCSYM-DB/3_3/UUGCUC/3_3-UUGCUC.mcs
MCSYM-DB/3_3/UUGCUG/
MCSYM-DB/3_3/UUGCUG/3_3-UUGCUG.mcs
MCSYM-DB/3_3/UUGCUG/ds-3_3-UUGCUG_x.pdb.gz
MCSYM-DB/3_3/UUGCUU/
MCSYM-DB/3_3/UUGCUU/3_3-UUGCUU.mcs
MCSYM-DB/3_3/UUGCUU/ds-3_3-UUGCUU_x.pdb.gz
MCSYM-DB/3_3/UUGGAA/
MCSYM-DB/3_3/UUGGAA/3_3-UUGGAA.mcs
MCSYM-DB/3_3/UUGGAG/
MCSYM-DB/3_3/UUGGAG/3_3-UUGGAG.mcs
MCSYM-DB/3_3/UUGGAG/ds-3_3-UUGGAG_x.pdb.gz
MCSYM-DB/3_3/UUGUAA/
MCSYM-DB/3_3/UUGUAA/3_3-UUGUAA.mcs
MCSYM-DB/3_3/UUGUAG/
MCSYM-DB/3_3/UUGUAG/3_3-UUGUAG.mcs
MCSYM-DB/3_3/UUGUCA/
MCSYM-DB/3_3/UUGUCA/3_3-UUGUCA.mcs
MCSYM-DB/3_3/UUGUCG/
MCSYM-DB/3_3/UUGUCG/3_3-UUGUCG.mcs
MCSYM-DB/3_3/UUGUCG/ds-3_3-UUGUCG_x.pdb.gz
MCSYM-DB/3_3/UUGUCU/
MCSYM-DB/3_3/UUGUCU/3_3-UUGUCU.mcs
MCSYM-DB/3_3/UUGUGA/
MCSYM-DB/3_3/UUGUGA/3_3-UUGUGA.mcs
MCSYM-DB/3_3/UUGUGU/
MCSYM-DB/3_3/UUGUGU/3_3-UUGUGU.mcs
MCSYM-DB/3_3/UUGUUA/
MCSYM-DB/3_3/UUGUUA/3_3-UUGUUA.mcs
MCSYM-DB/3_3/UUGUUA/ds-3_3-UUGUUA_x.pdb.gz
MCSYM-DB/3_3/UUGUUC/
MCSYM-DB/3_3/UUGUUC/3_3-UUGUUC.mcs
MCSYM-DB/3_3/UUGUUG/
MCSYM-DB/3_3/UUGUUG/3_3-UUGUUG.mcs
MCSYM-DB/3_3/UUGUUG/ds-3_3-UUGUUG_x.pdb.gz
MCSYM-DB/3_3/UUGUUU/
MCSYM-DB/3_3/UUGUUU/3_3-UUGUUU.mcs
MCSYM-DB/3_3/UUUAAA/
MCSYM-DB/3_3/UUUAAA/3_3-UUUAAA.mcs
MCSYM-DB/3_3/UUUAAC/
MCSYM-DB/3_3/UUUAAC/3_3-UUUAAC.mcs
MCSYM-DB/3_3/UUUAAG/
MCSYM-DB/3_3/UUUAAG/3_3-UUUAAG.mcs
MCSYM-DB/3_3/UUUACA/
MCSYM-DB/3_3/UUUACA/3_3-UUUACA.mcs
MCSYM-DB/3_3/UUUACA/ds-3_3-UUUACA_x.pdb.gz
MCSYM-DB/3_3/UUUACC/
MCSYM-DB/3_3/UUUACC/3_3-UUUACC.mcs
MCSYM-DB/3_3/UUUACG/
MCSYM-DB/3_3/UUUACG/3_3-UUUACG.mcs
MCSYM-DB/3_3/UUUACU/
MCSYM-DB/3_3/UUUACU/3_3-UUUACU.mcs
MCSYM-DB/3_3/UUUACU/ds-3_3-UUUACU_x.pdb.gz
MCSYM-DB/3_3/UUUAGA/
MCSYM-DB/3_3/UUUAGA/3_3-UUUAGA.mcs
MCSYM-DB/3_3/UUUAGA/ds-3_3-UUUAGA_x.pdb.gz
MCSYM-DB/3_3/UUUAGC/
MCSYM-DB/3_3/UUUAGC/3_3-UUUAGC.mcs
MCSYM-DB/3_3/UUUAGG/
MCSYM-DB/3_3/UUUAGG/3_3-UUUAGG.mcs
MCSYM-DB/3_3/UUUAGU/
MCSYM-DB/3_3/UUUAGU/3_3-UUUAGU.mcs
MCSYM-DB/3_3/UUUAUA/
MCSYM-DB/3_3/UUUAUA/3_3-UUUAUA.mcs
MCSYM-DB/3_3/UUUAUA/ds-3_3-UUUAUA_x.pdb.gz
MCSYM-DB/3_3/UUUAUG/
MCSYM-DB/3_3/UUUAUG/3_3-UUUAUG.mcs
MCSYM-DB/3_3/UUUAUG/ds-3_3-UUUAUG_x.pdb.gz
MCSYM-DB/3_3/UUUAUU/
MCSYM-DB/3_3/UUUAUU/3_3-UUUAUU.mcs
MCSYM-DB/3_3/UUUCAA/
MCSYM-DB/3_3/UUUCAA/3_3-UUUCAA.mcs
MCSYM-DB/3_3/UUUCAU/
MCSYM-DB/3_3/UUUCAU/3_3-UUUCAU.mcs
MCSYM-DB/3_3/UUUCCA/
MCSYM-DB/3_3/UUUCCA/3_3-UUUCCA.mcs
MCSYM-DB/3_3/UUUCCA/ds-3_3-UUUCCA_x.pdb.gz
MCSYM-DB/3_3/UUUCCC/
MCSYM-DB/3_3/UUUCCC/3_3-UUUCCC.mcs
MCSYM-DB/3_3/UUUCCG/
MCSYM-DB/3_3/UUUCCG/3_3-UUUCCG.mcs
MCSYM-DB/3_3/UUUCCU/
MCSYM-DB/3_3/UUUCCU/3_3-UUUCCU.mcs
MCSYM-DB/3_3/UUUCUA/
MCSYM-DB/3_3/UUUCUA/3_3-UUUCUA.mcs
MCSYM-DB/3_3/UUUCUG/
MCSYM-DB/3_3/UUUCUG/3_3-UUUCUG.mcs
MCSYM-DB/3_3/UUUGAA/
MCSYM-DB/3_3/UUUGAA/3_3-UUUGAA.mcs
MCSYM-DB/3_3/UUUGAG/
MCSYM-DB/3_3/UUUGAG/3_3-UUUGAG.mcs
MCSYM-DB/3_3/UUUGCA/
MCSYM-DB/3_3/UUUGCA/3_3-UUUGCA.mcs
MCSYM-DB/3_3/UUUGCC/
MCSYM-DB/3_3/UUUGCC/3_3-UUUGCC.mcs
MCSYM-DB/3_3/UUUGCU/
MCSYM-DB/3_3/UUUGCU/3_3-UUUGCU.mcs
MCSYM-DB/3_3/UUUGGA/
MCSYM-DB/3_3/UUUGGA/3_3-UUUGGA.mcs
MCSYM-DB/3_3/UUUGGU/
MCSYM-DB/3_3/UUUGGU/3_3-UUUGGU.mcs
MCSYM-DB/3_3/UUUGUA/
MCSYM-DB/3_3/UUUGUA/3_3-UUUGUA.mcs
MCSYM-DB/3_3/UUUGUG/
MCSYM-DB/3_3/UUUGUG/3_3-UUUGUG.mcs
MCSYM-DB/3_3/UUUGUG/ds-3_3-UUUGUG_x.pdb.gz
MCSYM-DB/3_3/UUUGUU/
MCSYM-DB/3_3/UUUGUU/3_3-UUUGUU.mcs
MCSYM-DB/3_3/UUUUAA/
MCSYM-DB/3_3/UUUUAA/3_3-UUUUAA.mcs
MCSYM-DB/3_3/UUUUAC/
MCSYM-DB/3_3/UUUUAC/3_3-UUUUAC.mcs
MCSYM-DB/3_3/UUUUAG/
MCSYM-DB/3_3/UUUUAG/3_3-UUUUAG.mcs
MCSYM-DB/3_3/UUUUAU/
MCSYM-DB/3_3/UUUUAU/3_3-UUUUAU.mcs
MCSYM-DB/3_3/UUUUCA/
MCSYM-DB/3_3/UUUUCA/3_3-UUUUCA.mcs
MCSYM-DB/3_3/UUUUCA/ds-3_3-UUUUCA_x.pdb.gz
MCSYM-DB/3_3/UUUUCC/
MCSYM-DB/3_3/UUUUCC/3_3-UUUUCC.mcs
MCSYM-DB/3_3/UUUUGA/
MCSYM-DB/3_3/UUUUGA/3_3-UUUUGA.mcs
MCSYM-DB/3_3/UUUUGG/
MCSYM-DB/3_3/UUUUGG/3_3-UUUUGG.mcs
MCSYM-DB/3_3/UUUUGG/ds-3_3-UUUUGG_x.pdb.gz
MCSYM-DB/3_3/UUUUGU/
MCSYM-DB/3_3/UUUUGU/3_3-UUUUGU.mcs
MCSYM-DB/3_3/UUUUUA/
MCSYM-DB/3_3/UUUUUA/3_3-UUUUUA.mcs
MCSYM-DB/3_3/UUUUUA/ds-3_3-UUUUUA_x.pdb.gz
MCSYM-DB/3_3/UUUUUC/
MCSYM-DB/3_3/UUUUUC/3_3-UUUUUC.mcs
MCSYM-DB/3_3/UUUUUG/
MCSYM-DB/3_3/UUUUUG/3_3-UUUUUG.mcs
MCSYM-DB/3_3/UUUUUU/
MCSYM-DB/3_3/UUUUUU/3_3-UUUUUU.mcs
MCSYM-DB/3_4/
MCSYM-DB/3_4/AACGCCA/
MCSYM-DB/3_4/AACGCCA/3_4-AACGCCA.mcs
MCSYM-DB/3_4/AACGCCA/ds-3_4-AACGCCA_x.pdb.gz
MCSYM-DB/3_4/AAUAACU/
MCSYM-DB/3_4/AAUAACU/3_4-AAUAACU.mcs
MCSYM-DB/3_4/AAUAACU/ds-3_4-AAUAACU_x.pdb.gz
MCSYM-DB/3_4/AUGCGUA/
MCSYM-DB/3_4/AUGCGUA/1U8D_model_1.pdb.gz
MCSYM-DB/3_4/AUGCGUA/1Y27_model_1.pdb.gz
MCSYM-DB/3_4/AUGCGUA/3_4-AUGCGUA.mcs
MCSYM-DB/3_4/AUGCGUA/ds-3_4-AUGCGUA_x.pdb.gz
MCSYM-DB/3_4/CAGCAAG/
MCSYM-DB/3_4/CAGCAAG/3_4-CAGCAAG.mcs
MCSYM-DB/3_4/CAGCAAG/ds-3_4-CAGCAAG_x.pdb.gz
MCSYM-DB/3_4/CCAUCAC/
MCSYM-DB/3_4/CCAUCAC/3_4-CCAUCAC.mcs
MCSYM-DB/3_4/CCAUCAC/ds-3_4-CCAUCAC_x.pdb.gz
MCSYM-DB/3_4/CCUUUUG/
MCSYM-DB/3_4/CCUUUUG/3_4-CCUUUUG.mcs
MCSYM-DB/3_4/CCUUUUG/ds-3_4-CCUUUUG_x.pdb.gz
MCSYM-DB/3_4/CGGCAAG/
MCSYM-DB/3_4/CGGCAAG/3_4-CGGCAAG.mcs
MCSYM-DB/3_4/CGGCAAG/ds-3_4-CGGCAAG_x.pdb.gz
MCSYM-DB/3_4/GCGUUUC/
MCSYM-DB/3_4/GCGUUUC/3_4-GCGUUUC.mcs
MCSYM-DB/3_4/GCGUUUC/ds-3_4-GCGUUUC_x.pdb.gz
MCSYM-DB/3_4/GGGGGUA/
MCSYM-DB/3_4/GGGGGUA/3_4-GGGGGUA.mcs
MCSYM-DB/3_4/GGGGGUA/ds-3_4-GGGGGUA_x.pdb.gz
MCSYM-DB/3_4/GGGGUAC/
MCSYM-DB/3_4/GGGGUAC/3_4-GGGGUAC.mcs
MCSYM-DB/3_4/GGGGUAC/ds-3_4-GGGGUAC_x.pdb.gz
MCSYM-DB/3_4/UCGCAAG/
MCSYM-DB/3_4/UCGCAAG/3_4-UCGCAAG.mcs
MCSYM-DB/3_4/UCGCAAG/ds-3_4-UCGCAAG_x.pdb.gz
MCSYM-DB/3_4/UCGCUUC/
MCSYM-DB/3_4/UCGCUUC/3_4-UCGCUUC.mcs
MCSYM-DB/3_4/UCGCUUC/ds-3_4-UCGCUUC_x.pdb.gz
MCSYM-DB/3_4/UGGCAAA/
MCSYM-DB/3_4/UGGCAAA/3_4-UGGCAAA.mcs
MCSYM-DB/3_4/UGGCAAA/ds-3_4-UGGCAAA_x.pdb.gz
MCSYM-DB/4/
MCSYM-DB/4/AAAA/
MCSYM-DB/4/AAAA/4-AAAA.mcs
MCSYM-DB/4/AAAA/4-AAAA.pdb.gz
MCSYM-DB/4/AAAA/ss-4-AAAA_x.pdb.gz
MCSYM-DB/4/AAAC/
MCSYM-DB/4/AAAC/4-AAAC.mcs
MCSYM-DB/4/AAAC/4-AAAC.pdb.gz
MCSYM-DB/4/AAAC/ss-4-AAAC_x.pdb.gz
MCSYM-DB/4/AAAG/
MCSYM-DB/4/AAAG/4-AAAG.mcs
MCSYM-DB/4/AAAG/4-AAAG.pdb.gz
MCSYM-DB/4/AAAG/ss-4-AAAG_x.pdb.gz
MCSYM-DB/4/AAAU/
MCSYM-DB/4/AAAU/4-AAAU.mcs
MCSYM-DB/4/AAAU/4-AAAU.pdb.gz
MCSYM-DB/4/AAAU/ss-4-AAAU_x.pdb.gz
MCSYM-DB/4/AACA/
MCSYM-DB/4/AACA/4-AACA.mcs
MCSYM-DB/4/AACA/4-AACA.pdb.gz
MCSYM-DB/4/AACA/ss-4-AACA_x.pdb.gz
MCSYM-DB/4/AACC/
MCSYM-DB/4/AACC/4-AACC.mcs
MCSYM-DB/4/AACC/4-AACC.pdb.gz
MCSYM-DB/4/AACC/ss-4-AACC_x.pdb.gz
MCSYM-DB/4/AACG/
MCSYM-DB/4/AACG/4-AACG.mcs
MCSYM-DB/4/AACG/4-AACG.pdb.gz
MCSYM-DB/4/AACG/ss-4-AACG_x.pdb.gz
MCSYM-DB/4/AACU/
MCSYM-DB/4/AACU/4-AACU.mcs
MCSYM-DB/4/AACU/4-AACU.pdb.gz
MCSYM-DB/4/AACU/ss-4-AACU_x.pdb.gz
MCSYM-DB/4/AAGA/
MCSYM-DB/4/AAGA/4-AAGA.mcs
MCSYM-DB/4/AAGA/4-AAGA.pdb.gz
MCSYM-DB/4/AAGA/ss-4-AAGA_x.pdb.gz
MCSYM-DB/4/AAGC/
MCSYM-DB/4/AAGC/4-AAGC.mcs
MCSYM-DB/4/AAGC/4-AAGC.pdb.gz
MCSYM-DB/4/AAGC/ss-4-AAGC_x.pdb.gz
MCSYM-DB/4/AAGG/
MCSYM-DB/4/AAGG/4-AAGG.mcs
MCSYM-DB/4/AAGG/4-AAGG.pdb.gz
MCSYM-DB/4/AAGG/ss-4-AAGG_x.pdb.gz
MCSYM-DB/4/AAGU/
MCSYM-DB/4/AAGU/4-AAGU.mcs
MCSYM-DB/4/AAGU/4-AAGU.pdb.gz
MCSYM-DB/4/AAGU/ss-4-AAGU_x.pdb.gz
MCSYM-DB/4/AAUA/
MCSYM-DB/4/AAUA/4-AAUA.mcs
MCSYM-DB/4/AAUA/4-AAUA.pdb.gz
MCSYM-DB/4/AAUA/ss-4-AAUA_x.pdb.gz
MCSYM-DB/4/AAUC/
MCSYM-DB/4/AAUC/4-AAUC.mcs
MCSYM-DB/4/AAUC/4-AAUC.pdb.gz
MCSYM-DB/4/AAUC/ss-4-AAUC_x.pdb.gz
MCSYM-DB/4/AAUG/
MCSYM-DB/4/AAUG/4-AAUG.mcs
MCSYM-DB/4/AAUG/4-AAUG.pdb.gz
MCSYM-DB/4/AAUG/ss-4-AAUG_x.pdb.gz
MCSYM-DB/4/AAUU/
MCSYM-DB/4/AAUU/4-AAUU.mcs
MCSYM-DB/4/AAUU/4-AAUU.pdb.gz
MCSYM-DB/4/AAUU/ss-4-AAUU_x.pdb.gz
MCSYM-DB/4/ACAA/
MCSYM-DB/4/ACAA/1PJY_model_1.pdb.gz
MCSYM-DB/4/ACAA/1Z2J_model_1.pdb.gz
MCSYM-DB/4/ACAA/4-ACAA.mcs
MCSYM-DB/4/ACAA/4-ACAA.pdb.gz
MCSYM-DB/4/ACAA/ss-4-ACAA_x.pdb.gz
MCSYM-DB/4/ACAC/
MCSYM-DB/4/ACAC/4-ACAC.mcs
MCSYM-DB/4/ACAC/4-ACAC.pdb.gz
MCSYM-DB/4/ACAC/ss-4-ACAC_x.pdb.gz
MCSYM-DB/4/ACAG/
MCSYM-DB/4/ACAG/4-ACAG.mcs
MCSYM-DB/4/ACAG/4-ACAG.pdb.gz
MCSYM-DB/4/ACAG/ss-4-ACAG_x.pdb.gz
MCSYM-DB/4/ACAU/
MCSYM-DB/4/ACAU/4-ACAU.mcs
MCSYM-DB/4/ACAU/4-ACAU.pdb.gz
MCSYM-DB/4/ACAU/ss-4-ACAU_x.pdb
MCSYM-DB/4/ACAU/ss-4-ACAU_x.pdb.gz
MCSYM-DB/4/ACCA/
MCSYM-DB/4/ACCA/4-ACCA.mcs
MCSYM-DB/4/ACCA/4-ACCA.pdb.gz
MCSYM-DB/4/ACCA/ss-4-ACCA_x.pdb.gz
MCSYM-DB/4/ACCC/
MCSYM-DB/4/ACCC/4-ACCC.mcs
MCSYM-DB/4/ACCC/4-ACCC.pdb.gz
MCSYM-DB/4/ACCC/ss-4-ACCC_x.pdb.gz
MCSYM-DB/4/ACCG/
MCSYM-DB/4/ACCG/4-ACCG.mcs
MCSYM-DB/4/ACCG/4-ACCG.pdb.gz
MCSYM-DB/4/ACCG/ss-4-ACCG_x.pdb.gz
MCSYM-DB/4/ACCU/
MCSYM-DB/4/ACCU/4-ACCU.mcs
MCSYM-DB/4/ACCU/4-ACCU.pdb.gz
MCSYM-DB/4/ACCU/ss-4-ACCU_x.pdb.gz
MCSYM-DB/4/ACGA/
MCSYM-DB/4/ACGA/4-ACGA.mcs
MCSYM-DB/4/ACGA/4-ACGA.pdb.gz
MCSYM-DB/4/ACGA/ss-4-ACGA_x.pdb.gz
MCSYM-DB/4/ACGC/
MCSYM-DB/4/ACGC/4-ACGC.mcs
MCSYM-DB/4/ACGC/4-ACGC.pdb.gz
MCSYM-DB/4/ACGC/ss-4-ACGC_x.pdb.gz
MCSYM-DB/4/ACGG/
MCSYM-DB/4/ACGG/4-ACGG.mcs
MCSYM-DB/4/ACGG/4-ACGG.pdb.gz
MCSYM-DB/4/ACGG/ss-4-ACGG_x.pdb.gz
MCSYM-DB/4/ACGU/
MCSYM-DB/4/ACGU/4-ACGU.mcs
MCSYM-DB/4/ACGU/4-ACGU.pdb.gz
MCSYM-DB/4/ACGU/ss-4-ACGU_x.pdb.gz
MCSYM-DB/4/ACUA/
MCSYM-DB/4/ACUA/4-ACUA.mcs
MCSYM-DB/4/ACUA/4-ACUA.pdb.gz
MCSYM-DB/4/ACUA/ss-4-ACUA_x.pdb.gz
MCSYM-DB/4/ACUC/
MCSYM-DB/4/ACUC/4-ACUC.mcs
MCSYM-DB/4/ACUC/4-ACUC.pdb.gz
MCSYM-DB/4/ACUC/ss-4-ACUC_x.pdb.gz
MCSYM-DB/4/ACUG/
MCSYM-DB/4/ACUG/4-ACUG.mcs
MCSYM-DB/4/ACUG/4-ACUG.pdb.gz
MCSYM-DB/4/ACUG/ss-4-ACUG_x.pdb.gz
MCSYM-DB/4/ACUU/
MCSYM-DB/4/ACUU/4-ACUU.mcs
MCSYM-DB/4/ACUU/4-ACUU.pdb.gz
MCSYM-DB/4/ACUU/ss-4-ACUU_x.pdb.gz
MCSYM-DB/4/AGAA/
MCSYM-DB/4/AGAA/1ATV_model_1.pdb.gz
MCSYM-DB/4/AGAA/1K4A_model_1.pdb.gz
MCSYM-DB/4/AGAA/1K6H_model_1.pdb.gz
MCSYM-DB/4/AGAA/4-AGAA.mcs
MCSYM-DB/4/AGAA/4-AGAA.pdb.gz
MCSYM-DB/4/AGAA/ss-4-AGAA_x.pdb.gz
MCSYM-DB/4/AGAC/
MCSYM-DB/4/AGAC/4-AGAC.mcs
MCSYM-DB/4/AGAC/4-AGAC.pdb.gz
MCSYM-DB/4/AGAC/ss-4-AGAC_x.pdb.gz
MCSYM-DB/4/AGAG/
MCSYM-DB/4/AGAG/4-AGAG.mcs
MCSYM-DB/4/AGAG/4-AGAG.pdb.gz
MCSYM-DB/4/AGAG/ss-4-AGAG_x.pdb.gz
MCSYM-DB/4/AGAU/
MCSYM-DB/4/AGAU/4-AGAU.mcs
MCSYM-DB/4/AGAU/4-AGAU.pdb.gz
MCSYM-DB/4/AGAU/ss-4-AGAU_x.pdb.gz
MCSYM-DB/4/AGCA/
MCSYM-DB/4/AGCA/4-AGCA.mcs
MCSYM-DB/4/AGCA/4-AGCA.pdb.gz
MCSYM-DB/4/AGCA/ss-4-AGCA_x.pdb.gz
MCSYM-DB/4/AGCC/
MCSYM-DB/4/AGCC/4-AGCC.mcs
MCSYM-DB/4/AGCC/4-AGCC.pdb.gz
MCSYM-DB/4/AGCC/ss-4-AGCC_x.pdb.gz
MCSYM-DB/4/AGCG/
MCSYM-DB/4/AGCG/4-AGCG.mcs
MCSYM-DB/4/AGCG/4-AGCG.pdb.gz
MCSYM-DB/4/AGCG/ss-4-AGCG_x.pdb.gz
MCSYM-DB/4/AGCU/
MCSYM-DB/4/AGCU/4-AGCU.mcs
MCSYM-DB/4/AGCU/4-AGCU.pdb.gz
MCSYM-DB/4/AGCU/ss-4-AGCU_x.pdb.gz
MCSYM-DB/4/AGGA/
MCSYM-DB/4/AGGA/4-AGGA.mcs
MCSYM-DB/4/AGGA/4-AGGA.pdb.gz
MCSYM-DB/4/AGGA/ss-4-AGGA_x.pdb.gz
MCSYM-DB/4/AGGC/
MCSYM-DB/4/AGGC/4-AGGC.mcs
MCSYM-DB/4/AGGC/4-AGGC.pdb.gz
MCSYM-DB/4/AGGC/ss-4-AGGC_x.pdb.gz
MCSYM-DB/4/AGGG/
MCSYM-DB/4/AGGG/4-AGGG.mcs
MCSYM-DB/4/AGGG/4-AGGG.pdb.gz
MCSYM-DB/4/AGGG/ss-4-AGGG_x.pdb.gz
MCSYM-DB/4/AGGU/
MCSYM-DB/4/AGGU/4-AGGU.mcs
MCSYM-DB/4/AGGU/4-AGGU.pdb.gz
MCSYM-DB/4/AGGU/ss-4-AGGU_x.pdb.gz
MCSYM-DB/4/AGUA/
MCSYM-DB/4/AGUA/4-AGUA.mcs
MCSYM-DB/4/AGUA/4-AGUA.pdb.gz
MCSYM-DB/4/AGUA/ss-4-AGUA_x.pdb.gz
MCSYM-DB/4/AGUC/
MCSYM-DB/4/AGUC/4-AGUC.mcs
MCSYM-DB/4/AGUC/4-AGUC.pdb.gz
MCSYM-DB/4/AGUC/ss-4-AGUC_x.pdb.gz
MCSYM-DB/4/AGUG/
MCSYM-DB/4/AGUG/4-AGUG.mcs
MCSYM-DB/4/AGUG/4-AGUG.pdb.gz
MCSYM-DB/4/AGUG/ss-4-AGUG_x.pdb.gz
MCSYM-DB/4/AGUU/
MCSYM-DB/4/AGUU/4-AGUU.mcs
MCSYM-DB/4/AGUU/4-AGUU.pdb.gz
MCSYM-DB/4/AGUU/ss-4-AGUU_x.pdb.gz
MCSYM-DB/4/AUAA/
MCSYM-DB/4/AUAA/4-AUAA.mcs
MCSYM-DB/4/AUAA/4-AUAA.pdb.gz
MCSYM-DB/4/AUAA/ss-4-AUAA_x.pdb.gz
MCSYM-DB/4/AUAC/
MCSYM-DB/4/AUAC/4-AUAC.mcs
MCSYM-DB/4/AUAC/4-AUAC.pdb.gz
MCSYM-DB/4/AUAC/ss-4-AUAC_x.pdb.gz
MCSYM-DB/4/AUAG/
MCSYM-DB/4/AUAG/4-AUAG.mcs
MCSYM-DB/4/AUAG/4-AUAG.pdb.gz
MCSYM-DB/4/AUAU/
MCSYM-DB/4/AUAU/4-AUAU.mcs
MCSYM-DB/4/AUAU/4-AUAU.pdb.gz
MCSYM-DB/4/AUAU/ss-4-AUAU_x.pdb.gz
MCSYM-DB/4/AUCA/
MCSYM-DB/4/AUCA/4-AUCA.mcs
MCSYM-DB/4/AUCA/4-AUCA.pdb.gz
MCSYM-DB/4/AUCA/ss-4-AUCA_x.pdb.gz
MCSYM-DB/4/AUCC/
MCSYM-DB/4/AUCC/4-AUCC.mcs
MCSYM-DB/4/AUCC/4-AUCC.pdb.gz
MCSYM-DB/4/AUCC/ss-4-AUCC_x.pdb.gz
MCSYM-DB/4/AUCG/
MCSYM-DB/4/AUCG/4-AUCG.mcs
MCSYM-DB/4/AUCG/4-AUCG.pdb.gz
MCSYM-DB/4/AUCG/ss-4-AUCG_x.pdb.gz
MCSYM-DB/4/AUCU/
MCSYM-DB/4/AUCU/1VQ7_model_1.pdb.gz
MCSYM-DB/4/AUCU/4-AUCU.mcs
MCSYM-DB/4/AUCU/4-AUCU.pdb.gz
MCSYM-DB/4/AUCU/ss-4-AUCU_x.pdb.gz
MCSYM-DB/4/AUGA/
MCSYM-DB/4/AUGA/4-AUGA.mcs
MCSYM-DB/4/AUGA/4-AUGA.pdb.gz
MCSYM-DB/4/AUGA/ss-4-AUGA_x.pdb.gz
MCSYM-DB/4/AUGC/
MCSYM-DB/4/AUGC/4-AUGC.mcs
MCSYM-DB/4/AUGC/4-AUGC.pdb.gz
MCSYM-DB/4/AUGC/ss-4-AUGC_x.pdb.gz
MCSYM-DB/4/AUGG/
MCSYM-DB/4/AUGG/4-AUGG.mcs
MCSYM-DB/4/AUGG/4-AUGG.pdb.gz
MCSYM-DB/4/AUGG/ss-4-AUGG_x.pdb.gz
MCSYM-DB/4/AUGU/
MCSYM-DB/4/AUGU/4-AUGU.mcs
MCSYM-DB/4/AUGU/4-AUGU.pdb.gz
MCSYM-DB/4/AUGU/ss-4-AUGU_x.pdb.gz
MCSYM-DB/4/AUUA/
MCSYM-DB/4/AUUA/4-AUUA.mcs
MCSYM-DB/4/AUUA/4-AUUA.pdb.gz
MCSYM-DB/4/AUUA/ss-4-AUUA_x.pdb.gz
MCSYM-DB/4/AUUC/
MCSYM-DB/4/AUUC/4-AUUC.mcs
MCSYM-DB/4/AUUC/4-AUUC.pdb.gz
MCSYM-DB/4/AUUC/ss-4-AUUC_x.pdb.gz
MCSYM-DB/4/AUUG/
MCSYM-DB/4/AUUG/4-AUUG.mcs
MCSYM-DB/4/AUUG/4-AUUG.pdb.gz
MCSYM-DB/4/AUUG/ss-4-AUUG_x.pdb.gz
MCSYM-DB/4/AUUU/
MCSYM-DB/4/AUUU/4-AUUU.mcs
MCSYM-DB/4/AUUU/4-AUUU.pdb.gz
MCSYM-DB/4/AUUU/ss-4-AUUU_x.pdb.gz
MCSYM-DB/4/CAAA/
MCSYM-DB/4/CAAA/4-CAAA.mcs
MCSYM-DB/4/CAAA/4-CAAA.pdb.gz
MCSYM-DB/4/CAAA/ss-4-CAAA_x.pdb.gz
MCSYM-DB/4/CAAC/
MCSYM-DB/4/CAAC/1VQ7_model_1.pdb.gz
MCSYM-DB/4/CAAC/4-CAAC.mcs
MCSYM-DB/4/CAAC/4-CAAC.pdb.gz
MCSYM-DB/4/CAAC/ss-4-CAAC_x.pdb.gz
MCSYM-DB/4/CAAG/
MCSYM-DB/4/CAAG/4-CAAG.mcs
MCSYM-DB/4/CAAG/4-CAAG.pdb.gz
MCSYM-DB/4/CAAG/ss-4-CAAG_x.pdb.gz
MCSYM-DB/4/CAAU/
MCSYM-DB/4/CAAU/4-CAAU.mcs
MCSYM-DB/4/CAAU/4-CAAU.pdb.gz
MCSYM-DB/4/CAAU/ss-4-CAAU_x.pdb.gz
MCSYM-DB/4/CACA/
MCSYM-DB/4/CACA/4-CACA.mcs
MCSYM-DB/4/CACA/4-CACA.pdb.gz
MCSYM-DB/4/CACA/ss-4-CACA_x.pdb.gz
MCSYM-DB/4/CACC/
MCSYM-DB/4/CACC/4-CACC.mcs
MCSYM-DB/4/CACC/4-CACC.pdb.gz
MCSYM-DB/4/CACC/ss-4-CACC_x.pdb.gz
MCSYM-DB/4/CACG/
MCSYM-DB/4/CACG/1RFR_model_1.pdb.gz
MCSYM-DB/4/CACG/4-CACG.mcs
MCSYM-DB/4/CACG/4-CACG.pdb.gz
MCSYM-DB/4/CACG/ss-4-CACG_x.pdb.gz
MCSYM-DB/4/CACU/
MCSYM-DB/4/CACU/4-CACU.mcs
MCSYM-DB/4/CACU/4-CACU.pdb.gz
MCSYM-DB/4/CACU/ss-4-CACU_x.pdb.gz
MCSYM-DB/4/CAGA/
MCSYM-DB/4/CAGA/4-CAGA.mcs
MCSYM-DB/4/CAGA/4-CAGA.pdb.gz
MCSYM-DB/4/CAGA/ss-4-CAGA_x.pdb.gz
MCSYM-DB/4/CAGC/
MCSYM-DB/4/CAGC/4-CAGC.mcs
MCSYM-DB/4/CAGC/4-CAGC.pdb.gz
MCSYM-DB/4/CAGC/ss-4-CAGC_x.pdb.gz
MCSYM-DB/4/CAGG/
MCSYM-DB/4/CAGG/4-CAGG.mcs
MCSYM-DB/4/CAGG/4-CAGG.pdb.gz
MCSYM-DB/4/CAGG/ss-4-CAGG_x.pdb.gz
MCSYM-DB/4/CAGU/
MCSYM-DB/4/CAGU/4-CAGU.mcs
MCSYM-DB/4/CAGU/4-CAGU.pdb.gz
MCSYM-DB/4/CAGU/ss-4-CAGU_x.pdb.gz
MCSYM-DB/4/CAUA/
MCSYM-DB/4/CAUA/4-CAUA.mcs
MCSYM-DB/4/CAUA/4-CAUA.pdb.gz
MCSYM-DB/4/CAUA/ss-4-CAUA_x.pdb.gz
MCSYM-DB/4/CAUC/
MCSYM-DB/4/CAUC/4-CAUC.mcs
MCSYM-DB/4/CAUC/4-CAUC.pdb.gz
MCSYM-DB/4/CAUC/ss-4-CAUC_x.pdb.gz
MCSYM-DB/4/CAUG/
MCSYM-DB/4/CAUG/4-CAUG.mcs
MCSYM-DB/4/CAUG/4-CAUG.pdb.gz
MCSYM-DB/4/CAUG/ss-4-CAUG_x.pdb.gz
MCSYM-DB/4/CAUU/
MCSYM-DB/4/CAUU/4-CAUU.mcs
MCSYM-DB/4/CAUU/4-CAUU.pdb.gz
MCSYM-DB/4/CAUU/ss-4-CAUU_x.pdb.gz
MCSYM-DB/4/CCAA/
MCSYM-DB/4/CCAA/4-CCAA.mcs
MCSYM-DB/4/CCAA/4-CCAA.pdb.gz
MCSYM-DB/4/CCAA/ss-4-CCAA_x.pdb.gz
MCSYM-DB/4/CCAC/
MCSYM-DB/4/CCAC/4-CCAC.mcs
MCSYM-DB/4/CCAC/4-CCAC.pdb.gz
MCSYM-DB/4/CCAC/ss-4-CCAC_x.pdb
MCSYM-DB/4/CCAC/ss-4-CCAC_x.pdb.gz
MCSYM-DB/4/CCAG/
MCSYM-DB/4/CCAG/4-CCAG.mcs
MCSYM-DB/4/CCAG/4-CCAG.pdb.gz
MCSYM-DB/4/CCAG/ss-4-CCAG_x.pdb.gz
MCSYM-DB/4/CCAU/
MCSYM-DB/4/CCAU/4-CCAU.mcs
MCSYM-DB/4/CCAU/4-CCAU.pdb.gz
MCSYM-DB/4/CCAU/ss-4-CCAU_x.pdb.gz
MCSYM-DB/4/CCCA/
MCSYM-DB/4/CCCA/4-CCCA.mcs
MCSYM-DB/4/CCCA/4-CCCA.pdb.gz
MCSYM-DB/4/CCCA/ss-4-CCCA_x.pdb.gz
MCSYM-DB/4/CCCC/
MCSYM-DB/4/CCCC/4-CCCC.mcs
MCSYM-DB/4/CCCC/4-CCCC.pdb.gz
MCSYM-DB/4/CCCC/ss-4-CCCC_x.pdb.gz
MCSYM-DB/4/CCCG/
MCSYM-DB/4/CCCG/4-CCCG.mcs
MCSYM-DB/4/CCCG/4-CCCG.pdb.gz
MCSYM-DB/4/CCCG/ss-4-CCCG_x.pdb.gz
MCSYM-DB/4/CCCU/
MCSYM-DB/4/CCCU/4-CCCU.mcs
MCSYM-DB/4/CCCU/4-CCCU.pdb.gz
MCSYM-DB/4/CCCU/ss-4-CCCU_x.pdb.gz
MCSYM-DB/4/CCGA/
MCSYM-DB/4/CCGA/4-CCGA.mcs
MCSYM-DB/4/CCGA/4-CCGA.pdb.gz
MCSYM-DB/4/CCGA/ss-4-CCGA_x.pdb.gz
MCSYM-DB/4/CCGC/
MCSYM-DB/4/CCGC/4-CCGC.mcs
MCSYM-DB/4/CCGC/4-CCGC.pdb.gz
MCSYM-DB/4/CCGC/ss-4-CCGC_x.pdb.gz
MCSYM-DB/4/CCGG/
MCSYM-DB/4/CCGG/1XMQ_model_1.pdb.gz
MCSYM-DB/4/CCGG/4-CCGG.mcs
MCSYM-DB/4/CCGG/4-CCGG.pdb.gz
MCSYM-DB/4/CCGG/ss-4-CCGG_x.pdb.gz
MCSYM-DB/4/CCGU/
MCSYM-DB/4/CCGU/4-CCGU.mcs
MCSYM-DB/4/CCGU/4-CCGU.pdb.gz
MCSYM-DB/4/CCGU/ss-4-CCGU_x.pdb.gz
MCSYM-DB/4/CCUA/
MCSYM-DB/4/CCUA/4-CCUA.mcs
MCSYM-DB/4/CCUA/4-CCUA.pdb.gz
MCSYM-DB/4/CCUA/ss-4-CCUA_x.pdb.gz
MCSYM-DB/4/CCUC/
MCSYM-DB/4/CCUC/4-CCUC.mcs
MCSYM-DB/4/CCUC/4-CCUC.pdb.gz
MCSYM-DB/4/CCUC/ss-4-CCUC_x.pdb.gz
MCSYM-DB/4/CCUG/
MCSYM-DB/4/CCUG/4-CCUG.mcs
MCSYM-DB/4/CCUG/4-CCUG.pdb.gz
MCSYM-DB/4/CCUG/ss-4-CCUG_x.pdb.gz
MCSYM-DB/4/CCUU/
MCSYM-DB/4/CCUU/4-CCUU.mcs
MCSYM-DB/4/CCUU/4-CCUU.pdb.gz
MCSYM-DB/4/CCUU/ss-4-CCUU_x.pdb.gz
MCSYM-DB/4/CGAA/
MCSYM-DB/4/CGAA/4-CGAA.mcs
MCSYM-DB/4/CGAA/4-CGAA.pdb.gz
MCSYM-DB/4/CGAA/ss-4-CGAA_x.pdb.gz
MCSYM-DB/4/CGAC/
MCSYM-DB/4/CGAC/4-CGAC.mcs
MCSYM-DB/4/CGAC/4-CGAC.pdb.gz
MCSYM-DB/4/CGAC/ss-4-CGAC_x.pdb.gz
MCSYM-DB/4/CGAG/
MCSYM-DB/4/CGAG/4-CGAG.mcs
MCSYM-DB/4/CGAG/4-CGAG.pdb.gz
MCSYM-DB/4/CGAG/ss-4-CGAG_x.pdb.gz
MCSYM-DB/4/CGAU/
MCSYM-DB/4/CGAU/4-CGAU.mcs
MCSYM-DB/4/CGAU/4-CGAU.pdb.gz
MCSYM-DB/4/CGAU/ss-4-CGAU_x.pdb.gz
MCSYM-DB/4/CGCA/
MCSYM-DB/4/CGCA/4-CGCA.mcs
MCSYM-DB/4/CGCA/4-CGCA.pdb.gz
MCSYM-DB/4/CGCA/ss-4-CGCA_x.pdb.gz
MCSYM-DB/4/CGCC/
MCSYM-DB/4/CGCC/4-CGCC.mcs
MCSYM-DB/4/CGCC/4-CGCC.pdb.gz
MCSYM-DB/4/CGCC/ss-4-CGCC_x.pdb.gz
MCSYM-DB/4/CGCG/
MCSYM-DB/4/CGCG/4-CGCG.mcs
MCSYM-DB/4/CGCG/4-CGCG.pdb.gz
MCSYM-DB/4/CGCG/ss-4-CGCG_x.pdb.gz
MCSYM-DB/4/CGCU/
MCSYM-DB/4/CGCU/4-CGCU.mcs
MCSYM-DB/4/CGCU/4-CGCU.pdb.gz
MCSYM-DB/4/CGCU/ss-4-CGCU_x.pdb.gz
MCSYM-DB/4/CGGA/
MCSYM-DB/4/CGGA/4-CGGA.mcs
MCSYM-DB/4/CGGA/4-CGGA.pdb.gz
MCSYM-DB/4/CGGA/ss-4-CGGA_x.pdb.gz
MCSYM-DB/4/CGGC/
MCSYM-DB/4/CGGC/4-CGGC.mcs
MCSYM-DB/4/CGGC/4-CGGC.pdb.gz
MCSYM-DB/4/CGGC/ss-4-CGGC_x.pdb.gz
MCSYM-DB/4/CGGG/
MCSYM-DB/4/CGGG/4-CGGG.mcs
MCSYM-DB/4/CGGG/4-CGGG.pdb.gz
MCSYM-DB/4/CGGG/ss-4-CGGG_x.pdb.gz
MCSYM-DB/4/CGGU/
MCSYM-DB/4/CGGU/4-CGGU.mcs
MCSYM-DB/4/CGGU/4-CGGU.pdb.gz
MCSYM-DB/4/CGGU/ss-4-CGGU_x.pdb.gz
MCSYM-DB/4/CGUA/
MCSYM-DB/4/CGUA/4-CGUA.mcs
MCSYM-DB/4/CGUA/4-CGUA.pdb.gz
MCSYM-DB/4/CGUA/ss-4-CGUA_x.pdb.gz
MCSYM-DB/4/CGUC/
MCSYM-DB/4/CGUC/4-CGUC.mcs
MCSYM-DB/4/CGUC/4-CGUC.pdb.gz
MCSYM-DB/4/CGUC/ss-4-CGUC_x.pdb.gz
MCSYM-DB/4/CGUG/
MCSYM-DB/4/CGUG/1IDV_model_1.pdb.gz
MCSYM-DB/4/CGUG/4-CGUG.mcs
MCSYM-DB/4/CGUG/4-CGUG.pdb.gz
MCSYM-DB/4/CGUG/ss-4-CGUG_x.pdb
MCSYM-DB/4/CGUG/ss-4-CGUG_x.pdb.gz
MCSYM-DB/4/CGUU/
MCSYM-DB/4/CGUU/4-CGUU.mcs
MCSYM-DB/4/CGUU/4-CGUU.pdb.gz
MCSYM-DB/4/CGUU/ss-4-CGUU_x.pdb.gz
MCSYM-DB/4/CUAA/
MCSYM-DB/4/CUAA/4-CUAA.mcs
MCSYM-DB/4/CUAA/4-CUAA.pdb.gz
MCSYM-DB/4/CUAA/ss-4-CUAA_x.pdb.gz
MCSYM-DB/4/CUAC/
MCSYM-DB/4/CUAC/4-CUAC.mcs
MCSYM-DB/4/CUAC/4-CUAC.pdb.gz
MCSYM-DB/4/CUAC/ss-4-CUAC_x.pdb.gz
MCSYM-DB/4/CUAG/
MCSYM-DB/4/CUAG/1EC6_model_1.pdb.gz
MCSYM-DB/4/CUAG/4-CUAG.mcs
MCSYM-DB/4/CUAG/4-CUAG.pdb.gz
MCSYM-DB/4/CUAG/ss-4-CUAG_x.pdb.gz
MCSYM-DB/4/CUAU/
MCSYM-DB/4/CUAU/4-CUAU.mcs
MCSYM-DB/4/CUAU/4-CUAU.pdb.gz
MCSYM-DB/4/CUAU/ss-4-CUAU_x.pdb.gz
MCSYM-DB/4/CUCA/
MCSYM-DB/4/CUCA/4-CUCA.mcs
MCSYM-DB/4/CUCA/4-CUCA.pdb.gz
MCSYM-DB/4/CUCA/ss-4-CUCA_x.pdb.gz
MCSYM-DB/4/CUCC/
MCSYM-DB/4/CUCC/4-CUCC.mcs
MCSYM-DB/4/CUCC/4-CUCC.pdb.gz
MCSYM-DB/4/CUCC/ss-4-CUCC_x.pdb.gz
MCSYM-DB/4/CUCG/
MCSYM-DB/4/CUCG/4-CUCG.mcs
MCSYM-DB/4/CUCG/4-CUCG.pdb.gz
MCSYM-DB/4/CUCG/ss-4-CUCG_x.pdb.gz
MCSYM-DB/4/CUCU/
MCSYM-DB/4/CUCU/4-CUCU.mcs
MCSYM-DB/4/CUCU/4-CUCU.pdb.gz
MCSYM-DB/4/CUCU/ss-4-CUCU_x.pdb.gz
MCSYM-DB/4/CUGA/
MCSYM-DB/4/CUGA/4-CUGA.mcs
MCSYM-DB/4/CUGA/4-CUGA.pdb.gz
MCSYM-DB/4/CUGA/ss-4-CUGA_x.pdb.gz
MCSYM-DB/4/CUGC/
MCSYM-DB/4/CUGC/4-CUGC.mcs
MCSYM-DB/4/CUGC/4-CUGC.pdb.gz
MCSYM-DB/4/CUGC/ss-4-CUGC_x.pdb.gz
MCSYM-DB/4/CUGG/
MCSYM-DB/4/CUGG/2B6G_model_1.pdb.gz
MCSYM-DB/4/CUGG/2ES5_model_1.pdb.gz
MCSYM-DB/4/CUGG/4-CUGG.mcs
MCSYM-DB/4/CUGG/4-CUGG.pdb.gz
MCSYM-DB/4/CUGG/ss-4-CUGG_x.pdb.gz
MCSYM-DB/4/CUGU/
MCSYM-DB/4/CUGU/4-CUGU.mcs
MCSYM-DB/4/CUGU/4-CUGU.pdb.gz
MCSYM-DB/4/CUGU/ss-4-CUGU_x.pdb.gz
MCSYM-DB/4/CUUA/
MCSYM-DB/4/CUUA/4-CUUA.mcs
MCSYM-DB/4/CUUA/4-CUUA.pdb.gz
MCSYM-DB/4/CUUA/ss-4-CUUA_x.pdb.gz
MCSYM-DB/4/CUUC/
MCSYM-DB/4/CUUC/4-CUUC.mcs
MCSYM-DB/4/CUUC/4-CUUC.pdb.gz
MCSYM-DB/4/CUUC/ss-4-CUUC_x.pdb.gz
MCSYM-DB/4/CUUG/
MCSYM-DB/4/CUUG/1RNG_model_1.pdb.gz
MCSYM-DB/4/CUUG/4-CUUG.mcs
MCSYM-DB/4/CUUG/4-CUUG.pdb.gz
MCSYM-DB/4/CUUG/ss-4-CUUG_x.pdb.gz
MCSYM-DB/4/CUUU/
MCSYM-DB/4/CUUU/4-CUUU.mcs
MCSYM-DB/4/CUUU/4-CUUU.pdb.gz
MCSYM-DB/4/CUUU/ss-4-CUUU_x.pdb.gz
MCSYM-DB/4/GAAA/
MCSYM-DB/4/GAAA/1AJF_model_1.pdb.gz
MCSYM-DB/4/GAAA/1DUL_model_1.pdb.gz
MCSYM-DB/4/GAAA/1FG0_model_1.pdb.gz
MCSYM-DB/4/GAAA/1G1X_model_1.pdb.gz
MCSYM-DB/4/GAAA/1HMH_model_1.pdb.gz
MCSYM-DB/4/GAAA/1KXK_model_1.pdb.gz
MCSYM-DB/4/GAAA/1L8V_model_1.pdb.gz
MCSYM-DB/4/GAAA/1M5K_model_1.pdb.gz
MCSYM-DB/4/GAAA/1N66_model_1.pdb.gz
MCSYM-DB/4/GAAA/1NBK_model_1.pdb.gz
MCSYM-DB/4/GAAA/1O15_model_1.pdb.gz
MCSYM-DB/4/GAAA/1OW9_model_1.pdb.gz
MCSYM-DB/4/GAAA/1R2P_model_1.pdb.gz
MCSYM-DB/4/GAAA/1RLG_model_1.pdb.gz
MCSYM-DB/4/GAAA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GAAA/1XMQ_model_1.pdb.gz
MCSYM-DB/4/GAAA/2ADT_model_1.pdb.gz
MCSYM-DB/4/GAAA/2BH2_model_1.pdb.gz
MCSYM-DB/4/GAAA/4-GAAA.mcs
MCSYM-DB/4/GAAA/4-GAAA.pdb.gz
MCSYM-DB/4/GAAA/ss-4-GAAA_x.pdb.gz
MCSYM-DB/4/GAAC/
MCSYM-DB/4/GAAC/1MJI_model_1.pdb.gz
MCSYM-DB/4/GAAC/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GAAC/4-GAAC.mcs
MCSYM-DB/4/GAAC/4-GAAC.pdb.gz
MCSYM-DB/4/GAAC/ss-4-GAAC_x.pdb
MCSYM-DB/4/GAAC/ss-4-GAAC_x.pdb.gz
MCSYM-DB/4/GAAG/
MCSYM-DB/4/GAAG/1G1X_model_1.pdb.gz
MCSYM-DB/4/GAAG/1XMQ_model_1.pdb.gz
MCSYM-DB/4/GAAG/4-GAAG.mcs
MCSYM-DB/4/GAAG/4-GAAG.pdb.gz
MCSYM-DB/4/GAAG/ss-4-GAAG_x.pdb
MCSYM-DB/4/GAAG/ss-4-GAAG_x.pdb.gz
MCSYM-DB/4/GAAU/
MCSYM-DB/4/GAAU/4-GAAU.mcs
MCSYM-DB/4/GAAU/4-GAAU.pdb.gz
MCSYM-DB/4/GAAU/ss-4-GAAU_x.pdb.gz
MCSYM-DB/4/GACA/
MCSYM-DB/4/GACA/4-GACA.mcs
MCSYM-DB/4/GACA/4-GACA.pdb.gz
MCSYM-DB/4/GACA/ss-4-GACA_x.pdb.gz
MCSYM-DB/4/GACC/
MCSYM-DB/4/GACC/4-GACC.mcs
MCSYM-DB/4/GACC/4-GACC.pdb.gz
MCSYM-DB/4/GACC/ss-4-GACC_x.pdb.gz
MCSYM-DB/4/GACG/
MCSYM-DB/4/GACG/1F5U_model_1.pdb.gz
MCSYM-DB/4/GACG/4-GACG.mcs
MCSYM-DB/4/GACG/4-GACG.pdb.gz
MCSYM-DB/4/GACG/ss-4-GACG_x.pdb.gz
MCSYM-DB/4/GACU/
MCSYM-DB/4/GACU/4-GACU.mcs
MCSYM-DB/4/GACU/4-GACU.pdb.gz
MCSYM-DB/4/GACU/ss-4-GACU_x.pdb.gz
MCSYM-DB/4/GAGA/
MCSYM-DB/4/GAGA/1JTW_model_1.pdb.gz
MCSYM-DB/4/GAGA/1K2G_model_1.pdb.gz
MCSYM-DB/4/GAGA/1MNX_model_1.pdb.gz
MCSYM-DB/4/GAGA/1N8X_model_1.pdb.gz
MCSYM-DB/4/GAGA/1Q8N_model_1.pdb.gz
MCSYM-DB/4/GAGA/1Q93_model_1.pdb.gz
MCSYM-DB/4/GAGA/1Q96_model_1.pdb.gz
MCSYM-DB/4/GAGA/1Q9A_model_1.pdb.gz
MCSYM-DB/4/GAGA/1U3K_model_1.pdb.gz
MCSYM-DB/4/GAGA/1U6P_model_1.pdb.gz
MCSYM-DB/4/GAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GAGA/1XMQ_model_1.pdb.gz
MCSYM-DB/4/GAGA/1ZIG_model_1.pdb.gz
MCSYM-DB/4/GAGA/4-GAGA.mcs
MCSYM-DB/4/GAGA/4-GAGA.pdb.gz
MCSYM-DB/4/GAGA/430D_model_1.pdb.gz
MCSYM-DB/4/GAGA/ss-4-GAGA_x.pdb
MCSYM-DB/4/GAGA/ss-4-GAGA_x.pdb.gz
MCSYM-DB/4/GAGC/
MCSYM-DB/4/GAGC/4-GAGC.mcs
MCSYM-DB/4/GAGC/4-GAGC.pdb.gz
MCSYM-DB/4/GAGC/ss-4-GAGC_x.pdb.gz
MCSYM-DB/4/GAGG/
MCSYM-DB/4/GAGG/4-GAGG.mcs
MCSYM-DB/4/GAGG/4-GAGG.pdb.gz
MCSYM-DB/4/GAGG/ss-4-GAGG_x.pdb.gz
MCSYM-DB/4/GAGU/
MCSYM-DB/4/GAGU/4-GAGU.mcs
MCSYM-DB/4/GAGU/4-GAGU.pdb.gz
MCSYM-DB/4/GAGU/ss-4-GAGU_x.pdb.gz
MCSYM-DB/4/GAUA/
MCSYM-DB/4/GAUA/1F85_model_1.pdb.gz
MCSYM-DB/4/GAUA/4-GAUA.mcs
MCSYM-DB/4/GAUA/4-GAUA.pdb.gz
MCSYM-DB/4/GAUA/ss-4-GAUA_x.pdb
MCSYM-DB/4/GAUA/ss-4-GAUA_x.pdb.gz
MCSYM-DB/4/GAUC/
MCSYM-DB/4/GAUC/1XJR_model_1.pdb.gz
MCSYM-DB/4/GAUC/4-GAUC.mcs
MCSYM-DB/4/GAUC/4-GAUC.pdb.gz
MCSYM-DB/4/GAUC/ss-4-GAUC_x.pdb.gz
MCSYM-DB/4/GAUG/
MCSYM-DB/4/GAUG/4-GAUG.mcs
MCSYM-DB/4/GAUG/4-GAUG.pdb.gz
MCSYM-DB/4/GAUG/ss-4-GAUG_x.pdb.gz
MCSYM-DB/4/GAUU/
MCSYM-DB/4/GAUU/4-GAUU.mcs
MCSYM-DB/4/GAUU/4-GAUU.pdb.gz
MCSYM-DB/4/GAUU/ss-4-GAUU_x.pdb.gz
MCSYM-DB/4/GCAA/
MCSYM-DB/4/GCAA/1CK5_model_1.pdb.gz
MCSYM-DB/4/GCAA/1I9F_model_1.pdb.gz
MCSYM-DB/4/GCAA/1MZP_model_1.pdb.gz
MCSYM-DB/4/GCAA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GCAA/1XMQ_model_1.pdb.gz
MCSYM-DB/4/GCAA/1ZIH_model_1.pdb.gz
MCSYM-DB/4/GCAA/2EZ6_model_1.pdb.gz
MCSYM-DB/4/GCAA/4-GCAA.mcs
MCSYM-DB/4/GCAA/4-GCAA.pdb.gz
MCSYM-DB/4/GCAA/ss-4-GCAA_x.pdb.gz
MCSYM-DB/4/GCAC/
MCSYM-DB/4/GCAC/4-GCAC.mcs
MCSYM-DB/4/GCAC/4-GCAC.pdb.gz
MCSYM-DB/4/GCAC/ss-4-GCAC_x.pdb.gz
MCSYM-DB/4/GCAG/
MCSYM-DB/4/GCAG/4-GCAG.mcs
MCSYM-DB/4/GCAG/4-GCAG.pdb.gz
MCSYM-DB/4/GCAG/ss-4-GCAG_x.pdb.gz
MCSYM-DB/4/GCAU/
MCSYM-DB/4/GCAU/1NC0_model_1.pdb.gz
MCSYM-DB/4/GCAU/4-GCAU.mcs
MCSYM-DB/4/GCAU/4-GCAU.pdb.gz
MCSYM-DB/4/GCAU/ss-4-GCAU_x.pdb.gz
MCSYM-DB/4/GCCA/
MCSYM-DB/4/GCCA/1E95_model_1.pdb.gz
MCSYM-DB/4/GCCA/4-GCCA.mcs
MCSYM-DB/4/GCCA/4-GCCA.pdb.gz
MCSYM-DB/4/GCCA/ss-4-GCCA_x.pdb.gz
MCSYM-DB/4/GCCC/
MCSYM-DB/4/GCCC/4-GCCC.mcs
MCSYM-DB/4/GCCC/4-GCCC.pdb.gz
MCSYM-DB/4/GCCC/ss-4-GCCC_x.pdb.gz
MCSYM-DB/4/GCCG/
MCSYM-DB/4/GCCG/4-GCCG.mcs
MCSYM-DB/4/GCCG/4-GCCG.pdb.gz
MCSYM-DB/4/GCCG/ss-4-GCCG_x.pdb.gz
MCSYM-DB/4/GCCU/
MCSYM-DB/4/GCCU/4-GCCU.mcs
MCSYM-DB/4/GCCU/4-GCCU.pdb.gz
MCSYM-DB/4/GCCU/ss-4-GCCU_x.pdb.gz
MCSYM-DB/4/GCGA/
MCSYM-DB/4/GCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GCGA/4-GCGA.mcs
MCSYM-DB/4/GCGA/4-GCGA.pdb.gz
MCSYM-DB/4/GCGA/ss-4-GCGA_x.pdb.gz
MCSYM-DB/4/GCGC/
MCSYM-DB/4/GCGC/4-GCGC.mcs
MCSYM-DB/4/GCGC/4-GCGC.pdb.gz
MCSYM-DB/4/GCGC/ss-4-GCGC_x.pdb.gz
MCSYM-DB/4/GCGG/
MCSYM-DB/4/GCGG/4-GCGG.mcs
MCSYM-DB/4/GCGG/4-GCGG.pdb.gz
MCSYM-DB/4/GCGG/ss-4-GCGG_x.pdb.gz
MCSYM-DB/4/GCGU/
MCSYM-DB/4/GCGU/4-GCGU.mcs
MCSYM-DB/4/GCGU/4-GCGU.pdb.gz
MCSYM-DB/4/GCGU/ss-4-GCGU_x.pdb.gz
MCSYM-DB/4/GCUA/
MCSYM-DB/4/GCUA/4-GCUA.mcs
MCSYM-DB/4/GCUA/4-GCUA.pdb.gz
MCSYM-DB/4/GCUA/ss-4-GCUA_x.pdb.gz
MCSYM-DB/4/GCUC/
MCSYM-DB/4/GCUC/4-GCUC.mcs
MCSYM-DB/4/GCUC/4-GCUC.pdb.gz
MCSYM-DB/4/GCUC/ss-4-GCUC_x.pdb.gz
MCSYM-DB/4/GCUG/
MCSYM-DB/4/GCUG/4-GCUG.mcs
MCSYM-DB/4/GCUG/4-GCUG.pdb.gz
MCSYM-DB/4/GCUG/ss-4-GCUG_x.pdb.gz
MCSYM-DB/4/GCUU/
MCSYM-DB/4/GCUU/4-GCUU.mcs
MCSYM-DB/4/GCUU/4-GCUU.pdb.gz
MCSYM-DB/4/GCUU/ss-4-GCUU_x.pdb.gz
MCSYM-DB/4/GGAA/
MCSYM-DB/4/GGAA/1CQ5_model_1.pdb.gz
MCSYM-DB/4/GGAA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GGAA/1Z43_model_1.pdb.gz
MCSYM-DB/4/GGAA/28SP_model_1.pdb.gz
MCSYM-DB/4/GGAA/4-GGAA.mcs
MCSYM-DB/4/GGAA/4-GGAA.pdb.gz
MCSYM-DB/4/GGAA/ss-4-GGAA_x.pdb.gz
MCSYM-DB/4/GGAC/
MCSYM-DB/4/GGAC/4-GGAC.mcs
MCSYM-DB/4/GGAC/4-GGAC.pdb.gz
MCSYM-DB/4/GGAC/ss-4-GGAC_x.pdb.gz
MCSYM-DB/4/GGAG/
MCSYM-DB/4/GGAG/1L1W_model_1.pdb.gz
MCSYM-DB/4/GGAG/1MY9_model_1.pdb.gz
MCSYM-DB/4/GGAG/4-GGAG.mcs
MCSYM-DB/4/GGAG/4-GGAG.pdb.gz
MCSYM-DB/4/GGAG/ss-4-GGAG_x.pdb.gz
MCSYM-DB/4/GGAU/
MCSYM-DB/4/GGAU/4-GGAU.mcs
MCSYM-DB/4/GGAU/4-GGAU.pdb.gz
MCSYM-DB/4/GGAU/ss-4-GGAU_x.pdb.gz
MCSYM-DB/4/GGCA/
MCSYM-DB/4/GGCA/1U9S_model_1.pdb.gz
MCSYM-DB/4/GGCA/4-GGCA.mcs
MCSYM-DB/4/GGCA/4-GGCA.pdb.gz
MCSYM-DB/4/GGCA/ss-4-GGCA_x.pdb.gz
MCSYM-DB/4/GGCC/
MCSYM-DB/4/GGCC/4-GGCC.mcs
MCSYM-DB/4/GGCC/4-GGCC.pdb.gz
MCSYM-DB/4/GGCC/ss-4-GGCC_x.pdb.gz
MCSYM-DB/4/GGCG/
MCSYM-DB/4/GGCG/4-GGCG.mcs
MCSYM-DB/4/GGCG/4-GGCG.pdb.gz
MCSYM-DB/4/GGCG/ss-4-GGCG_x.pdb.gz
MCSYM-DB/4/GGCU/
MCSYM-DB/4/GGCU/4-GGCU.mcs
MCSYM-DB/4/GGCU/4-GGCU.pdb.gz
MCSYM-DB/4/GGCU/ss-4-GGCU_x.pdb.gz
MCSYM-DB/4/GGGA/
MCSYM-DB/4/GGGA/1FG0_model_1.pdb.gz
MCSYM-DB/4/GGGA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GGGA/4-GGGA.mcs
MCSYM-DB/4/GGGA/4-GGGA.pdb.gz
MCSYM-DB/4/GGGA/ss-4-GGGA_x.pdb.gz
MCSYM-DB/4/GGGC/
MCSYM-DB/4/GGGC/4-GGGC.mcs
MCSYM-DB/4/GGGC/4-GGGC.pdb.gz
MCSYM-DB/4/GGGC/ss-4-GGGC_x.pdb.gz
MCSYM-DB/4/GGGG/
MCSYM-DB/4/GGGG/4-GGGG.mcs
MCSYM-DB/4/GGGG/4-GGGG.pdb.gz
MCSYM-DB/4/GGGG/ss-4-GGGG_x.pdb.gz
MCSYM-DB/4/GGGU/
MCSYM-DB/4/GGGU/4-GGGU.mcs
MCSYM-DB/4/GGGU/4-GGGU.pdb.gz
MCSYM-DB/4/GGGU/ss-4-GGGU_x.pdb.gz
MCSYM-DB/4/GGUA/
MCSYM-DB/4/GGUA/4-GGUA.mcs
MCSYM-DB/4/GGUA/4-GGUA.pdb.gz
MCSYM-DB/4/GGUA/ss-4-GGUA_x.pdb.gz
MCSYM-DB/4/GGUC/
MCSYM-DB/4/GGUC/1WSU_model_1.pdb.gz
MCSYM-DB/4/GGUC/4-GGUC.mcs
MCSYM-DB/4/GGUC/4-GGUC.pdb.gz
MCSYM-DB/4/GGUC/ss-4-GGUC_x.pdb.gz
MCSYM-DB/4/GGUG/
MCSYM-DB/4/GGUG/4-GGUG.mcs
MCSYM-DB/4/GGUG/4-GGUG.pdb.gz
MCSYM-DB/4/GGUG/ss-4-GGUG_x.pdb.gz
MCSYM-DB/4/GGUGAG/
MCSYM-DB/4/GGUGAG/4-GGUGAG.mcs
MCSYM-DB/4/GGUGAG/ss-4-GGUGAG_x.pdb.gz
MCSYM-DB/4/GGUU/
MCSYM-DB/4/GGUU/4-GGUU.mcs
MCSYM-DB/4/GGUU/4-GGUU.pdb.gz
MCSYM-DB/4/GGUU/ss-4-GGUU_x.pdb.gz
MCSYM-DB/4/GUAA/
MCSYM-DB/4/GUAA/1MSY_model_1.pdb.gz
MCSYM-DB/4/GUAA/1OOA_model_1.pdb.gz
MCSYM-DB/4/GUAA/1Q29_model_1.pdb.gz
MCSYM-DB/4/GUAA/1TJZ_model_1.pdb.gz
MCSYM-DB/4/GUAA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GUAA/4-GUAA.mcs
MCSYM-DB/4/GUAA/4-GUAA.pdb.gz
MCSYM-DB/4/GUAA/ss-4-GUAA_x.pdb.gz
MCSYM-DB/4/GUAC/
MCSYM-DB/4/GUAC/4-GUAC.mcs
MCSYM-DB/4/GUAC/4-GUAC.pdb.gz
MCSYM-DB/4/GUAC/ss-4-GUAC_x.pdb.gz
MCSYM-DB/4/GUAG/
MCSYM-DB/4/GUAG/4-GUAG.mcs
MCSYM-DB/4/GUAG/4-GUAG.pdb.gz
MCSYM-DB/4/GUAG/ss-4-GUAG_x.pdb.gz
MCSYM-DB/4/GUAU/
MCSYM-DB/4/GUAU/4-GUAU.mcs
MCSYM-DB/4/GUAU/4-GUAU.pdb.gz
MCSYM-DB/4/GUAU/ss-4-GUAU_x.pdb.gz
MCSYM-DB/4/GUCA/
MCSYM-DB/4/GUCA/4-GUCA.mcs
MCSYM-DB/4/GUCA/4-GUCA.pdb.gz
MCSYM-DB/4/GUCA/ss-4-GUCA_x.pdb.gz
MCSYM-DB/4/GUCC/
MCSYM-DB/4/GUCC/4-GUCC.mcs
MCSYM-DB/4/GUCC/4-GUCC.pdb.gz
MCSYM-DB/4/GUCC/ss-4-GUCC_x.pdb
MCSYM-DB/4/GUCC/ss-4-GUCC_x.pdb.gz
MCSYM-DB/4/GUCG/
MCSYM-DB/4/GUCG/4-GUCG.mcs
MCSYM-DB/4/GUCG/4-GUCG.pdb.gz
MCSYM-DB/4/GUCG/ss-4-GUCG_x.pdb.gz
MCSYM-DB/4/GUCU/
MCSYM-DB/4/GUCU/4-GUCU.mcs
MCSYM-DB/4/GUCU/4-GUCU.pdb.gz
MCSYM-DB/4/GUCU/ss-4-GUCU_x.pdb.gz
MCSYM-DB/4/GUGA/
MCSYM-DB/4/GUGA/1FG0_model_1.pdb.gz
MCSYM-DB/4/GUGA/1R7W_model_1.pdb.gz
MCSYM-DB/4/GUGA/1R7Z_model_1.pdb.gz
MCSYM-DB/4/GUGA/1VQ7_model_1.pdb.gz
MCSYM-DB/4/GUGA/4-GUGA.mcs
MCSYM-DB/4/GUGA/4-GUGA.pdb.gz
MCSYM-DB/4/GUGA/ss-4-GUGA_x.pdb.gz
MCSYM-DB/4/GUGC/
MCSYM-DB/4/GUGC/4-GUGC.mcs
MCSYM-DB/4/GUGC/4-GUGC.pdb.gz
MCSYM-DB/4/GUGC/ss-4-GUGC_x.pdb.gz
MCSYM-DB/4/GUGG/
MCSYM-DB/4/GUGG/4-GUGG.mcs
MCSYM-DB/4/GUGG/4-GUGG.pdb.gz
MCSYM-DB/4/GUGG/ss-4-GUGG_x.pdb.gz
MCSYM-DB/4/GUGU/
MCSYM-DB/4/GUGU/4-GUGU.mcs
MCSYM-DB/4/GUGU/4-GUGU.pdb.gz
MCSYM-DB/4/GUGU/ss-4-GUGU_x.pdb.gz
MCSYM-DB/4/GUUA/
MCSYM-DB/4/GUUA/4-GUUA.mcs
MCSYM-DB/4/GUUA/4-GUUA.pdb.gz
MCSYM-DB/4/GUUA/ss-4-GUUA_x.pdb.gz
MCSYM-DB/4/GUUC/
MCSYM-DB/4/GUUC/4-GUUC.mcs
MCSYM-DB/4/GUUC/4-GUUC.pdb.gz
MCSYM-DB/4/GUUC/ss-4-GUUC_x.pdb.gz
MCSYM-DB/4/GUUG/
MCSYM-DB/4/GUUG/4-GUUG.mcs
MCSYM-DB/4/GUUG/4-GUUG.pdb.gz
MCSYM-DB/4/GUUG/ss-4-GUUG_x.pdb.gz
MCSYM-DB/4/GUUU/
MCSYM-DB/4/GUUU/4-GUUU.mcs
MCSYM-DB/4/GUUU/4-GUUU.pdb.gz
MCSYM-DB/4/GUUU/ss-4-GUUU_x.pdb.gz
MCSYM-DB/4/UAAA/
MCSYM-DB/4/UAAA/4-UAAA.mcs
MCSYM-DB/4/UAAA/4-UAAA.pdb.gz
MCSYM-DB/4/UAAA/ss-4-UAAA_x.pdb.gz
MCSYM-DB/4/UAAC/
MCSYM-DB/4/UAAC/1XMQ_model_1.pdb.gz
MCSYM-DB/4/UAAC/4-UAAC.mcs
MCSYM-DB/4/UAAC/4-UAAC.pdb.gz
MCSYM-DB/4/UAAC/ss-4-UAAC_x.pdb.gz
MCSYM-DB/4/UAAG/
MCSYM-DB/4/UAAG/4-UAAG.mcs
MCSYM-DB/4/UAAG/4-UAAG.pdb.gz
MCSYM-DB/4/UAAG/ss-4-UAAG_x.pdb.gz
MCSYM-DB/4/UAAU/
MCSYM-DB/4/UAAU/2FRL_model_1.pdb.gz
MCSYM-DB/4/UAAU/4-UAAU.mcs
MCSYM-DB/4/UAAU/4-UAAU.pdb.gz
MCSYM-DB/4/UAAU/ss-4-UAAU_x.pdb.gz
MCSYM-DB/4/UACA/
MCSYM-DB/4/UACA/4-UACA.mcs
MCSYM-DB/4/UACA/4-UACA.pdb.gz
MCSYM-DB/4/UACA/ss-4-UACA_x.pdb.gz
MCSYM-DB/4/UACC/
MCSYM-DB/4/UACC/4-UACC.mcs
MCSYM-DB/4/UACC/4-UACC.pdb.gz
MCSYM-DB/4/UACC/ss-4-UACC_x.pdb.gz
MCSYM-DB/4/UACG/
MCSYM-DB/4/UACG/1L1C_model_1.pdb.gz
MCSYM-DB/4/UACG/1MFJ_model_1.pdb.gz
MCSYM-DB/4/UACG/1OSW_model_1.pdb.gz
MCSYM-DB/4/UACG/1TXS_model_1.pdb.gz
MCSYM-DB/4/UACG/1XMQ_model_1.pdb.gz
MCSYM-DB/4/UACG/4-UACG.mcs
MCSYM-DB/4/UACG/4-UACG.pdb.gz
MCSYM-DB/4/UACG/ss-4-UACG_x.pdb.gz
MCSYM-DB/4/UACU/
MCSYM-DB/4/UACU/4-UACU.mcs
MCSYM-DB/4/UACU/4-UACU.pdb.gz
MCSYM-DB/4/UACU/ss-4-UACU_x.pdb.gz
MCSYM-DB/4/UAGA/
MCSYM-DB/4/UAGA/4-UAGA.mcs
MCSYM-DB/4/UAGA/4-UAGA.pdb.gz
MCSYM-DB/4/UAGA/ss-4-UAGA_x.pdb
MCSYM-DB/4/UAGA/ss-4-UAGA_x.pdb.gz
MCSYM-DB/4/UAGC/
MCSYM-DB/4/UAGC/4-UAGC.mcs
MCSYM-DB/4/UAGC/4-UAGC.pdb.gz
MCSYM-DB/4/UAGC/ss-4-UAGC_x.pdb.gz
MCSYM-DB/4/UAGG/
MCSYM-DB/4/UAGG/4-UAGG.mcs
MCSYM-DB/4/UAGG/4-UAGG.pdb.gz
MCSYM-DB/4/UAGG/ss-4-UAGG_x.pdb.gz
MCSYM-DB/4/UAGU/
MCSYM-DB/4/UAGU/4-UAGU.mcs
MCSYM-DB/4/UAGU/4-UAGU.pdb.gz
MCSYM-DB/4/UAGU/ss-4-UAGU_x.pdb.gz
MCSYM-DB/4/UAUA/
MCSYM-DB/4/UAUA/4-UAUA.mcs
MCSYM-DB/4/UAUA/4-UAUA.pdb.gz
MCSYM-DB/4/UAUA/ss-4-UAUA_x.pdb.gz
MCSYM-DB/4/UAUC/
MCSYM-DB/4/UAUC/4-UAUC.mcs
MCSYM-DB/4/UAUC/4-UAUC.pdb.gz
MCSYM-DB/4/UAUC/ss-4-UAUC_x.pdb.gz
MCSYM-DB/4/UAUG/
MCSYM-DB/4/UAUG/1Y27_model_1.pdb.gz
MCSYM-DB/4/UAUG/4-UAUG.mcs
MCSYM-DB/4/UAUG/4-UAUG.pdb.gz
MCSYM-DB/4/UAUG/ss-4-UAUG_x.pdb.gz
MCSYM-DB/4/UAUU/
MCSYM-DB/4/UAUU/4-UAUU.mcs
MCSYM-DB/4/UAUU/4-UAUU.pdb.gz
MCSYM-DB/4/UAUU/ss-4-UAUU_x.pdb.gz
MCSYM-DB/4/UCAA/
MCSYM-DB/4/UCAA/4-UCAA.mcs
MCSYM-DB/4/UCAA/4-UCAA.pdb.gz
MCSYM-DB/4/UCAA/ss-4-UCAA_x.pdb
MCSYM-DB/4/UCAA/ss-4-UCAA_x.pdb.gz
MCSYM-DB/4/UCAC/
MCSYM-DB/4/UCAC/1VQ7_model_1.pdb.gz
MCSYM-DB/4/UCAC/4-UCAC.mcs
MCSYM-DB/4/UCAC/4-UCAC.pdb.gz
MCSYM-DB/4/UCAC/ss-4-UCAC_x.pdb.gz
MCSYM-DB/4/UCAG/
MCSYM-DB/4/UCAG/1Q75_model_1.pdb.gz
MCSYM-DB/4/UCAG/4-UCAG.mcs
MCSYM-DB/4/UCAG/4-UCAG.pdb.gz
MCSYM-DB/4/UCAG/ss-4-UCAG_x.pdb.gz
MCSYM-DB/4/UCAU/
MCSYM-DB/4/UCAU/4-UCAU.mcs
MCSYM-DB/4/UCAU/4-UCAU.pdb.gz
MCSYM-DB/4/UCAU/ss-4-UCAU_x.pdb.gz
MCSYM-DB/4/UCCA/
MCSYM-DB/4/UCCA/4-UCCA.mcs
MCSYM-DB/4/UCCA/4-UCCA.pdb.gz
MCSYM-DB/4/UCCA/ss-4-UCCA_x.pdb.gz
MCSYM-DB/4/UCCC/
MCSYM-DB/4/UCCC/4-UCCC.mcs
MCSYM-DB/4/UCCC/4-UCCC.pdb.gz
MCSYM-DB/4/UCCC/ss-4-UCCC_x.pdb.gz
MCSYM-DB/4/UCCG/
MCSYM-DB/4/UCCG/4-UCCG.mcs
MCSYM-DB/4/UCCG/4-UCCG.pdb.gz
MCSYM-DB/4/UCCG/ss-4-UCCG_x.pdb.gz
MCSYM-DB/4/UCCU/
MCSYM-DB/4/UCCU/4-UCCU.mcs
MCSYM-DB/4/UCCU/4-UCCU.pdb.gz
MCSYM-DB/4/UCCU/ss-4-UCCU_x.pdb.gz
MCSYM-DB/4/UCGA/
MCSYM-DB/4/UCGA/1NBK_model_1.pdb.gz
MCSYM-DB/4/UCGA/4-UCGA.mcs
MCSYM-DB/4/UCGA/4-UCGA.pdb.gz
MCSYM-DB/4/UCGA/ss-4-UCGA_x.pdb.gz
MCSYM-DB/4/UCGC/
MCSYM-DB/4/UCGC/4-UCGC.mcs
MCSYM-DB/4/UCGC/4-UCGC.pdb.gz
MCSYM-DB/4/UCGC/ss-4-UCGC_x.pdb.gz
MCSYM-DB/4/UCGG/
MCSYM-DB/4/UCGG/1F6Z_model_1.pdb.gz
MCSYM-DB/4/UCGG/4-UCGG.mcs
MCSYM-DB/4/UCGG/4-UCGG.pdb.gz
MCSYM-DB/4/UCGG/ss-4-UCGG_x.pdb.gz
MCSYM-DB/4/UCGU/
MCSYM-DB/4/UCGU/4-UCGU.mcs
MCSYM-DB/4/UCGU/4-UCGU.pdb.gz
MCSYM-DB/4/UCGU/ss-4-UCGU_x.pdb.gz
MCSYM-DB/4/UCUA/
MCSYM-DB/4/UCUA/4-UCUA.mcs
MCSYM-DB/4/UCUA/4-UCUA.pdb.gz
MCSYM-DB/4/UCUA/ss-4-UCUA_x.pdb.gz
MCSYM-DB/4/UCUC/
MCSYM-DB/4/UCUC/4-UCUC.mcs
MCSYM-DB/4/UCUC/4-UCUC.pdb.gz
MCSYM-DB/4/UCUC/ss-4-UCUC_x.pdb.gz
MCSYM-DB/4/UCUG/
MCSYM-DB/4/UCUG/4-UCUG.mcs
MCSYM-DB/4/UCUG/4-UCUG.pdb.gz
MCSYM-DB/4/UCUG/ss-4-UCUG_x.pdb.gz
MCSYM-DB/4/UCUU/
MCSYM-DB/4/UCUU/4-UCUU.mcs
MCSYM-DB/4/UCUU/4-UCUU.pdb.gz
MCSYM-DB/4/UCUU/ss-4-UCUU_x.pdb.gz
MCSYM-DB/4/UGAA/
MCSYM-DB/4/UGAA/1J4Y_model_1.pdb.gz
MCSYM-DB/4/UGAA/4-UGAA.mcs
MCSYM-DB/4/UGAA/4-UGAA.pdb.gz
MCSYM-DB/4/UGAA/ss-4-UGAA_x.pdb.gz
MCSYM-DB/4/UGAC/
MCSYM-DB/4/UGAC/4-UGAC.mcs
MCSYM-DB/4/UGAC/4-UGAC.pdb.gz
MCSYM-DB/4/UGAC/ss-4-UGAC_x.pdb.gz
MCSYM-DB/4/UGAG/
MCSYM-DB/4/UGAG/4-UGAG.mcs
MCSYM-DB/4/UGAG/4-UGAG.pdb.gz
MCSYM-DB/4/UGAG/ss-4-UGAG_x.pdb.gz
MCSYM-DB/4/UGAU/
MCSYM-DB/4/UGAU/4-UGAU.mcs
MCSYM-DB/4/UGAU/4-UGAU.pdb.gz
MCSYM-DB/4/UGAU/ss-4-UGAU_x.pdb.gz
MCSYM-DB/4/UGCA/
MCSYM-DB/4/UGCA/1B23_model_1.pdb.gz
MCSYM-DB/4/UGCA/4-UGCA.mcs
MCSYM-DB/4/UGCA/4-UGCA.pdb.gz
MCSYM-DB/4/UGCA/ss-4-UGCA_x.pdb
MCSYM-DB/4/UGCA/ss-4-UGCA_x.pdb.gz
MCSYM-DB/4/UGCC/
MCSYM-DB/4/UGCC/4-UGCC.mcs
MCSYM-DB/4/UGCC/4-UGCC.pdb.gz
MCSYM-DB/4/UGCC/ss-4-UGCC_x.pdb.gz
MCSYM-DB/4/UGCG/
MCSYM-DB/4/UGCG/4-UGCG.mcs
MCSYM-DB/4/UGCG/4-UGCG.pdb.gz
MCSYM-DB/4/UGCG/ss-4-UGCG_x.pdb.gz
MCSYM-DB/4/UGCU/
MCSYM-DB/4/UGCU/4-UGCU.mcs
MCSYM-DB/4/UGCU/4-UGCU.pdb.gz
MCSYM-DB/4/UGCU/ss-4-UGCU_x.pdb.gz
MCSYM-DB/4/UGGA/
MCSYM-DB/4/UGGA/1ULL_model_1.pdb.gz
MCSYM-DB/4/UGGA/4-UGGA.mcs
MCSYM-DB/4/UGGA/4-UGGA.pdb.gz
MCSYM-DB/4/UGGA/ss-4-UGGA_x.pdb.gz
MCSYM-DB/4/UGGC/
MCSYM-DB/4/UGGC/4-UGGC.mcs
MCSYM-DB/4/UGGC/4-UGGC.pdb.gz
MCSYM-DB/4/UGGC/ss-4-UGGC_x.pdb.gz
MCSYM-DB/4/UGGG/
MCSYM-DB/4/UGGG/4-UGGG.mcs
MCSYM-DB/4/UGGG/4-UGGG.pdb.gz
MCSYM-DB/4/UGGG/ss-4-UGGG_x.pdb.gz
MCSYM-DB/4/UGGU/
MCSYM-DB/4/UGGU/4-UGGU.mcs
MCSYM-DB/4/UGGU/4-UGGU.pdb.gz
MCSYM-DB/4/UGGU/ss-4-UGGU_x.pdb.gz
MCSYM-DB/4/UGUA/
MCSYM-DB/4/UGUA/4-UGUA.mcs
MCSYM-DB/4/UGUA/4-UGUA.pdb.gz
MCSYM-DB/4/UGUA/ss-4-UGUA_x.pdb.gz
MCSYM-DB/4/UGUC/
MCSYM-DB/4/UGUC/4-UGUC.mcs
MCSYM-DB/4/UGUC/4-UGUC.pdb.gz
MCSYM-DB/4/UGUC/ss-4-UGUC_x.pdb.gz
MCSYM-DB/4/UGUG/
MCSYM-DB/4/UGUG/4-UGUG.mcs
MCSYM-DB/4/UGUG/4-UGUG.pdb.gz
MCSYM-DB/4/UGUG/ss-4-UGUG_x.pdb.gz
MCSYM-DB/4/UGUU/
MCSYM-DB/4/UGUU/4-UGUU.mcs
MCSYM-DB/4/UGUU/4-UGUU.pdb.gz
MCSYM-DB/4/UGUU/ss-4-UGUU_x.pdb.gz
MCSYM-DB/4/UUAA/
MCSYM-DB/4/UUAA/4-UUAA.mcs
MCSYM-DB/4/UUAA/4-UUAA.pdb.gz
MCSYM-DB/4/UUAA/ss-4-UUAA_x.pdb.gz
MCSYM-DB/4/UUAC/
MCSYM-DB/4/UUAC/4-UUAC.mcs
MCSYM-DB/4/UUAC/4-UUAC.pdb.gz
MCSYM-DB/4/UUAC/ss-4-UUAC_x.pdb.gz
MCSYM-DB/4/UUAG/
MCSYM-DB/4/UUAG/4-UUAG.mcs
MCSYM-DB/4/UUAG/4-UUAG.pdb.gz
MCSYM-DB/4/UUAG/ss-4-UUAG_x.pdb.gz
MCSYM-DB/4/UUAU/
MCSYM-DB/4/UUAU/4-UUAU.mcs
MCSYM-DB/4/UUAU/4-UUAU.pdb.gz
MCSYM-DB/4/UUAU/ss-4-UUAU_x.pdb.gz
MCSYM-DB/4/UUCA/
MCSYM-DB/4/UUCA/4-UUCA.mcs
MCSYM-DB/4/UUCA/4-UUCA.pdb.gz
MCSYM-DB/4/UUCA/ss-4-UUCA_x.pdb.gz
MCSYM-DB/4/UUCC/
MCSYM-DB/4/UUCC/4-UUCC.mcs
MCSYM-DB/4/UUCC/4-UUCC.pdb.gz
MCSYM-DB/4/UUCC/ss-4-UUCC_x.pdb.gz
MCSYM-DB/4/UUCG/
MCSYM-DB/4/UUCG/1B36_model_1.pdb.gz
MCSYM-DB/4/UUCG/1BYJ_model_1.pdb.gz
MCSYM-DB/4/UUCG/1D6K_model_1.pdb.gz
MCSYM-DB/4/UUCG/1EBR_model_1.pdb.gz
MCSYM-DB/4/UUCG/1EKZ_model_1.pdb.gz
MCSYM-DB/4/UUCG/1F6Z_model_1.pdb.gz
MCSYM-DB/4/UUCG/1HLX_model_1.pdb.gz
MCSYM-DB/4/UUCG/1KP7_model_1.pdb.gz
MCSYM-DB/4/UUCG/1KUQ_model_1.pdb.gz
MCSYM-DB/4/UUCG/1M5L_model_1.pdb.gz
MCSYM-DB/4/UUCG/1M82_model_1.pdb.gz
MCSYM-DB/4/UUCG/1RAW_model_1.pdb.gz
MCSYM-DB/4/UUCG/1TLR_model_1.pdb.gz
MCSYM-DB/4/UUCG/1ULL_model_1.pdb.gz
MCSYM-DB/4/UUCG/1VQ7_model_1.pdb.gz
MCSYM-DB/4/UUCG/1XSG_model_1.pdb.gz
MCSYM-DB/4/UUCG/1XSH_model_1.pdb.gz
MCSYM-DB/4/UUCG/1Z31_model_1.pdb.gz
MCSYM-DB/4/UUCG/2AU4_model_1.pdb.gz
MCSYM-DB/4/UUCG/2EUY_model_1.pdb.gz
MCSYM-DB/4/UUCG/4-UUCG.mcs
MCSYM-DB/4/UUCG/4-UUCG.pdb.gz
MCSYM-DB/4/UUCG/ss-4-UUCG_x.pdb
MCSYM-DB/4/UUCG/ss-4-UUCG_x.pdb.gz
MCSYM-DB/4/UUCU/
MCSYM-DB/4/UUCU/4-UUCU.mcs
MCSYM-DB/4/UUCU/4-UUCU.pdb.gz
MCSYM-DB/4/UUCU/ss-4-UUCU_x.pdb.gz
MCSYM-DB/4/UUGA/
MCSYM-DB/4/UUGA/4-UUGA.mcs
MCSYM-DB/4/UUGA/4-UUGA.pdb.gz
MCSYM-DB/4/UUGA/ss-4-UUGA_x.pdb.gz
MCSYM-DB/4/UUGC/
MCSYM-DB/4/UUGC/4-UUGC.mcs
MCSYM-DB/4/UUGC/4-UUGC.pdb.gz
MCSYM-DB/4/UUGC/ss-4-UUGC_x.pdb.gz
MCSYM-DB/4/UUGG/
MCSYM-DB/4/UUGG/4-UUGG.mcs
MCSYM-DB/4/UUGG/4-UUGG.pdb.gz
MCSYM-DB/4/UUGG/ss-4-UUGG_x.pdb.gz
MCSYM-DB/4/UUGU/
MCSYM-DB/4/UUGU/4-UUGU.mcs
MCSYM-DB/4/UUGU/4-UUGU.pdb.gz
MCSYM-DB/4/UUGU/ss-4-UUGU_x.pdb.gz
MCSYM-DB/4/UUUA/
MCSYM-DB/4/UUUA/4-UUUA.mcs
MCSYM-DB/4/UUUA/4-UUUA.pdb.gz
MCSYM-DB/4/UUUA/ss-4-UUUA_x.pdb.gz
MCSYM-DB/4/UUUC/
MCSYM-DB/4/UUUC/4-UUUC.mcs
MCSYM-DB/4/UUUC/4-UUUC.pdb.gz
MCSYM-DB/4/UUUC/ss-4-UUUC_x.pdb.gz
MCSYM-DB/4/UUUG/
MCSYM-DB/4/UUUG/4-UUUG.mcs
MCSYM-DB/4/UUUG/4-UUUG.pdb.gz
MCSYM-DB/4/UUUG/ss-4-UUUG_x.pdb.gz
MCSYM-DB/4/UUUU/
MCSYM-DB/4/UUUU/4-UUUU.mcs
MCSYM-DB/4/UUUU/4-UUUU.pdb.gz
MCSYM-DB/4/UUUU/ss-4-UUUU_x.pdb
MCSYM-DB/4/UUUU/ss-4-UUUU_x.pdb.gz
MCSYM-DB/4_2/
MCSYM-DB/4_2/AAAAAA/
MCSYM-DB/4_2/AAAAAA/4_2-AAAAAA.mcs
MCSYM-DB/4_2/AAAAAA/ds-4_2-AAAAAA_x.pdb.gz
MCSYM-DB/4_2/AAAAAG/
MCSYM-DB/4_2/AAAAAG/4_2-AAAAAG.mcs
MCSYM-DB/4_2/AAAAAG/ds-4_2-AAAAAG_x.pdb.gz
MCSYM-DB/4_2/AAAAAU/
MCSYM-DB/4_2/AAAAAU/4_2-AAAAAU.mcs
MCSYM-DB/4_2/AAAAAU/ds-4_2-AAAAAU_x.pdb.gz
MCSYM-DB/4_2/AAAACA/
MCSYM-DB/4_2/AAAACA/4_2-AAAACA.mcs
MCSYM-DB/4_2/AAAACA/ds-4_2-AAAACA_x.pdb.gz
MCSYM-DB/4_2/AAAACC/
MCSYM-DB/4_2/AAAACC/4_2-AAAACC.mcs
MCSYM-DB/4_2/AAAACC/ds-4_2-AAAACC_x.pdb.gz
MCSYM-DB/4_2/AAAACG/
MCSYM-DB/4_2/AAAACG/4_2-AAAACG.mcs
MCSYM-DB/4_2/AAAACG/ds-4_2-AAAACG_x.pdb.gz
MCSYM-DB/4_2/AAAAGG/
MCSYM-DB/4_2/AAAAGG/4_2-AAAAGG.mcs
MCSYM-DB/4_2/AAAAGG/ds-4_2-AAAAGG_x.pdb.gz
MCSYM-DB/4_2/AAAAGU/
MCSYM-DB/4_2/AAAAGU/4_2-AAAAGU.mcs
MCSYM-DB/4_2/AAAAUA/
MCSYM-DB/4_2/AAAAUA/4_2-AAAAUA.mcs
MCSYM-DB/4_2/AAAAUC/
MCSYM-DB/4_2/AAAAUC/4_2-AAAAUC.mcs
MCSYM-DB/4_2/AAAAUU/
MCSYM-DB/4_2/AAAAUU/4_2-AAAAUU.mcs
MCSYM-DB/4_2/AAACCU/
MCSYM-DB/4_2/AAACCU/4_2-AAACCU.mcs
MCSYM-DB/4_2/AAACCU/ds-4_2-AAACCU_x.pdb.gz
MCSYM-DB/4_2/AAACGA/
MCSYM-DB/4_2/AAACGA/4_2-AAACGA.mcs
MCSYM-DB/4_2/AAACGA/ds-4_2-AAACGA_x.pdb.gz
MCSYM-DB/4_2/AAACGC/
MCSYM-DB/4_2/AAACGC/4_2-AAACGC.mcs
MCSYM-DB/4_2/AAACGC/ds-4_2-AAACGC_x.pdb.gz
MCSYM-DB/4_2/AAACGG/
MCSYM-DB/4_2/AAACGG/4_2-AAACGG.mcs
MCSYM-DB/4_2/AAACGG/ds-4_2-AAACGG_x.pdb.gz
MCSYM-DB/4_2/AAACGU/
MCSYM-DB/4_2/AAACGU/4_2-AAACGU.mcs
MCSYM-DB/4_2/AAACGU/ds-4_2-AAACGU_x.pdb.gz
MCSYM-DB/4_2/AAAGAA/
MCSYM-DB/4_2/AAAGAA/4_2-AAAGAA.mcs
MCSYM-DB/4_2/AAAGAA/ds-4_2-AAAGAA_x.pdb.gz
MCSYM-DB/4_2/AAAGAG/
MCSYM-DB/4_2/AAAGAG/4_2-AAAGAG.mcs
MCSYM-DB/4_2/AAAGAG/ds-4_2-AAAGAG_x.pdb.gz
MCSYM-DB/4_2/AAAGCA/
MCSYM-DB/4_2/AAAGCA/4_2-AAAGCA.mcs
MCSYM-DB/4_2/AAAGCA/ds-4_2-AAAGCA_x.pdb.gz
MCSYM-DB/4_2/AAAGCC/
MCSYM-DB/4_2/AAAGCC/4_2-AAAGCC.mcs
MCSYM-DB/4_2/AAAGCC/ds-4_2-AAAGCC_x.pdb.gz
MCSYM-DB/4_2/AAAGCU/
MCSYM-DB/4_2/AAAGCU/4_2-AAAGCU.mcs
MCSYM-DB/4_2/AAAGCU/ds-4_2-AAAGCU_x.pdb.gz
MCSYM-DB/4_2/AAAGGA/
MCSYM-DB/4_2/AAAGGA/4_2-AAAGGA.mcs
MCSYM-DB/4_2/AAAGGA/ds-4_2-AAAGGA_x.pdb.gz
MCSYM-DB/4_2/AAAGGU/
MCSYM-DB/4_2/AAAGGU/4_2-AAAGGU.mcs
MCSYM-DB/4_2/AAAGUA/
MCSYM-DB/4_2/AAAGUA/4_2-AAAGUA.mcs
MCSYM-DB/4_2/AAAGUA/ds-4_2-AAAGUA_x.pdb.gz
MCSYM-DB/4_2/AAAGUC/
MCSYM-DB/4_2/AAAGUC/4_2-AAAGUC.mcs
MCSYM-DB/4_2/AAAGUG/
MCSYM-DB/4_2/AAAGUG/4_2-AAAGUG.mcs
MCSYM-DB/4_2/AAAGUU/
MCSYM-DB/4_2/AAAGUU/4_2-AAAGUU.mcs
MCSYM-DB/4_2/AAAUAA/
MCSYM-DB/4_2/AAAUAA/4_2-AAAUAA.mcs
MCSYM-DB/4_2/AAAUAA/ds-4_2-AAAUAA_x.pdb.gz
MCSYM-DB/4_2/AAAUAC/
MCSYM-DB/4_2/AAAUAC/4_2-AAAUAC.mcs
MCSYM-DB/4_2/AAAUAG/
MCSYM-DB/4_2/AAAUAG/4_2-AAAUAG.mcs
MCSYM-DB/4_2/AAAUAG/ds-4_2-AAAUAG_x.pdb.gz
MCSYM-DB/4_2/AAAUAU/
MCSYM-DB/4_2/AAAUAU/4_2-AAAUAU.mcs
MCSYM-DB/4_2/AAAUAU/ds-4_2-AAAUAU_x.pdb.gz
MCSYM-DB/4_2/AAAUCC/
MCSYM-DB/4_2/AAAUCC/4_2-AAAUCC.mcs
MCSYM-DB/4_2/AAAUGA/
MCSYM-DB/4_2/AAAUGA/4_2-AAAUGA.mcs
MCSYM-DB/4_2/AAAUGA/ds-4_2-AAAUGA_x.pdb.gz
MCSYM-DB/4_2/AAAUGG/
MCSYM-DB/4_2/AAAUGG/4_2-AAAUGG.mcs
MCSYM-DB/4_2/AAAUGG/ds-4_2-AAAUGG_x.pdb.gz
MCSYM-DB/4_2/AAAUGU/
MCSYM-DB/4_2/AAAUGU/4_2-AAAUGU.mcs
MCSYM-DB/4_2/AAAUUU/
MCSYM-DB/4_2/AAAUUU/4_2-AAAUUU.mcs
MCSYM-DB/4_2/AACAAU/
MCSYM-DB/4_2/AACAAU/4_2-AACAAU.mcs
MCSYM-DB/4_2/AACAAU/ds-4_2-AACAAU_x.pdb.gz
MCSYM-DB/4_2/AACACA/
MCSYM-DB/4_2/AACACA/4_2-AACACA.mcs
MCSYM-DB/4_2/AACACU/
MCSYM-DB/4_2/AACACU/4_2-AACACU.mcs
MCSYM-DB/4_2/AACACU/ds-4_2-AACACU_x.pdb.gz
MCSYM-DB/4_2/AACAGA/
MCSYM-DB/4_2/AACAGA/4_2-AACAGA.mcs
MCSYM-DB/4_2/AACAGG/
MCSYM-DB/4_2/AACAGG/4_2-AACAGG.mcs
MCSYM-DB/4_2/AACAGG/ds-4_2-AACAGG_x.pdb.gz
MCSYM-DB/4_2/AACAUA/
MCSYM-DB/4_2/AACAUA/4_2-AACAUA.mcs
MCSYM-DB/4_2/AACAUA/ds-4_2-AACAUA_x.pdb.gz
MCSYM-DB/4_2/AACAUC/
MCSYM-DB/4_2/AACAUC/4_2-AACAUC.mcs
MCSYM-DB/4_2/AACAUU/
MCSYM-DB/4_2/AACAUU/4_2-AACAUU.mcs
MCSYM-DB/4_2/AACAUU/ds-4_2-AACAUU_x.pdb.gz
MCSYM-DB/4_2/AACCAA/
MCSYM-DB/4_2/AACCAA/4_2-AACCAA.mcs
MCSYM-DB/4_2/AACCAU/
MCSYM-DB/4_2/AACCAU/4_2-AACCAU.mcs
MCSYM-DB/4_2/AACCGA/
MCSYM-DB/4_2/AACCGA/4_2-AACCGA.mcs
MCSYM-DB/4_2/AACCGA/ds-4_2-AACCGA_x.pdb.gz
MCSYM-DB/4_2/AACCGU/
MCSYM-DB/4_2/AACCGU/4_2-AACCGU.mcs
MCSYM-DB/4_2/AACCGU/ds-4_2-AACCGU_x.pdb.gz
MCSYM-DB/4_2/AACCUU/
MCSYM-DB/4_2/AACCUU/4_2-AACCUU.mcs
MCSYM-DB/4_2/AACGAA/
MCSYM-DB/4_2/AACGAA/4_2-AACGAA.mcs
MCSYM-DB/4_2/AACGAA/ds-4_2-AACGAA_x.pdb.gz
MCSYM-DB/4_2/AACGCA/
MCSYM-DB/4_2/AACGCA/4_2-AACGCA.mcs
MCSYM-DB/4_2/AACGCA/ds-4_2-AACGCA_x.pdb.gz
MCSYM-DB/4_2/AACGCG/
MCSYM-DB/4_2/AACGCG/4_2-AACGCG.mcs
MCSYM-DB/4_2/AACGCG/ds-4_2-AACGCG_x.pdb.gz
MCSYM-DB/4_2/AACGCU/
MCSYM-DB/4_2/AACGCU/4_2-AACGCU.mcs
MCSYM-DB/4_2/AACGCU/ds-4_2-AACGCU_x.pdb.gz
MCSYM-DB/4_2/AACGUU/
MCSYM-DB/4_2/AACGUU/4_2-AACGUU.mcs
MCSYM-DB/4_2/AACUAA/
MCSYM-DB/4_2/AACUAA/4_2-AACUAA.mcs
MCSYM-DB/4_2/AACUAA/ds-4_2-AACUAA_x.pdb.gz
MCSYM-DB/4_2/AACUAU/
MCSYM-DB/4_2/AACUAU/4_2-AACUAU.mcs
MCSYM-DB/4_2/AACUAU/ds-4_2-AACUAU_x.pdb.gz
MCSYM-DB/4_2/AACUCU/
MCSYM-DB/4_2/AACUCU/4_2-AACUCU.mcs
MCSYM-DB/4_2/AACUCU/ds-4_2-AACUCU_x.pdb.gz
MCSYM-DB/4_2/AACUGU/
MCSYM-DB/4_2/AACUGU/4_2-AACUGU.mcs
MCSYM-DB/4_2/AACUGU/ds-4_2-AACUGU_x.pdb.gz
MCSYM-DB/4_2/AACUUU/
MCSYM-DB/4_2/AACUUU/4_2-AACUUU.mcs
MCSYM-DB/4_2/AAGAAA/
MCSYM-DB/4_2/AAGAAA/4_2-AAGAAA.mcs
MCSYM-DB/4_2/AAGAAA/ds-4_2-AAGAAA_x.pdb.gz
MCSYM-DB/4_2/AAGAAG/
MCSYM-DB/4_2/AAGAAG/4_2-AAGAAG.mcs
MCSYM-DB/4_2/AAGAAG/ds-4_2-AAGAAG_x.pdb.gz
MCSYM-DB/4_2/AAGAAU/
MCSYM-DB/4_2/AAGAAU/4_2-AAGAAU.mcs
MCSYM-DB/4_2/AAGAAU/ds-4_2-AAGAAU_x.pdb.gz
MCSYM-DB/4_2/AAGACC/
MCSYM-DB/4_2/AAGACC/4_2-AAGACC.mcs
MCSYM-DB/4_2/AAGACC/ds-4_2-AAGACC_x.pdb.gz
MCSYM-DB/4_2/AAGAGG/
MCSYM-DB/4_2/AAGAGG/4_2-AAGAGG.mcs
MCSYM-DB/4_2/AAGAGG/ds-4_2-AAGAGG_x.pdb.gz
MCSYM-DB/4_2/AAGAGU/
MCSYM-DB/4_2/AAGAGU/4_2-AAGAGU.mcs
MCSYM-DB/4_2/AAGAUA/
MCSYM-DB/4_2/AAGAUA/4_2-AAGAUA.mcs
MCSYM-DB/4_2/AAGAUG/
MCSYM-DB/4_2/AAGAUG/4_2-AAGAUG.mcs
MCSYM-DB/4_2/AAGAUG/ds-4_2-AAGAUG_x.pdb.gz
MCSYM-DB/4_2/AAGAUU/
MCSYM-DB/4_2/AAGAUU/4_2-AAGAUU.mcs
MCSYM-DB/4_2/AAGAUU/ds-4_2-AAGAUU_x.pdb.gz
MCSYM-DB/4_2/AAGCGA/
MCSYM-DB/4_2/AAGCGA/4_2-AAGCGA.mcs
MCSYM-DB/4_2/AAGCGC/
MCSYM-DB/4_2/AAGCGC/4_2-AAGCGC.mcs
MCSYM-DB/4_2/AAGCGG/
MCSYM-DB/4_2/AAGCGG/4_2-AAGCGG.mcs
MCSYM-DB/4_2/AAGCGG/ds-4_2-AAGCGG_x.pdb.gz
MCSYM-DB/4_2/AAGCGU/
MCSYM-DB/4_2/AAGCGU/4_2-AAGCGU.mcs
MCSYM-DB/4_2/AAGCGU/ds-4_2-AAGCGU_x.pdb.gz
MCSYM-DB/4_2/AAGCUU/
MCSYM-DB/4_2/AAGCUU/4_2-AAGCUU.mcs
MCSYM-DB/4_2/AAGCUU/ds-4_2-AAGCUU_x.pdb.gz
MCSYM-DB/4_2/AAGGCA/
MCSYM-DB/4_2/AAGGCA/4_2-AAGGCA.mcs
MCSYM-DB/4_2/AAGGCC/
MCSYM-DB/4_2/AAGGCC/4_2-AAGGCC.mcs
MCSYM-DB/4_2/AAGGCG/
MCSYM-DB/4_2/AAGGCG/4_2-AAGGCG.mcs
MCSYM-DB/4_2/AAGGCG/ds-4_2-AAGGCG_x.pdb.gz
MCSYM-DB/4_2/AAGGCU/
MCSYM-DB/4_2/AAGGCU/4_2-AAGGCU.mcs
MCSYM-DB/4_2/AAGGCU/ds-4_2-AAGGCU_x.pdb.gz
MCSYM-DB/4_2/AAGGGA/
MCSYM-DB/4_2/AAGGGA/4_2-AAGGGA.mcs
MCSYM-DB/4_2/AAGGUC/
MCSYM-DB/4_2/AAGGUC/4_2-AAGGUC.mcs
MCSYM-DB/4_2/AAGGUU/
MCSYM-DB/4_2/AAGGUU/4_2-AAGGUU.mcs
MCSYM-DB/4_2/AAGUAA/
MCSYM-DB/4_2/AAGUAA/4_2-AAGUAA.mcs
MCSYM-DB/4_2/AAGUAG/
MCSYM-DB/4_2/AAGUAG/4_2-AAGUAG.mcs
MCSYM-DB/4_2/AAGUAG/ds-4_2-AAGUAG_x.pdb.gz
MCSYM-DB/4_2/AAGUAU/
MCSYM-DB/4_2/AAGUAU/4_2-AAGUAU.mcs
MCSYM-DB/4_2/AAGUCC/
MCSYM-DB/4_2/AAGUCC/4_2-AAGUCC.mcs
MCSYM-DB/4_2/AAGUCU/
MCSYM-DB/4_2/AAGUCU/4_2-AAGUCU.mcs
MCSYM-DB/4_2/AAGUCU/ds-4_2-AAGUCU_x.pdb.gz
MCSYM-DB/4_2/AAGUGG/
MCSYM-DB/4_2/AAGUGG/4_2-AAGUGG.mcs
MCSYM-DB/4_2/AAGUGG/ds-4_2-AAGUGG_x.pdb.gz
MCSYM-DB/4_2/AAGUGU/
MCSYM-DB/4_2/AAGUGU/4_2-AAGUGU.mcs
MCSYM-DB/4_2/AAGUGU/ds-4_2-AAGUGU_x.pdb.gz
MCSYM-DB/4_2/AAGUUC/
MCSYM-DB/4_2/AAGUUC/4_2-AAGUUC.mcs
MCSYM-DB/4_2/AAUAAU/
MCSYM-DB/4_2/AAUAAU/4_2-AAUAAU.mcs
MCSYM-DB/4_2/AAUAGU/
MCSYM-DB/4_2/AAUAGU/4_2-AAUAGU.mcs
MCSYM-DB/4_2/AAUAUA/
MCSYM-DB/4_2/AAUAUA/4_2-AAUAUA.mcs
MCSYM-DB/4_2/AAUAUC/
MCSYM-DB/4_2/AAUAUC/4_2-AAUAUC.mcs
MCSYM-DB/4_2/AAUAUU/
MCSYM-DB/4_2/AAUAUU/4_2-AAUAUU.mcs
MCSYM-DB/4_2/AAUAUU/ds-4_2-AAUAUU_x.pdb.gz
MCSYM-DB/4_2/AAUCAG/
MCSYM-DB/4_2/AAUCAG/4_2-AAUCAG.mcs
MCSYM-DB/4_2/AAUCAG/ds-4_2-AAUCAG_x.pdb.gz
MCSYM-DB/4_2/AAUCAU/
MCSYM-DB/4_2/AAUCAU/4_2-AAUCAU.mcs
MCSYM-DB/4_2/AAUCCU/
MCSYM-DB/4_2/AAUCCU/4_2-AAUCCU.mcs
MCSYM-DB/4_2/AAUCCU/ds-4_2-AAUCCU_x.pdb.gz
MCSYM-DB/4_2/AAUCGA/
MCSYM-DB/4_2/AAUCGA/4_2-AAUCGA.mcs
MCSYM-DB/4_2/AAUCGC/
MCSYM-DB/4_2/AAUCGC/4_2-AAUCGC.mcs
MCSYM-DB/4_2/AAUCGC/ds-4_2-AAUCGC_x.pdb.gz
MCSYM-DB/4_2/AAUCGG/
MCSYM-DB/4_2/AAUCGG/4_2-AAUCGG.mcs
MCSYM-DB/4_2/AAUCGU/
MCSYM-DB/4_2/AAUCGU/4_2-AAUCGU.mcs
MCSYM-DB/4_2/AAUCGU/ds-4_2-AAUCGU_x.pdb.gz
MCSYM-DB/4_2/AAUCUU/
MCSYM-DB/4_2/AAUCUU/4_2-AAUCUU.mcs
MCSYM-DB/4_2/AAUGAU/
MCSYM-DB/4_2/AAUGAU/4_2-AAUGAU.mcs
MCSYM-DB/4_2/AAUGAU/ds-4_2-AAUGAU_x.pdb.gz
MCSYM-DB/4_2/AAUGCA/
MCSYM-DB/4_2/AAUGCA/4_2-AAUGCA.mcs
MCSYM-DB/4_2/AAUGCC/
MCSYM-DB/4_2/AAUGCC/4_2-AAUGCC.mcs
MCSYM-DB/4_2/AAUGCU/
MCSYM-DB/4_2/AAUGCU/4_2-AAUGCU.mcs
MCSYM-DB/4_2/AAUGCU/ds-4_2-AAUGCU_x.pdb.gz
MCSYM-DB/4_2/AAUGGG/
MCSYM-DB/4_2/AAUGGG/4_2-AAUGGG.mcs
MCSYM-DB/4_2/AAUGUA/
MCSYM-DB/4_2/AAUGUA/4_2-AAUGUA.mcs
MCSYM-DB/4_2/AAUGUG/
MCSYM-DB/4_2/AAUGUG/4_2-AAUGUG.mcs
MCSYM-DB/4_2/AAUGUU/
MCSYM-DB/4_2/AAUGUU/4_2-AAUGUU.mcs
MCSYM-DB/4_2/AAUGUU/ds-4_2-AAUGUU_x.pdb.gz
MCSYM-DB/4_2/AAUUAC/
MCSYM-DB/4_2/AAUUAC/4_2-AAUUAC.mcs
MCSYM-DB/4_2/AAUUAG/
MCSYM-DB/4_2/AAUUAG/4_2-AAUUAG.mcs
MCSYM-DB/4_2/AAUUAU/
MCSYM-DB/4_2/AAUUAU/4_2-AAUUAU.mcs
MCSYM-DB/4_2/AAUUAU/ds-4_2-AAUUAU_x.pdb.gz
MCSYM-DB/4_2/AAUUCU/
MCSYM-DB/4_2/AAUUCU/4_2-AAUUCU.mcs
MCSYM-DB/4_2/AAUUCU/ds-4_2-AAUUCU_x.pdb.gz
MCSYM-DB/4_2/AAUUGC/
MCSYM-DB/4_2/AAUUGC/4_2-AAUUGC.mcs
MCSYM-DB/4_2/AAUUGC/ds-4_2-AAUUGC_x.pdb.gz
MCSYM-DB/4_2/AAUUGG/
MCSYM-DB/4_2/AAUUGG/4_2-AAUUGG.mcs
MCSYM-DB/4_2/AAUUGU/
MCSYM-DB/4_2/AAUUGU/4_2-AAUUGU.mcs
MCSYM-DB/4_2/AAUUUG/
MCSYM-DB/4_2/AAUUUG/4_2-AAUUUG.mcs
MCSYM-DB/4_2/AAUUUU/
MCSYM-DB/4_2/AAUUUU/4_2-AAUUUU.mcs
MCSYM-DB/4_2/ACAAAA/
MCSYM-DB/4_2/ACAAAA/4_2-ACAAAA.mcs
MCSYM-DB/4_2/ACAAAA/ds-4_2-ACAAAA_x.pdb.gz
MCSYM-DB/4_2/ACAACA/
MCSYM-DB/4_2/ACAACA/4_2-ACAACA.mcs
MCSYM-DB/4_2/ACAACA/ds-4_2-ACAACA_x.pdb.gz
MCSYM-DB/4_2/ACAACU/
MCSYM-DB/4_2/ACAACU/4_2-ACAACU.mcs
MCSYM-DB/4_2/ACAAGA/
MCSYM-DB/4_2/ACAAGA/4_2-ACAAGA.mcs
MCSYM-DB/4_2/ACAAGA/ds-4_2-ACAAGA_x.pdb.gz
MCSYM-DB/4_2/ACAAGU/
MCSYM-DB/4_2/ACAAGU/4_2-ACAAGU.mcs
MCSYM-DB/4_2/ACAAUA/
MCSYM-DB/4_2/ACAAUA/4_2-ACAAUA.mcs
MCSYM-DB/4_2/ACAAUC/
MCSYM-DB/4_2/ACAAUC/4_2-ACAAUC.mcs
MCSYM-DB/4_2/ACAAUG/
MCSYM-DB/4_2/ACAAUG/4_2-ACAAUG.mcs
MCSYM-DB/4_2/ACAAUU/
MCSYM-DB/4_2/ACAAUU/4_2-ACAAUU.mcs
MCSYM-DB/4_2/ACAAUU/ds-4_2-ACAAUU_x.pdb.gz
MCSYM-DB/4_2/ACACCC/
MCSYM-DB/4_2/ACACCC/4_2-ACACCC.mcs
MCSYM-DB/4_2/ACACCC/ds-4_2-ACACCC_x.pdb.gz
MCSYM-DB/4_2/ACACCU/
MCSYM-DB/4_2/ACACCU/4_2-ACACCU.mcs
MCSYM-DB/4_2/ACACCU/ds-4_2-ACACCU_x.pdb.gz
MCSYM-DB/4_2/ACACGA/
MCSYM-DB/4_2/ACACGA/4_2-ACACGA.mcs
MCSYM-DB/4_2/ACACGA/ds-4_2-ACACGA_x.pdb.gz
MCSYM-DB/4_2/ACACGC/
MCSYM-DB/4_2/ACACGC/4_2-ACACGC.mcs
MCSYM-DB/4_2/ACACGC/ds-4_2-ACACGC_x.pdb.gz
MCSYM-DB/4_2/ACACGG/
MCSYM-DB/4_2/ACACGG/4_2-ACACGG.mcs
MCSYM-DB/4_2/ACACGU/
MCSYM-DB/4_2/ACACGU/4_2-ACACGU.mcs
MCSYM-DB/4_2/ACACGU/ds-4_2-ACACGU_x.pdb.gz
MCSYM-DB/4_2/ACACUU/
MCSYM-DB/4_2/ACACUU/4_2-ACACUU.mcs
MCSYM-DB/4_2/ACAGAA/
MCSYM-DB/4_2/ACAGAA/4_2-ACAGAA.mcs
MCSYM-DB/4_2/ACAGAA/ds-4_2-ACAGAA_x.pdb.gz
MCSYM-DB/4_2/ACAGAU/
MCSYM-DB/4_2/ACAGAU/4_2-ACAGAU.mcs
MCSYM-DB/4_2/ACAGAU/ds-4_2-ACAGAU_x.pdb.gz
MCSYM-DB/4_2/ACAGCA/
MCSYM-DB/4_2/ACAGCA/4_2-ACAGCA.mcs
MCSYM-DB/4_2/ACAGCA/ds-4_2-ACAGCA_x.pdb.gz
MCSYM-DB/4_2/ACAGCC/
MCSYM-DB/4_2/ACAGCC/4_2-ACAGCC.mcs
MCSYM-DB/4_2/ACAGCC/ds-4_2-ACAGCC_x.pdb.gz
MCSYM-DB/4_2/ACAGCU/
MCSYM-DB/4_2/ACAGCU/4_2-ACAGCU.mcs
MCSYM-DB/4_2/ACAGCU/ds-4_2-ACAGCU_x.pdb.gz
MCSYM-DB/4_2/ACAGUU/
MCSYM-DB/4_2/ACAGUU/4_2-ACAGUU.mcs
MCSYM-DB/4_2/ACAUAA/
MCSYM-DB/4_2/ACAUAA/4_2-ACAUAA.mcs
MCSYM-DB/4_2/ACAUAA/ds-4_2-ACAUAA_x.pdb.gz
MCSYM-DB/4_2/ACAUAC/
MCSYM-DB/4_2/ACAUAC/4_2-ACAUAC.mcs
MCSYM-DB/4_2/ACAUAU/
MCSYM-DB/4_2/ACAUAU/4_2-ACAUAU.mcs
MCSYM-DB/4_2/ACAUAU/ds-4_2-ACAUAU_x.pdb.gz
MCSYM-DB/4_2/ACAUCU/
MCSYM-DB/4_2/ACAUCU/4_2-ACAUCU.mcs
MCSYM-DB/4_2/ACAUGU/
MCSYM-DB/4_2/ACAUGU/4_2-ACAUGU.mcs
MCSYM-DB/4_2/ACAUGU/ds-4_2-ACAUGU_x.pdb.gz
MCSYM-DB/4_2/ACAUUU/
MCSYM-DB/4_2/ACAUUU/4_2-ACAUUU.mcs
MCSYM-DB/4_2/ACCAAA/
MCSYM-DB/4_2/ACCAAA/4_2-ACCAAA.mcs
MCSYM-DB/4_2/ACCAAA/ds-4_2-ACCAAA_x.pdb.gz
MCSYM-DB/4_2/ACCAAU/
MCSYM-DB/4_2/ACCAAU/4_2-ACCAAU.mcs
MCSYM-DB/4_2/ACCAAU/ds-4_2-ACCAAU_x.pdb.gz
MCSYM-DB/4_2/ACCAGU/
MCSYM-DB/4_2/ACCAGU/4_2-ACCAGU.mcs
MCSYM-DB/4_2/ACCAUA/
MCSYM-DB/4_2/ACCAUA/4_2-ACCAUA.mcs
MCSYM-DB/4_2/ACCAUA/ds-4_2-ACCAUA_x.pdb.gz
MCSYM-DB/4_2/ACCAUC/
MCSYM-DB/4_2/ACCAUC/4_2-ACCAUC.mcs
MCSYM-DB/4_2/ACCAUC/ds-4_2-ACCAUC_x.pdb.gz
MCSYM-DB/4_2/ACCAUG/
MCSYM-DB/4_2/ACCAUG/4_2-ACCAUG.mcs
MCSYM-DB/4_2/ACCAUU/
MCSYM-DB/4_2/ACCAUU/4_2-ACCAUU.mcs
MCSYM-DB/4_2/ACCAUU/ds-4_2-ACCAUU_x.pdb.gz
MCSYM-DB/4_2/ACCCCU/
MCSYM-DB/4_2/ACCCCU/4_2-ACCCCU.mcs
MCSYM-DB/4_2/ACCCCU/ds-4_2-ACCCCU_x.pdb.gz
MCSYM-DB/4_2/ACCCGA/
MCSYM-DB/4_2/ACCCGA/4_2-ACCCGA.mcs
MCSYM-DB/4_2/ACCCGC/
MCSYM-DB/4_2/ACCCGC/4_2-ACCCGC.mcs
MCSYM-DB/4_2/ACCCGC/ds-4_2-ACCCGC_x.pdb.gz
MCSYM-DB/4_2/ACCCGU/
MCSYM-DB/4_2/ACCCGU/4_2-ACCCGU.mcs
MCSYM-DB/4_2/ACCCGU/ds-4_2-ACCCGU_x.pdb.gz
MCSYM-DB/4_2/ACCCUC/
MCSYM-DB/4_2/ACCCUC/4_2-ACCCUC.mcs
MCSYM-DB/4_2/ACCGCA/
MCSYM-DB/4_2/ACCGCA/4_2-ACCGCA.mcs
MCSYM-DB/4_2/ACCGCA/ds-4_2-ACCGCA_x.pdb.gz
MCSYM-DB/4_2/ACCGCG/
MCSYM-DB/4_2/ACCGCG/4_2-ACCGCG.mcs
MCSYM-DB/4_2/ACCGCG/ds-4_2-ACCGCG_x.pdb.gz
MCSYM-DB/4_2/ACCGCU/
MCSYM-DB/4_2/ACCGCU/4_2-ACCGCU.mcs
MCSYM-DB/4_2/ACCGCU/ds-4_2-ACCGCU_x.pdb.gz
MCSYM-DB/4_2/ACCUAA/
MCSYM-DB/4_2/ACCUAA/4_2-ACCUAA.mcs
MCSYM-DB/4_2/ACCUAA/ds-4_2-ACCUAA_x.pdb.gz
MCSYM-DB/4_2/ACCUAC/
MCSYM-DB/4_2/ACCUAC/4_2-ACCUAC.mcs
MCSYM-DB/4_2/ACCUAG/
MCSYM-DB/4_2/ACCUAG/4_2-ACCUAG.mcs
MCSYM-DB/4_2/ACCUAG/ds-4_2-ACCUAG_x.pdb.gz
MCSYM-DB/4_2/ACCUAU/
MCSYM-DB/4_2/ACCUAU/4_2-ACCUAU.mcs
MCSYM-DB/4_2/ACCUAU/ds-4_2-ACCUAU_x.pdb.gz
MCSYM-DB/4_2/ACCUCA/
MCSYM-DB/4_2/ACCUCA/4_2-ACCUCA.mcs
MCSYM-DB/4_2/ACCUCA/ds-4_2-ACCUCA_x.pdb.gz
MCSYM-DB/4_2/ACCUCU/
MCSYM-DB/4_2/ACCUCU/4_2-ACCUCU.mcs
MCSYM-DB/4_2/ACCUGA/
MCSYM-DB/4_2/ACCUGA/4_2-ACCUGA.mcs
MCSYM-DB/4_2/ACCUGC/
MCSYM-DB/4_2/ACCUGC/4_2-ACCUGC.mcs
MCSYM-DB/4_2/ACCUGU/
MCSYM-DB/4_2/ACCUGU/4_2-ACCUGU.mcs
MCSYM-DB/4_2/ACCUUG/
MCSYM-DB/4_2/ACCUUG/4_2-ACCUUG.mcs
MCSYM-DB/4_2/ACCUUU/
MCSYM-DB/4_2/ACCUUU/4_2-ACCUUU.mcs
MCSYM-DB/4_2/ACCUUU/ds-4_2-ACCUUU_x.pdb.gz
MCSYM-DB/4_2/ACGAAU/
MCSYM-DB/4_2/ACGAAU/4_2-ACGAAU.mcs
MCSYM-DB/4_2/ACGAAU/ds-4_2-ACGAAU_x.pdb.gz
MCSYM-DB/4_2/ACGACA/
MCSYM-DB/4_2/ACGACA/4_2-ACGACA.mcs
MCSYM-DB/4_2/ACGAGU/
MCSYM-DB/4_2/ACGAGU/4_2-ACGAGU.mcs
MCSYM-DB/4_2/ACGAGU/ds-4_2-ACGAGU_x.pdb.gz
MCSYM-DB/4_2/ACGAUU/
MCSYM-DB/4_2/ACGAUU/4_2-ACGAUU.mcs
MCSYM-DB/4_2/ACGAUU/ds-4_2-ACGAUU_x.pdb.gz
MCSYM-DB/4_2/ACGCCC/
MCSYM-DB/4_2/ACGCCC/4_2-ACGCCC.mcs
MCSYM-DB/4_2/ACGCCC/ds-4_2-ACGCCC_x.pdb.gz
MCSYM-DB/4_2/ACGCGU/
MCSYM-DB/4_2/ACGCGU/4_2-ACGCGU.mcs
MCSYM-DB/4_2/ACGCGU/ds-4_2-ACGCGU_x.pdb.gz
MCSYM-DB/4_2/ACGGCU/
MCSYM-DB/4_2/ACGGCU/4_2-ACGGCU.mcs
MCSYM-DB/4_2/ACGGCU/ds-4_2-ACGGCU_x.pdb.gz
MCSYM-DB/4_2/ACGGGU/
MCSYM-DB/4_2/ACGGGU/4_2-ACGGGU.mcs
MCSYM-DB/4_2/ACGGGU/ds-4_2-ACGGGU_x.pdb.gz
MCSYM-DB/4_2/ACGUAU/
MCSYM-DB/4_2/ACGUAU/4_2-ACGUAU.mcs
MCSYM-DB/4_2/ACGUAU/ds-4_2-ACGUAU_x.pdb.gz
MCSYM-DB/4_2/ACGUGG/
MCSYM-DB/4_2/ACGUGG/4_2-ACGUGG.mcs
MCSYM-DB/4_2/ACGUGU/
MCSYM-DB/4_2/ACGUGU/4_2-ACGUGU.mcs
MCSYM-DB/4_2/ACGUUU/
MCSYM-DB/4_2/ACGUUU/4_2-ACGUUU.mcs
MCSYM-DB/4_2/ACGUUU/ds-4_2-ACGUUU_x.pdb.gz
MCSYM-DB/4_2/ACUAUG/
MCSYM-DB/4_2/ACUAUG/4_2-ACUAUG.mcs
MCSYM-DB/4_2/ACUAUU/
MCSYM-DB/4_2/ACUAUU/4_2-ACUAUU.mcs
MCSYM-DB/4_2/ACUAUU/ds-4_2-ACUAUU_x.pdb.gz
MCSYM-DB/4_2/ACUCAU/
MCSYM-DB/4_2/ACUCAU/4_2-ACUCAU.mcs
MCSYM-DB/4_2/ACUCGC/
MCSYM-DB/4_2/ACUCGC/4_2-ACUCGC.mcs
MCSYM-DB/4_2/ACUCGG/
MCSYM-DB/4_2/ACUCGG/4_2-ACUCGG.mcs
MCSYM-DB/4_2/ACUCGU/
MCSYM-DB/4_2/ACUCGU/4_2-ACUCGU.mcs
MCSYM-DB/4_2/ACUCGU/ds-4_2-ACUCGU_x.pdb.gz
MCSYM-DB/4_2/ACUGAU/
MCSYM-DB/4_2/ACUGAU/4_2-ACUGAU.mcs
MCSYM-DB/4_2/ACUGAU/ds-4_2-ACUGAU_x.pdb.gz
MCSYM-DB/4_2/ACUGCA/
MCSYM-DB/4_2/ACUGCA/4_2-ACUGCA.mcs
MCSYM-DB/4_2/ACUGCU/
MCSYM-DB/4_2/ACUGCU/4_2-ACUGCU.mcs
MCSYM-DB/4_2/ACUGCU/ds-4_2-ACUGCU_x.pdb.gz
MCSYM-DB/4_2/ACUGGA/
MCSYM-DB/4_2/ACUGGA/4_2-ACUGGA.mcs
MCSYM-DB/4_2/ACUGGC/
MCSYM-DB/4_2/ACUGGC/4_2-ACUGGC.mcs
MCSYM-DB/4_2/ACUGGC/ds-4_2-ACUGGC_x.pdb.gz
MCSYM-DB/4_2/ACUGGG/
MCSYM-DB/4_2/ACUGGG/4_2-ACUGGG.mcs
MCSYM-DB/4_2/ACUGUC/
MCSYM-DB/4_2/ACUGUC/4_2-ACUGUC.mcs
MCSYM-DB/4_2/ACUGUC/ds-4_2-ACUGUC_x.pdb.gz
MCSYM-DB/4_2/ACUGUU/
MCSYM-DB/4_2/ACUGUU/4_2-ACUGUU.mcs
MCSYM-DB/4_2/ACUUAC/
MCSYM-DB/4_2/ACUUAC/4_2-ACUUAC.mcs
MCSYM-DB/4_2/ACUUAC/ds-4_2-ACUUAC_x.pdb.gz
MCSYM-DB/4_2/ACUUAU/
MCSYM-DB/4_2/ACUUAU/4_2-ACUUAU.mcs
MCSYM-DB/4_2/ACUUAU/ds-4_2-ACUUAU_x.pdb.gz
MCSYM-DB/4_2/ACUUCU/
MCSYM-DB/4_2/ACUUCU/4_2-ACUUCU.mcs
MCSYM-DB/4_2/ACUUGC/
MCSYM-DB/4_2/ACUUGC/4_2-ACUUGC.mcs
MCSYM-DB/4_2/ACUUGU/
MCSYM-DB/4_2/ACUUGU/4_2-ACUUGU.mcs
MCSYM-DB/4_2/ACUUUA/
MCSYM-DB/4_2/ACUUUA/4_2-ACUUUA.mcs
MCSYM-DB/4_2/ACUUUA/ds-4_2-ACUUUA_x.pdb
MCSYM-DB/4_2/ACUUUA/ds-4_2-ACUUUA_x.pdb.gz
MCSYM-DB/4_2/ACUUUC/
MCSYM-DB/4_2/ACUUUC/4_2-ACUUUC.mcs
MCSYM-DB/4_2/ACUUUC/ds-4_2-ACUUUC_x.pdb.gz
MCSYM-DB/4_2/ACUUUU/
MCSYM-DB/4_2/ACUUUU/4_2-ACUUUU.mcs
MCSYM-DB/4_2/ACUUUU/ds-4_2-ACUUUU_x.pdb.gz
MCSYM-DB/4_2/AGAAAA/
MCSYM-DB/4_2/AGAAAA/4_2-AGAAAA.mcs
MCSYM-DB/4_2/AGAAAA/ds-4_2-AGAAAA_x.pdb.gz
MCSYM-DB/4_2/AGAAAC/
MCSYM-DB/4_2/AGAAAC/4_2-AGAAAC.mcs
MCSYM-DB/4_2/AGAAAC/ds-4_2-AGAAAC_x.pdb.gz
MCSYM-DB/4_2/AGAAAG/
MCSYM-DB/4_2/AGAAAG/4_2-AGAAAG.mcs
MCSYM-DB/4_2/AGAACG/
MCSYM-DB/4_2/AGAACG/4_2-AGAACG.mcs
MCSYM-DB/4_2/AGAACG/ds-4_2-AGAACG_x.pdb.gz
MCSYM-DB/4_2/AGAACU/
MCSYM-DB/4_2/AGAACU/4_2-AGAACU.mcs
MCSYM-DB/4_2/AGAAGC/
MCSYM-DB/4_2/AGAAGC/4_2-AGAAGC.mcs
MCSYM-DB/4_2/AGAAGC/ds-4_2-AGAAGC_x.pdb.gz
MCSYM-DB/4_2/AGAAGU/
MCSYM-DB/4_2/AGAAGU/4_2-AGAAGU.mcs
MCSYM-DB/4_2/AGAAUA/
MCSYM-DB/4_2/AGAAUA/4_2-AGAAUA.mcs
MCSYM-DB/4_2/AGAAUA/ds-4_2-AGAAUA_x.pdb.gz
MCSYM-DB/4_2/AGAAUG/
MCSYM-DB/4_2/AGAAUG/4_2-AGAAUG.mcs
MCSYM-DB/4_2/AGAAUG/ds-4_2-AGAAUG_x.pdb.gz
MCSYM-DB/4_2/AGAAUU/
MCSYM-DB/4_2/AGAAUU/4_2-AGAAUU.mcs
MCSYM-DB/4_2/AGAAUU/ds-4_2-AGAAUU_x.pdb.gz
MCSYM-DB/4_2/AGACAA/
MCSYM-DB/4_2/AGACAA/4_2-AGACAA.mcs
MCSYM-DB/4_2/AGACAA/ds-4_2-AGACAA_x.pdb.gz
MCSYM-DB/4_2/AGACGG/
MCSYM-DB/4_2/AGACGG/4_2-AGACGG.mcs
MCSYM-DB/4_2/AGACGG/ds-4_2-AGACGG_x.pdb.gz
MCSYM-DB/4_2/AGACGU/
MCSYM-DB/4_2/AGACGU/4_2-AGACGU.mcs
MCSYM-DB/4_2/AGAGCG/
MCSYM-DB/4_2/AGAGCG/4_2-AGAGCG.mcs
MCSYM-DB/4_2/AGAGCU/
MCSYM-DB/4_2/AGAGCU/4_2-AGAGCU.mcs
MCSYM-DB/4_2/AGAGCU/ds-4_2-AGAGCU_x.pdb.gz
MCSYM-DB/4_2/AGAGGU/
MCSYM-DB/4_2/AGAGGU/4_2-AGAGGU.mcs
MCSYM-DB/4_2/AGAGUA/
MCSYM-DB/4_2/AGAGUA/4_2-AGAGUA.mcs
MCSYM-DB/4_2/AGAGUG/
MCSYM-DB/4_2/AGAGUG/4_2-AGAGUG.mcs
MCSYM-DB/4_2/AGAGUG/ds-4_2-AGAGUG_x.pdb.gz
MCSYM-DB/4_2/AGAGUU/
MCSYM-DB/4_2/AGAGUU/4_2-AGAGUU.mcs
MCSYM-DB/4_2/AGAGUU/ds-4_2-AGAGUU_x.pdb.gz
MCSYM-DB/4_2/AGAUAA/
MCSYM-DB/4_2/AGAUAA/4_2-AGAUAA.mcs
MCSYM-DB/4_2/AGAUAA/ds-4_2-AGAUAA_x.pdb.gz
MCSYM-DB/4_2/AGAUAC/
MCSYM-DB/4_2/AGAUAC/4_2-AGAUAC.mcs
MCSYM-DB/4_2/AGAUAG/
MCSYM-DB/4_2/AGAUAG/4_2-AGAUAG.mcs
MCSYM-DB/4_2/AGAUAU/
MCSYM-DB/4_2/AGAUAU/4_2-AGAUAU.mcs
MCSYM-DB/4_2/AGAUAU/ds-4_2-AGAUAU_x.pdb.gz
MCSYM-DB/4_2/AGAUCU/
MCSYM-DB/4_2/AGAUCU/4_2-AGAUCU.mcs
MCSYM-DB/4_2/AGAUCU/ds-4_2-AGAUCU_x.pdb.gz
MCSYM-DB/4_2/AGAUGG/
MCSYM-DB/4_2/AGAUGG/4_2-AGAUGG.mcs
MCSYM-DB/4_2/AGAUGG/ds-4_2-AGAUGG_x.pdb.gz
MCSYM-DB/4_2/AGAUGU/
MCSYM-DB/4_2/AGAUGU/4_2-AGAUGU.mcs
MCSYM-DB/4_2/AGAUUU/
MCSYM-DB/4_2/AGAUUU/4_2-AGAUUU.mcs
MCSYM-DB/4_2/AGCAAU/
MCSYM-DB/4_2/AGCAAU/4_2-AGCAAU.mcs
MCSYM-DB/4_2/AGCACA/
MCSYM-DB/4_2/AGCACA/4_2-AGCACA.mcs
MCSYM-DB/4_2/AGCACA/ds-4_2-AGCACA_x.pdb.gz
MCSYM-DB/4_2/AGCAGA/
MCSYM-DB/4_2/AGCAGA/4_2-AGCAGA.mcs
MCSYM-DB/4_2/AGCAGA/ds-4_2-AGCAGA_x.pdb.gz
MCSYM-DB/4_2/AGCAGU/
MCSYM-DB/4_2/AGCAGU/4_2-AGCAGU.mcs
MCSYM-DB/4_2/AGCAGU/ds-4_2-AGCAGU_x.pdb.gz
MCSYM-DB/4_2/AGCAUA/
MCSYM-DB/4_2/AGCAUA/4_2-AGCAUA.mcs
MCSYM-DB/4_2/AGCAUA/ds-4_2-AGCAUA_x.pdb.gz
MCSYM-DB/4_2/AGCAUG/
MCSYM-DB/4_2/AGCAUG/4_2-AGCAUG.mcs
MCSYM-DB/4_2/AGCAUG/ds-4_2-AGCAUG_x.pdb.gz
MCSYM-DB/4_2/AGCAUU/
MCSYM-DB/4_2/AGCAUU/4_2-AGCAUU.mcs
MCSYM-DB/4_2/AGCAUU/ds-4_2-AGCAUU_x.pdb.gz
MCSYM-DB/4_2/AGCCCU/
MCSYM-DB/4_2/AGCCCU/4_2-AGCCCU.mcs
MCSYM-DB/4_2/AGCCGA/
MCSYM-DB/4_2/AGCCGA/4_2-AGCCGA.mcs
MCSYM-DB/4_2/AGCCGA/ds-4_2-AGCCGA_x.pdb.gz
MCSYM-DB/4_2/AGCCGC/
MCSYM-DB/4_2/AGCCGC/4_2-AGCCGC.mcs
MCSYM-DB/4_2/AGCCGG/
MCSYM-DB/4_2/AGCCGG/4_2-AGCCGG.mcs
MCSYM-DB/4_2/AGCCGU/
MCSYM-DB/4_2/AGCCGU/4_2-AGCCGU.mcs
MCSYM-DB/4_2/AGCCGU/ds-4_2-AGCCGU_x.pdb.gz
MCSYM-DB/4_2/AGCGCA/
MCSYM-DB/4_2/AGCGCA/4_2-AGCGCA.mcs
MCSYM-DB/4_2/AGCGCU/
MCSYM-DB/4_2/AGCGCU/4_2-AGCGCU.mcs
MCSYM-DB/4_2/AGCGCU/ds-4_2-AGCGCU_x.pdb.gz
MCSYM-DB/4_2/AGCUAA/
MCSYM-DB/4_2/AGCUAA/4_2-AGCUAA.mcs
MCSYM-DB/4_2/AGCUAA/ds-4_2-AGCUAA_x.pdb.gz
MCSYM-DB/4_2/AGCUAG/
MCSYM-DB/4_2/AGCUAG/4_2-AGCUAG.mcs
MCSYM-DB/4_2/AGCUAG/ds-4_2-AGCUAG_x.pdb.gz
MCSYM-DB/4_2/AGCUAU/
MCSYM-DB/4_2/AGCUAU/4_2-AGCUAU.mcs
MCSYM-DB/4_2/AGCUAU/ds-4_2-AGCUAU_x.pdb.gz
MCSYM-DB/4_2/AGCUGU/
MCSYM-DB/4_2/AGCUGU/4_2-AGCUGU.mcs
MCSYM-DB/4_2/AGCUUU/
MCSYM-DB/4_2/AGCUUU/4_2-AGCUUU.mcs
MCSYM-DB/4_2/AGCUUU/ds-4_2-AGCUUU_x.pdb.gz
MCSYM-DB/4_2/AGGAAU/
MCSYM-DB/4_2/AGGAAU/4_2-AGGAAU.mcs
MCSYM-DB/4_2/AGGAGG/
MCSYM-DB/4_2/AGGAGG/4_2-AGGAGG.mcs
MCSYM-DB/4_2/AGGAGG/ds-4_2-AGGAGG_x.pdb.gz
MCSYM-DB/4_2/AGGAGU/
MCSYM-DB/4_2/AGGAGU/4_2-AGGAGU.mcs
MCSYM-DB/4_2/AGGAGU/ds-4_2-AGGAGU_x.pdb.gz
MCSYM-DB/4_2/AGGAUG/
MCSYM-DB/4_2/AGGAUG/4_2-AGGAUG.mcs
MCSYM-DB/4_2/AGGAUG/ds-4_2-AGGAUG_x.pdb.gz
MCSYM-DB/4_2/AGGAUU/
MCSYM-DB/4_2/AGGAUU/4_2-AGGAUU.mcs
MCSYM-DB/4_2/AGGAUU/ds-4_2-AGGAUU_x.pdb.gz
MCSYM-DB/4_2/AGGCAC/
MCSYM-DB/4_2/AGGCAC/4_2-AGGCAC.mcs
MCSYM-DB/4_2/AGGCAC/ds-4_2-AGGCAC_x.pdb.gz
MCSYM-DB/4_2/AGGCAG/
MCSYM-DB/4_2/AGGCAG/4_2-AGGCAG.mcs
MCSYM-DB/4_2/AGGCCG/
MCSYM-DB/4_2/AGGCCG/4_2-AGGCCG.mcs
MCSYM-DB/4_2/AGGCCG/ds-4_2-AGGCCG_x.pdb.gz
MCSYM-DB/4_2/AGGCCU/
MCSYM-DB/4_2/AGGCCU/4_2-AGGCCU.mcs
MCSYM-DB/4_2/AGGCGA/
MCSYM-DB/4_2/AGGCGA/4_2-AGGCGA.mcs
MCSYM-DB/4_2/AGGCGA/ds-4_2-AGGCGA_x.pdb.gz
MCSYM-DB/4_2/AGGCGC/
MCSYM-DB/4_2/AGGCGC/4_2-AGGCGC.mcs
MCSYM-DB/4_2/AGGCGG/
MCSYM-DB/4_2/AGGCGG/1N8X_model_1.pdb.gz
MCSYM-DB/4_2/AGGCGG/1OSW_model_1.pdb.gz
MCSYM-DB/4_2/AGGCGG/2D17_model_1.pdb.gz
MCSYM-DB/4_2/AGGCGG/2D1A_model_1.pdb.gz
MCSYM-DB/4_2/AGGCGG/2GM0_model_1.pdb.gz
MCSYM-DB/4_2/AGGCGG/4_2-AGGCGG.mcs
MCSYM-DB/4_2/AGGCGG/ds-4_2-AGGCGG_x.pdb.gz
MCSYM-DB/4_2/AGGCGU/
MCSYM-DB/4_2/AGGCGU/4_2-AGGCGU.mcs
MCSYM-DB/4_2/AGGCGU/ds-4_2-AGGCGU_x.pdb.gz
MCSYM-DB/4_2/AGGCUC/
MCSYM-DB/4_2/AGGCUC/4_2-AGGCUC.mcs
MCSYM-DB/4_2/AGGCUC/ds-4_2-AGGCUC_x.pdb.gz
MCSYM-DB/4_2/AGGCUG/
MCSYM-DB/4_2/AGGCUG/4_2-AGGCUG.mcs
MCSYM-DB/4_2/AGGGAG/
MCSYM-DB/4_2/AGGGAG/4_2-AGGGAG.mcs
MCSYM-DB/4_2/AGGGAG/ds-4_2-AGGGAG_x.pdb.gz
MCSYM-DB/4_2/AGGGAU/
MCSYM-DB/4_2/AGGGAU/4_2-AGGGAU.mcs
MCSYM-DB/4_2/AGGGCU/
MCSYM-DB/4_2/AGGGCU/4_2-AGGGCU.mcs
MCSYM-DB/4_2/AGGGGG/
MCSYM-DB/4_2/AGGGGG/4_2-AGGGGG.mcs
MCSYM-DB/4_2/AGGGGU/
MCSYM-DB/4_2/AGGGGU/4_2-AGGGGU.mcs
MCSYM-DB/4_2/AGGGGU/ds-4_2-AGGGGU_x.pdb.gz
MCSYM-DB/4_2/AGGUAG/
MCSYM-DB/4_2/AGGUAG/4_2-AGGUAG.mcs
MCSYM-DB/4_2/AGGUAG/ds-4_2-AGGUAG_x.pdb.gz
MCSYM-DB/4_2/AGGUAU/
MCSYM-DB/4_2/AGGUAU/4_2-AGGUAU.mcs
MCSYM-DB/4_2/AGGUAU/ds-4_2-AGGUAU_x.pdb.gz
MCSYM-DB/4_2/AGGUCU/
MCSYM-DB/4_2/AGGUCU/4_2-AGGUCU.mcs
MCSYM-DB/4_2/AGGUGG/
MCSYM-DB/4_2/AGGUGG/4_2-AGGUGG.mcs
MCSYM-DB/4_2/AGGUGG/ds-4_2-AGGUGG_x.pdb.gz
MCSYM-DB/4_2/AGGUUG/
MCSYM-DB/4_2/AGGUUG/4_2-AGGUUG.mcs
MCSYM-DB/4_2/AGGUUU/
MCSYM-DB/4_2/AGGUUU/4_2-AGGUUU.mcs
MCSYM-DB/4_2/AGUAAU/
MCSYM-DB/4_2/AGUAAU/4_2-AGUAAU.mcs
MCSYM-DB/4_2/AGUAAU/ds-4_2-AGUAAU_x.pdb.gz
MCSYM-DB/4_2/AGUACU/
MCSYM-DB/4_2/AGUACU/4_2-AGUACU.mcs
MCSYM-DB/4_2/AGUAGG/
MCSYM-DB/4_2/AGUAGG/4_2-AGUAGG.mcs
MCSYM-DB/4_2/AGUAGU/
MCSYM-DB/4_2/AGUAGU/4_2-AGUAGU.mcs
MCSYM-DB/4_2/AGUAUC/
MCSYM-DB/4_2/AGUAUC/4_2-AGUAUC.mcs
MCSYM-DB/4_2/AGUAUU/
MCSYM-DB/4_2/AGUAUU/4_2-AGUAUU.mcs
MCSYM-DB/4_2/AGUAUU/ds-4_2-AGUAUU_x.pdb.gz
MCSYM-DB/4_2/AGUCGA/
MCSYM-DB/4_2/AGUCGA/4_2-AGUCGA.mcs
MCSYM-DB/4_2/AGUCGC/
MCSYM-DB/4_2/AGUCGC/4_2-AGUCGC.mcs
MCSYM-DB/4_2/AGUCGG/
MCSYM-DB/4_2/AGUCGG/4_2-AGUCGG.mcs
MCSYM-DB/4_2/AGUCGG/ds-4_2-AGUCGG_x.pdb.gz
MCSYM-DB/4_2/AGUCGU/
MCSYM-DB/4_2/AGUCGU/1FG0_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/1IVS_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/1QU2_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/1VQ7_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/2BTE_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/2CSX_model_1.pdb.gz
MCSYM-DB/4_2/AGUCGU/4_2-AGUCGU.mcs
MCSYM-DB/4_2/AGUCGU/ds-4_2-AGUCGU_x.pdb.gz
MCSYM-DB/4_2/AGUGAG/
MCSYM-DB/4_2/AGUGAG/4_2-AGUGAG.mcs
MCSYM-DB/4_2/AGUGAG/ds-4_2-AGUGAG_x.pdb.gz
MCSYM-DB/4_2/AGUGCA/
MCSYM-DB/4_2/AGUGCA/4_2-AGUGCA.mcs
MCSYM-DB/4_2/AGUGCA/ds-4_2-AGUGCA_x.pdb.gz
MCSYM-DB/4_2/AGUGCG/
MCSYM-DB/4_2/AGUGCG/4_2-AGUGCG.mcs
MCSYM-DB/4_2/AGUGCU/
MCSYM-DB/4_2/AGUGCU/4_2-AGUGCU.mcs
MCSYM-DB/4_2/AGUGCU/ds-4_2-AGUGCU_x.pdb.gz
MCSYM-DB/4_2/AGUGGG/
MCSYM-DB/4_2/AGUGGG/4_2-AGUGGG.mcs
MCSYM-DB/4_2/AGUGUU/
MCSYM-DB/4_2/AGUGUU/4_2-AGUGUU.mcs
MCSYM-DB/4_2/AGUGUU/ds-4_2-AGUGUU_x.pdb.gz
MCSYM-DB/4_2/AGUUAC/
MCSYM-DB/4_2/AGUUAC/4_2-AGUUAC.mcs
MCSYM-DB/4_2/AGUUAU/
MCSYM-DB/4_2/AGUUAU/4_2-AGUUAU.mcs
MCSYM-DB/4_2/AGUUAU/ds-4_2-AGUUAU_x.pdb.gz
MCSYM-DB/4_2/AGUUCC/
MCSYM-DB/4_2/AGUUCC/4_2-AGUUCC.mcs
MCSYM-DB/4_2/AGUUCG/
MCSYM-DB/4_2/AGUUCG/4_2-AGUUCG.mcs
MCSYM-DB/4_2/AGUUCG/ds-4_2-AGUUCG_x.pdb.gz
MCSYM-DB/4_2/AGUUCU/
MCSYM-DB/4_2/AGUUCU/4_2-AGUUCU.mcs
MCSYM-DB/4_2/AGUUGG/
MCSYM-DB/4_2/AGUUGG/4_2-AGUUGG.mcs
MCSYM-DB/4_2/AGUUGU/
MCSYM-DB/4_2/AGUUGU/4_2-AGUUGU.mcs
MCSYM-DB/4_2/AGUUGU/ds-4_2-AGUUGU_x.pdb.gz
MCSYM-DB/4_2/AGUUUC/
MCSYM-DB/4_2/AGUUUC/4_2-AGUUUC.mcs
MCSYM-DB/4_2/AGUUUU/
MCSYM-DB/4_2/AGUUUU/4_2-AGUUUU.mcs
MCSYM-DB/4_2/AUAAAU/
MCSYM-DB/4_2/AUAAAU/4_2-AUAAAU.mcs
MCSYM-DB/4_2/AUAACU/
MCSYM-DB/4_2/AUAACU/4_2-AUAACU.mcs
MCSYM-DB/4_2/AUAACU/ds-4_2-AUAACU_x.pdb.gz
MCSYM-DB/4_2/AUAAGG/
MCSYM-DB/4_2/AUAAGG/4_2-AUAAGG.mcs
MCSYM-DB/4_2/AUAAGU/
MCSYM-DB/4_2/AUAAGU/4_2-AUAAGU.mcs
MCSYM-DB/4_2/AUAAUG/
MCSYM-DB/4_2/AUAAUG/4_2-AUAAUG.mcs
MCSYM-DB/4_2/AUAAUG/ds-4_2-AUAAUG_x.pdb.gz
MCSYM-DB/4_2/AUAAUU/
MCSYM-DB/4_2/AUAAUU/4_2-AUAAUU.mcs
MCSYM-DB/4_2/AUAAUU/ds-4_2-AUAAUU_x.pdb.gz
MCSYM-DB/4_2/AUACCU/
MCSYM-DB/4_2/AUACCU/4_2-AUACCU.mcs
MCSYM-DB/4_2/AUACGC/
MCSYM-DB/4_2/AUACGC/4_2-AUACGC.mcs
MCSYM-DB/4_2/AUACGC/ds-4_2-AUACGC_x.pdb.gz
MCSYM-DB/4_2/AUACGU/
MCSYM-DB/4_2/AUACGU/4_2-AUACGU.mcs
MCSYM-DB/4_2/AUACGU/ds-4_2-AUACGU_x.pdb.gz
MCSYM-DB/4_2/AUAGAU/
MCSYM-DB/4_2/AUAGAU/4_2-AUAGAU.mcs
MCSYM-DB/4_2/AUAGCA/
MCSYM-DB/4_2/AUAGCA/4_2-AUAGCA.mcs
MCSYM-DB/4_2/AUAGCC/
MCSYM-DB/4_2/AUAGCC/4_2-AUAGCC.mcs
MCSYM-DB/4_2/AUAGCC/ds-4_2-AUAGCC_x.pdb.gz
MCSYM-DB/4_2/AUAGCU/
MCSYM-DB/4_2/AUAGCU/4_2-AUAGCU.mcs
MCSYM-DB/4_2/AUAGCU/ds-4_2-AUAGCU_x.pdb.gz
MCSYM-DB/4_2/AUAGGU/
MCSYM-DB/4_2/AUAGGU/4_2-AUAGGU.mcs
MCSYM-DB/4_2/AUAGUA/
MCSYM-DB/4_2/AUAGUA/4_2-AUAGUA.mcs
MCSYM-DB/4_2/AUAGUU/
MCSYM-DB/4_2/AUAGUU/4_2-AUAGUU.mcs
MCSYM-DB/4_2/AUAUAC/
MCSYM-DB/4_2/AUAUAC/4_2-AUAUAC.mcs
MCSYM-DB/4_2/AUAUAC/ds-4_2-AUAUAC_x.pdb.gz
MCSYM-DB/4_2/AUAUAU/
MCSYM-DB/4_2/AUAUAU/4_2-AUAUAU.mcs
MCSYM-DB/4_2/AUAUCU/
MCSYM-DB/4_2/AUAUCU/4_2-AUAUCU.mcs
MCSYM-DB/4_2/AUAUGA/
MCSYM-DB/4_2/AUAUGA/4_2-AUAUGA.mcs
MCSYM-DB/4_2/AUAUGC/
MCSYM-DB/4_2/AUAUGC/4_2-AUAUGC.mcs
MCSYM-DB/4_2/AUAUGG/
MCSYM-DB/4_2/AUAUGG/4_2-AUAUGG.mcs
MCSYM-DB/4_2/AUAUGU/
MCSYM-DB/4_2/AUAUGU/4_2-AUAUGU.mcs
MCSYM-DB/4_2/AUAUGU/ds-4_2-AUAUGU_x.pdb.gz
MCSYM-DB/4_2/AUAUUC/
MCSYM-DB/4_2/AUAUUC/4_2-AUAUUC.mcs
MCSYM-DB/4_2/AUAUUG/
MCSYM-DB/4_2/AUAUUG/4_2-AUAUUG.mcs
MCSYM-DB/4_2/AUAUUG/ds-4_2-AUAUUG_x.pdb.gz
MCSYM-DB/4_2/AUAUUU/
MCSYM-DB/4_2/AUAUUU/4_2-AUAUUU.mcs
MCSYM-DB/4_2/AUAUUU/ds-4_2-AUAUUU_x.pdb.gz
MCSYM-DB/4_2/AUCACU/
MCSYM-DB/4_2/AUCACU/4_2-AUCACU.mcs
MCSYM-DB/4_2/AUCAGA/
MCSYM-DB/4_2/AUCAGA/2gdi_model_1.pdb.gz
MCSYM-DB/4_2/AUCAGA/4_2-AUCAGA.mcs
MCSYM-DB/4_2/AUCAGA/ds-4_2-AUCAGA_x.pdb.gz
MCSYM-DB/4_2/AUCAUG/
MCSYM-DB/4_2/AUCAUG/4_2-AUCAUG.mcs
MCSYM-DB/4_2/AUCAUG/ds-4_2-AUCAUG_x.pdb.gz
MCSYM-DB/4_2/AUCAUU/
MCSYM-DB/4_2/AUCAUU/4_2-AUCAUU.mcs
MCSYM-DB/4_2/AUCAUU/ds-4_2-AUCAUU_x.pdb.gz
MCSYM-DB/4_2/AUCCAU/
MCSYM-DB/4_2/AUCCAU/4_2-AUCCAU.mcs
MCSYM-DB/4_2/AUCCCC/
MCSYM-DB/4_2/AUCCCC/4_2-AUCCCC.mcs
MCSYM-DB/4_2/AUCCCU/
MCSYM-DB/4_2/AUCCCU/4_2-AUCCCU.mcs
MCSYM-DB/4_2/AUCCGA/
MCSYM-DB/4_2/AUCCGA/4_2-AUCCGA.mcs
MCSYM-DB/4_2/AUCCGC/
MCSYM-DB/4_2/AUCCGC/4_2-AUCCGC.mcs
MCSYM-DB/4_2/AUCCGC/ds-4_2-AUCCGC_x.pdb.gz
MCSYM-DB/4_2/AUCCGU/
MCSYM-DB/4_2/AUCCGU/1R3E_model_1.pdb.gz
MCSYM-DB/4_2/AUCCGU/1ZL3_model_1.pdb.gz
MCSYM-DB/4_2/AUCCGU/4_2-AUCCGU.mcs
MCSYM-DB/4_2/AUCCGU/ds-4_2-AUCCGU_x.pdb.gz
MCSYM-DB/4_2/AUCCUC/
MCSYM-DB/4_2/AUCCUC/4_2-AUCCUC.mcs
MCSYM-DB/4_2/AUCCUU/
MCSYM-DB/4_2/AUCCUU/4_2-AUCCUU.mcs
MCSYM-DB/4_2/AUCCUU/ds-4_2-AUCCUU_x.pdb.gz
MCSYM-DB/4_2/AUCGAU/
MCSYM-DB/4_2/AUCGAU/4_2-AUCGAU.mcs
MCSYM-DB/4_2/AUCGAU/ds-4_2-AUCGAU_x.pdb.gz
MCSYM-DB/4_2/AUCGCU/
MCSYM-DB/4_2/AUCGCU/4_2-AUCGCU.mcs
MCSYM-DB/4_2/AUCGCU/ds-4_2-AUCGCU_x.pdb.gz
MCSYM-DB/4_2/AUCGUU/
MCSYM-DB/4_2/AUCGUU/4_2-AUCGUU.mcs
MCSYM-DB/4_2/AUCGUU/ds-4_2-AUCGUU_x.pdb.gz
MCSYM-DB/4_2/AUCUAU/
MCSYM-DB/4_2/AUCUAU/4_2-AUCUAU.mcs
MCSYM-DB/4_2/AUCUAU/ds-4_2-AUCUAU_x.pdb.gz
MCSYM-DB/4_2/AUCUCA/
MCSYM-DB/4_2/AUCUCA/4_2-AUCUCA.mcs
MCSYM-DB/4_2/AUCUCA/ds-4_2-AUCUCA_x.pdb.gz
MCSYM-DB/4_2/AUCUCC/
MCSYM-DB/4_2/AUCUCC/4_2-AUCUCC.mcs
MCSYM-DB/4_2/AUCUCC/ds-4_2-AUCUCC_x.pdb.gz
MCSYM-DB/4_2/AUCUCU/
MCSYM-DB/4_2/AUCUCU/4_2-AUCUCU.mcs
MCSYM-DB/4_2/AUCUGU/
MCSYM-DB/4_2/AUCUGU/4_2-AUCUGU.mcs
MCSYM-DB/4_2/AUCUGU/ds-4_2-AUCUGU_x.pdb.gz
MCSYM-DB/4_2/AUCUUG/
MCSYM-DB/4_2/AUCUUG/4_2-AUCUUG.mcs
MCSYM-DB/4_2/AUCUUU/
MCSYM-DB/4_2/AUCUUU/4_2-AUCUUU.mcs
MCSYM-DB/4_2/AUGAAU/
MCSYM-DB/4_2/AUGAAU/4_2-AUGAAU.mcs
MCSYM-DB/4_2/AUGAAU/ds-4_2-AUGAAU_x.pdb.gz
MCSYM-DB/4_2/AUGAGC/
MCSYM-DB/4_2/AUGAGC/4_2-AUGAGC.mcs
MCSYM-DB/4_2/AUGAUA/
MCSYM-DB/4_2/AUGAUA/4_2-AUGAUA.mcs
MCSYM-DB/4_2/AUGAUG/
MCSYM-DB/4_2/AUGAUG/4_2-AUGAUG.mcs
MCSYM-DB/4_2/AUGAUG/ds-4_2-AUGAUG_x.pdb.gz
MCSYM-DB/4_2/AUGAUU/
MCSYM-DB/4_2/AUGAUU/4_2-AUGAUU.mcs
MCSYM-DB/4_2/AUGAUU/ds-4_2-AUGAUU_x.pdb.gz
MCSYM-DB/4_2/AUGCGG/
MCSYM-DB/4_2/AUGCGG/4_2-AUGCGG.mcs
MCSYM-DB/4_2/AUGCGG/ds-4_2-AUGCGG_x.pdb.gz
MCSYM-DB/4_2/AUGCGU/
MCSYM-DB/4_2/AUGCGU/4_2-AUGCGU.mcs
MCSYM-DB/4_2/AUGCGU/ds-4_2-AUGCGU_x.pdb.gz
MCSYM-DB/4_2/AUGCUG/
MCSYM-DB/4_2/AUGCUG/4_2-AUGCUG.mcs
MCSYM-DB/4_2/AUGGAU/
MCSYM-DB/4_2/AUGGAU/4_2-AUGGAU.mcs
MCSYM-DB/4_2/AUGGAU/ds-4_2-AUGGAU_x.pdb.gz
MCSYM-DB/4_2/AUGGCA/
MCSYM-DB/4_2/AUGGCA/4_2-AUGGCA.mcs
MCSYM-DB/4_2/AUGGCG/
MCSYM-DB/4_2/AUGGCG/4_2-AUGGCG.mcs
MCSYM-DB/4_2/AUGGCG/ds-4_2-AUGGCG_x.pdb.gz
MCSYM-DB/4_2/AUGGCU/
MCSYM-DB/4_2/AUGGCU/4_2-AUGGCU.mcs
MCSYM-DB/4_2/AUGGCU/ds-4_2-AUGGCU_x.pdb.gz
MCSYM-DB/4_2/AUGGGA/
MCSYM-DB/4_2/AUGGGA/4_2-AUGGGA.mcs
MCSYM-DB/4_2/AUGGUG/
MCSYM-DB/4_2/AUGGUG/4_2-AUGGUG.mcs
MCSYM-DB/4_2/AUGGUG/ds-4_2-AUGGUG_x.pdb.gz
MCSYM-DB/4_2/AUGGUU/
MCSYM-DB/4_2/AUGGUU/4_2-AUGGUU.mcs
MCSYM-DB/4_2/AUGGUU/ds-4_2-AUGGUU_x.pdb.gz
MCSYM-DB/4_2/AUGUAA/
MCSYM-DB/4_2/AUGUAA/4_2-AUGUAA.mcs
MCSYM-DB/4_2/AUGUAG/
MCSYM-DB/4_2/AUGUAG/4_2-AUGUAG.mcs
MCSYM-DB/4_2/AUGUAU/
MCSYM-DB/4_2/AUGUAU/4_2-AUGUAU.mcs
MCSYM-DB/4_2/AUGUGU/
MCSYM-DB/4_2/AUGUGU/4_2-AUGUGU.mcs
MCSYM-DB/4_2/AUGUGU/ds-4_2-AUGUGU_x.pdb.gz
MCSYM-DB/4_2/AUGUUG/
MCSYM-DB/4_2/AUGUUG/4_2-AUGUUG.mcs
MCSYM-DB/4_2/AUGUUG/ds-4_2-AUGUUG_x.pdb.gz
MCSYM-DB/4_2/AUGUUU/
MCSYM-DB/4_2/AUGUUU/4_2-AUGUUU.mcs
MCSYM-DB/4_2/AUUAAU/
MCSYM-DB/4_2/AUUAAU/4_2-AUUAAU.mcs
MCSYM-DB/4_2/AUUAUG/
MCSYM-DB/4_2/AUUAUG/4_2-AUUAUG.mcs
MCSYM-DB/4_2/AUUAUU/
MCSYM-DB/4_2/AUUAUU/4_2-AUUAUU.mcs
MCSYM-DB/4_2/AUUAUU/ds-4_2-AUUAUU_x.pdb.gz
MCSYM-DB/4_2/AUUCAU/
MCSYM-DB/4_2/AUUCAU/4_2-AUUCAU.mcs
MCSYM-DB/4_2/AUUCCU/
MCSYM-DB/4_2/AUUCCU/4_2-AUUCCU.mcs
MCSYM-DB/4_2/AUUCGA/
MCSYM-DB/4_2/AUUCGA/4_2-AUUCGA.mcs
MCSYM-DB/4_2/AUUCGA/ds-4_2-AUUCGA_x.pdb.gz
MCSYM-DB/4_2/AUUCGG/
MCSYM-DB/4_2/AUUCGG/4_2-AUUCGG.mcs
MCSYM-DB/4_2/AUUCGU/
MCSYM-DB/4_2/AUUCGU/4_2-AUUCGU.mcs
MCSYM-DB/4_2/AUUCGU/ds-4_2-AUUCGU_x.pdb.gz
MCSYM-DB/4_2/AUUGAU/
MCSYM-DB/4_2/AUUGAU/4_2-AUUGAU.mcs
MCSYM-DB/4_2/AUUGAU/ds-4_2-AUUGAU_x.pdb.gz
MCSYM-DB/4_2/AUUGCA/
MCSYM-DB/4_2/AUUGCA/4_2-AUUGCA.mcs
MCSYM-DB/4_2/AUUGCC/
MCSYM-DB/4_2/AUUGCC/4_2-AUUGCC.mcs
MCSYM-DB/4_2/AUUGCG/
MCSYM-DB/4_2/AUUGCG/4_2-AUUGCG.mcs
MCSYM-DB/4_2/AUUGCU/
MCSYM-DB/4_2/AUUGCU/4_2-AUUGCU.mcs
MCSYM-DB/4_2/AUUGCU/ds-4_2-AUUGCU_x.pdb.gz
MCSYM-DB/4_2/AUUGUA/
MCSYM-DB/4_2/AUUGUA/4_2-AUUGUA.mcs
MCSYM-DB/4_2/AUUGUG/
MCSYM-DB/4_2/AUUGUG/4_2-AUUGUG.mcs
MCSYM-DB/4_2/AUUGUU/
MCSYM-DB/4_2/AUUGUU/4_2-AUUGUU.mcs
MCSYM-DB/4_2/AUUGUU/ds-4_2-AUUGUU_x.pdb.gz
MCSYM-DB/4_2/AUUUAA/
MCSYM-DB/4_2/AUUUAA/4_2-AUUUAA.mcs
MCSYM-DB/4_2/AUUUAG/
MCSYM-DB/4_2/AUUUAG/4_2-AUUUAG.mcs
MCSYM-DB/4_2/AUUUAU/
MCSYM-DB/4_2/AUUUAU/4_2-AUUUAU.mcs
MCSYM-DB/4_2/AUUUAU/ds-4_2-AUUUAU_x.pdb.gz
MCSYM-DB/4_2/AUUUCU/
MCSYM-DB/4_2/AUUUCU/4_2-AUUUCU.mcs
MCSYM-DB/4_2/AUUUGA/
MCSYM-DB/4_2/AUUUGA/4_2-AUUUGA.mcs
MCSYM-DB/4_2/AUUUGG/
MCSYM-DB/4_2/AUUUGG/4_2-AUUUGG.mcs
MCSYM-DB/4_2/AUUUGU/
MCSYM-DB/4_2/AUUUGU/4_2-AUUUGU.mcs
MCSYM-DB/4_2/AUUUUC/
MCSYM-DB/4_2/AUUUUC/4_2-AUUUUC.mcs
MCSYM-DB/4_2/AUUUUG/
MCSYM-DB/4_2/AUUUUG/4_2-AUUUUG.mcs
MCSYM-DB/4_2/AUUUUU/
MCSYM-DB/4_2/AUUUUU/4_2-AUUUUU.mcs
MCSYM-DB/4_2/CAAAAC/
MCSYM-DB/4_2/CAAAAC/4_2-CAAAAC.mcs
MCSYM-DB/4_2/CAAAAC/ds-4_2-CAAAAC_x.pdb.gz
MCSYM-DB/4_2/CAAAAG/
MCSYM-DB/4_2/CAAAAG/4_2-CAAAAG.mcs
MCSYM-DB/4_2/CAAAAG/ds-4_2-CAAAAG_x.pdb.gz
MCSYM-DB/4_2/CAAACC/
MCSYM-DB/4_2/CAAACC/4_2-CAAACC.mcs
MCSYM-DB/4_2/CAAACG/
MCSYM-DB/4_2/CAAACG/4_2-CAAACG.mcs
MCSYM-DB/4_2/CAAAGG/
MCSYM-DB/4_2/CAAAGG/4_2-CAAAGG.mcs
MCSYM-DB/4_2/CAAAGG/ds-4_2-CAAAGG_x.pdb.gz
MCSYM-DB/4_2/CAAAUA/
MCSYM-DB/4_2/CAAAUA/4_2-CAAAUA.mcs
MCSYM-DB/4_2/CAAAUA/ds-4_2-CAAAUA_x.pdb.gz
MCSYM-DB/4_2/CAAAUC/
MCSYM-DB/4_2/CAAAUC/4_2-CAAAUC.mcs
MCSYM-DB/4_2/CAAAUC/ds-4_2-CAAAUC_x.pdb.gz
MCSYM-DB/4_2/CAAAUG/
MCSYM-DB/4_2/CAAAUG/1U9S_model_1.pdb.gz
MCSYM-DB/4_2/CAAAUG/4_2-CAAAUG.mcs
MCSYM-DB/4_2/CAAAUG/ds-4_2-CAAAUG_x.pdb.gz
MCSYM-DB/4_2/CAACAG/
MCSYM-DB/4_2/CAACAG/4_2-CAACAG.mcs
MCSYM-DB/4_2/CAACGC/
MCSYM-DB/4_2/CAACGC/4_2-CAACGC.mcs
MCSYM-DB/4_2/CAACGC/ds-4_2-CAACGC_x.pdb.gz
MCSYM-DB/4_2/CAACGG/
MCSYM-DB/4_2/CAACGG/4_2-CAACGG.mcs
MCSYM-DB/4_2/CAACGG/ds-4_2-CAACGG_x.pdb.gz
MCSYM-DB/4_2/CAAGAG/
MCSYM-DB/4_2/CAAGAG/4_2-CAAGAG.mcs
MCSYM-DB/4_2/CAAGAG/ds-4_2-CAAGAG_x.pdb.gz
MCSYM-DB/4_2/CAAGCA/
MCSYM-DB/4_2/CAAGCA/4_2-CAAGCA.mcs
MCSYM-DB/4_2/CAAGCC/
MCSYM-DB/4_2/CAAGCC/4_2-CAAGCC.mcs
MCSYM-DB/4_2/CAAGCC/ds-4_2-CAAGCC_x.pdb.gz
MCSYM-DB/4_2/CAAGCG/
MCSYM-DB/4_2/CAAGCG/1U9S_model_1.pdb.gz
MCSYM-DB/4_2/CAAGCG/4_2-CAAGCG.mcs
MCSYM-DB/4_2/CAAGCG/ds-4_2-CAAGCG_x.pdb.gz
MCSYM-DB/4_2/CAAGCU/
MCSYM-DB/4_2/CAAGCU/4_2-CAAGCU.mcs
MCSYM-DB/4_2/CAAGGC/
MCSYM-DB/4_2/CAAGGC/4_2-CAAGGC.mcs
MCSYM-DB/4_2/CAAGGC/ds-4_2-CAAGGC_x.pdb.gz
MCSYM-DB/4_2/CAAGUG/
MCSYM-DB/4_2/CAAGUG/4_2-CAAGUG.mcs
MCSYM-DB/4_2/CAAGUG/ds-4_2-CAAGUG_x.pdb.gz
MCSYM-DB/4_2/CAAUAC/
MCSYM-DB/4_2/CAAUAC/4_2-CAAUAC.mcs
MCSYM-DB/4_2/CAAUAG/
MCSYM-DB/4_2/CAAUAG/4_2-CAAUAG.mcs
MCSYM-DB/4_2/CAAUAG/ds-4_2-CAAUAG_x.pdb.gz
MCSYM-DB/4_2/CAAUAU/
MCSYM-DB/4_2/CAAUAU/4_2-CAAUAU.mcs
MCSYM-DB/4_2/CAAUCG/
MCSYM-DB/4_2/CAAUCG/4_2-CAAUCG.mcs
MCSYM-DB/4_2/CAAUCG/ds-4_2-CAAUCG_x.pdb.gz
MCSYM-DB/4_2/CAAUGA/
MCSYM-DB/4_2/CAAUGA/4_2-CAAUGA.mcs
MCSYM-DB/4_2/CAAUGC/
MCSYM-DB/4_2/CAAUGC/4_2-CAAUGC.mcs
MCSYM-DB/4_2/CAAUGC/ds-4_2-CAAUGC_x.pdb.gz
MCSYM-DB/4_2/CAAUGG/
MCSYM-DB/4_2/CAAUGG/4_2-CAAUGG.mcs
MCSYM-DB/4_2/CAAUGG/ds-4_2-CAAUGG_x.pdb.gz
MCSYM-DB/4_2/CAAUUG/
MCSYM-DB/4_2/CAAUUG/4_2-CAAUUG.mcs
MCSYM-DB/4_2/CACAAC/
MCSYM-DB/4_2/CACAAC/4_2-CACAAC.mcs
MCSYM-DB/4_2/CACAAC/ds-4_2-CACAAC_x.pdb.gz
MCSYM-DB/4_2/CACAAG/
MCSYM-DB/4_2/CACAAG/4_2-CACAAG.mcs
MCSYM-DB/4_2/CACAAG/ds-4_2-CACAAG_x.pdb.gz
MCSYM-DB/4_2/CACAUA/
MCSYM-DB/4_2/CACAUA/4_2-CACAUA.mcs
MCSYM-DB/4_2/CACAUG/
MCSYM-DB/4_2/CACAUG/4_2-CACAUG.mcs
MCSYM-DB/4_2/CACAUG/ds-4_2-CACAUG_x.pdb.gz
MCSYM-DB/4_2/CACCAG/
MCSYM-DB/4_2/CACCAG/4_2-CACCAG.mcs
MCSYM-DB/4_2/CACCAG/ds-4_2-CACCAG_x.pdb.gz
MCSYM-DB/4_2/CACCCC/
MCSYM-DB/4_2/CACCCC/4_2-CACCCC.mcs
MCSYM-DB/4_2/CACCGA/
MCSYM-DB/4_2/CACCGA/4_2-CACCGA.mcs
MCSYM-DB/4_2/CACCGC/
MCSYM-DB/4_2/CACCGC/4_2-CACCGC.mcs
MCSYM-DB/4_2/CACCGC/ds-4_2-CACCGC_x.pdb.gz
MCSYM-DB/4_2/CACCGG/
MCSYM-DB/4_2/CACCGG/4_2-CACCGG.mcs
MCSYM-DB/4_2/CACCGG/ds-4_2-CACCGG_x.pdb.gz
MCSYM-DB/4_2/CACCUG/
MCSYM-DB/4_2/CACCUG/4_2-CACCUG.mcs
MCSYM-DB/4_2/CACGCG/
MCSYM-DB/4_2/CACGCG/4_2-CACGCG.mcs
MCSYM-DB/4_2/CACGCG/ds-4_2-CACGCG_x.pdb.gz
MCSYM-DB/4_2/CACGUG/
MCSYM-DB/4_2/CACGUG/4_2-CACGUG.mcs
MCSYM-DB/4_2/CACUAA/
MCSYM-DB/4_2/CACUAA/4_2-CACUAA.mcs
MCSYM-DB/4_2/CACUAA/ds-4_2-CACUAA_x.pdb.gz
MCSYM-DB/4_2/CACUAC/
MCSYM-DB/4_2/CACUAC/4_2-CACUAC.mcs
MCSYM-DB/4_2/CACUAC/ds-4_2-CACUAC_x.pdb.gz
MCSYM-DB/4_2/CACUAG/
MCSYM-DB/4_2/CACUAG/4_2-CACUAG.mcs
MCSYM-DB/4_2/CACUAG/ds-4_2-CACUAG_x.pdb.gz
MCSYM-DB/4_2/CACUAU/
MCSYM-DB/4_2/CACUAU/4_2-CACUAU.mcs
MCSYM-DB/4_2/CACUCA/
MCSYM-DB/4_2/CACUCA/4_2-CACUCA.mcs
MCSYM-DB/4_2/CACUCC/
MCSYM-DB/4_2/CACUCC/4_2-CACUCC.mcs
MCSYM-DB/4_2/CACUCC/ds-4_2-CACUCC_x.pdb.gz
MCSYM-DB/4_2/CACUCG/
MCSYM-DB/4_2/CACUCG/4_2-CACUCG.mcs
MCSYM-DB/4_2/CACUCG/ds-4_2-CACUCG_x.pdb.gz
MCSYM-DB/4_2/CACUCU/
MCSYM-DB/4_2/CACUCU/4_2-CACUCU.mcs
MCSYM-DB/4_2/CACUCU/ds-4_2-CACUCU_x.pdb.gz
MCSYM-DB/4_2/CACUGA/
MCSYM-DB/4_2/CACUGA/4_2-CACUGA.mcs
MCSYM-DB/4_2/CACUGG/
MCSYM-DB/4_2/CACUGG/4_2-CACUGG.mcs
MCSYM-DB/4_2/CACUUC/
MCSYM-DB/4_2/CACUUC/4_2-CACUUC.mcs
MCSYM-DB/4_2/CACUUG/
MCSYM-DB/4_2/CACUUG/4_2-CACUUG.mcs
MCSYM-DB/4_2/CACUUU/
MCSYM-DB/4_2/CACUUU/4_2-CACUUU.mcs
MCSYM-DB/4_2/CAGAAG/
MCSYM-DB/4_2/CAGAAG/4_2-CAGAAG.mcs
MCSYM-DB/4_2/CAGAAG/ds-4_2-CAGAAG_x.pdb.gz
MCSYM-DB/4_2/CAGAAU/
MCSYM-DB/4_2/CAGAAU/4_2-CAGAAU.mcs
MCSYM-DB/4_2/CAGAGG/
MCSYM-DB/4_2/CAGAGG/4_2-CAGAGG.mcs
MCSYM-DB/4_2/CAGAGU/
MCSYM-DB/4_2/CAGAGU/4_2-CAGAGU.mcs
MCSYM-DB/4_2/CAGAUA/
MCSYM-DB/4_2/CAGAUA/4_2-CAGAUA.mcs
MCSYM-DB/4_2/CAGAUC/
MCSYM-DB/4_2/CAGAUC/4_2-CAGAUC.mcs
MCSYM-DB/4_2/CAGAUG/
MCSYM-DB/4_2/CAGAUG/4_2-CAGAUG.mcs
MCSYM-DB/4_2/CAGAUG/ds-4_2-CAGAUG_x.pdb.gz
MCSYM-DB/4_2/CAGCAA/
MCSYM-DB/4_2/CAGCAA/4_2-CAGCAA.mcs
MCSYM-DB/4_2/CAGCAA/ds-4_2-CAGCAA_x.pdb.gz
MCSYM-DB/4_2/CAGCAG/
MCSYM-DB/4_2/CAGCAG/4_2-CAGCAG.mcs
MCSYM-DB/4_2/CAGCCC/
MCSYM-DB/4_2/CAGCCC/4_2-CAGCCC.mcs
MCSYM-DB/4_2/CAGCCC/ds-4_2-CAGCCC_x.pdb.gz
MCSYM-DB/4_2/CAGCGA/
MCSYM-DB/4_2/CAGCGA/4_2-CAGCGA.mcs
MCSYM-DB/4_2/CAGCGA/ds-4_2-CAGCGA_x.pdb.gz
MCSYM-DB/4_2/CAGCGC/
MCSYM-DB/4_2/CAGCGC/4_2-CAGCGC.mcs
MCSYM-DB/4_2/CAGCGG/
MCSYM-DB/4_2/CAGCGG/1U9S_model_1.pdb.gz
MCSYM-DB/4_2/CAGCGG/4_2-CAGCGG.mcs
MCSYM-DB/4_2/CAGCGG/ds-4_2-CAGCGG_x.pdb.gz
MCSYM-DB/4_2/CAGCUC/
MCSYM-DB/4_2/CAGCUC/4_2-CAGCUC.mcs
MCSYM-DB/4_2/CAGCUC/ds-4_2-CAGCUC_x.pdb.gz
MCSYM-DB/4_2/CAGCUG/
MCSYM-DB/4_2/CAGCUG/4_2-CAGCUG.mcs
MCSYM-DB/4_2/CAGGAG/
MCSYM-DB/4_2/CAGGAG/4_2-CAGGAG.mcs
MCSYM-DB/4_2/CAGGAG/ds-4_2-CAGGAG_x.pdb.gz
MCSYM-DB/4_2/CAGGCA/
MCSYM-DB/4_2/CAGGCA/4_2-CAGGCA.mcs
MCSYM-DB/4_2/CAGGCC/
MCSYM-DB/4_2/CAGGCC/4_2-CAGGCC.mcs
MCSYM-DB/4_2/CAGGCC/ds-4_2-CAGGCC_x.pdb.gz
MCSYM-DB/4_2/CAGGCG/
MCSYM-DB/4_2/CAGGCG/4_2-CAGGCG.mcs
MCSYM-DB/4_2/CAGGCG/ds-4_2-CAGGCG_x.pdb.gz
MCSYM-DB/4_2/CAGGGG/
MCSYM-DB/4_2/CAGGGG/4_2-CAGGGG.mcs
MCSYM-DB/4_2/CAGGGG/ds-4_2-CAGGGG_x.pdb.gz
MCSYM-DB/4_2/CAGGUG/
MCSYM-DB/4_2/CAGGUG/4_2-CAGGUG.mcs
MCSYM-DB/4_2/CAGGUG/ds-4_2-CAGGUG_x.pdb.gz
MCSYM-DB/4_2/CAGUAC/
MCSYM-DB/4_2/CAGUAC/4_2-CAGUAC.mcs
MCSYM-DB/4_2/CAGUAG/
MCSYM-DB/4_2/CAGUAG/4_2-CAGUAG.mcs
MCSYM-DB/4_2/CAGUAG/ds-4_2-CAGUAG_x.pdb.gz
MCSYM-DB/4_2/CAGUAU/
MCSYM-DB/4_2/CAGUAU/4_2-CAGUAU.mcs
MCSYM-DB/4_2/CAGUAU/ds-4_2-CAGUAU_x.pdb.gz
MCSYM-DB/4_2/CAGUGG/
MCSYM-DB/4_2/CAGUGG/4_2-CAGUGG.mcs
MCSYM-DB/4_2/CAGUGG/ds-4_2-CAGUGG_x.pdb.gz
MCSYM-DB/4_2/CAGUGU/
MCSYM-DB/4_2/CAGUGU/4_2-CAGUGU.mcs
MCSYM-DB/4_2/CAGUGU/ds-4_2-CAGUGU_x.pdb.gz
MCSYM-DB/4_2/CAGUUG/
MCSYM-DB/4_2/CAGUUG/4_2-CAGUUG.mcs
MCSYM-DB/4_2/CAUACC/
MCSYM-DB/4_2/CAUACC/4_2-CAUACC.mcs
MCSYM-DB/4_2/CAUACC/ds-4_2-CAUACC_x.pdb.gz
MCSYM-DB/4_2/CAUACG/
MCSYM-DB/4_2/CAUACG/4_2-CAUACG.mcs
MCSYM-DB/4_2/CAUAUC/
MCSYM-DB/4_2/CAUAUC/4_2-CAUAUC.mcs
MCSYM-DB/4_2/CAUAUC/ds-4_2-CAUAUC_x.pdb.gz
MCSYM-DB/4_2/CAUAUG/
MCSYM-DB/4_2/CAUAUG/4_2-CAUAUG.mcs
MCSYM-DB/4_2/CAUAUG/ds-4_2-CAUAUG_x.pdb.gz
MCSYM-DB/4_2/CAUCAG/
MCSYM-DB/4_2/CAUCAG/4_2-CAUCAG.mcs
MCSYM-DB/4_2/CAUCCG/
MCSYM-DB/4_2/CAUCCG/4_2-CAUCCG.mcs
MCSYM-DB/4_2/CAUCCG/ds-4_2-CAUCCG_x.pdb.gz
MCSYM-DB/4_2/CAUCGC/
MCSYM-DB/4_2/CAUCGC/4_2-CAUCGC.mcs
MCSYM-DB/4_2/CAUCGC/ds-4_2-CAUCGC_x.pdb.gz
MCSYM-DB/4_2/CAUCGG/
MCSYM-DB/4_2/CAUCGG/4_2-CAUCGG.mcs
MCSYM-DB/4_2/CAUCGG/ds-4_2-CAUCGG_x.pdb.gz
MCSYM-DB/4_2/CAUCGU/
MCSYM-DB/4_2/CAUCGU/4_2-CAUCGU.mcs
MCSYM-DB/4_2/CAUCUG/
MCSYM-DB/4_2/CAUCUG/4_2-CAUCUG.mcs
MCSYM-DB/4_2/CAUGCA/
MCSYM-DB/4_2/CAUGCA/4_2-CAUGCA.mcs
MCSYM-DB/4_2/CAUGCC/
MCSYM-DB/4_2/CAUGCC/4_2-CAUGCC.mcs
MCSYM-DB/4_2/CAUGCG/
MCSYM-DB/4_2/CAUGCG/4_2-CAUGCG.mcs
MCSYM-DB/4_2/CAUGCG/ds-4_2-CAUGCG_x.pdb.gz
MCSYM-DB/4_2/CAUGGG/
MCSYM-DB/4_2/CAUGGG/4_2-CAUGGG.mcs
MCSYM-DB/4_2/CAUGGG/ds-4_2-CAUGGG_x.pdb.gz
MCSYM-DB/4_2/CAUGUA/
MCSYM-DB/4_2/CAUGUA/4_2-CAUGUA.mcs
MCSYM-DB/4_2/CAUGUG/
MCSYM-DB/4_2/CAUGUG/4_2-CAUGUG.mcs
MCSYM-DB/4_2/CAUGUG/ds-4_2-CAUGUG_x.pdb.gz
MCSYM-DB/4_2/CAUUAG/
MCSYM-DB/4_2/CAUUAG/4_2-CAUUAG.mcs
MCSYM-DB/4_2/CAUUAG/ds-4_2-CAUUAG_x.pdb.gz
MCSYM-DB/4_2/CAUUAU/
MCSYM-DB/4_2/CAUUAU/4_2-CAUUAU.mcs
MCSYM-DB/4_2/CAUUGG/
MCSYM-DB/4_2/CAUUGG/4_2-CAUUGG.mcs
MCSYM-DB/4_2/CAUUGG/ds-4_2-CAUUGG_x.pdb.gz
MCSYM-DB/4_2/CAUUGU/
MCSYM-DB/4_2/CAUUGU/4_2-CAUUGU.mcs
MCSYM-DB/4_2/CAUUUG/
MCSYM-DB/4_2/CAUUUG/4_2-CAUUUG.mcs
MCSYM-DB/4_2/CAUUUU/
MCSYM-DB/4_2/CAUUUU/4_2-CAUUUU.mcs
MCSYM-DB/4_2/CCAAAC/
MCSYM-DB/4_2/CCAAAC/4_2-CCAAAC.mcs
MCSYM-DB/4_2/CCAAAC/ds-4_2-CCAAAC_x.pdb.gz
MCSYM-DB/4_2/CCAAAG/
MCSYM-DB/4_2/CCAAAG/4_2-CCAAAG.mcs
MCSYM-DB/4_2/CCAAAG/ds-4_2-CCAAAG_x.pdb.gz
MCSYM-DB/4_2/CCAACC/
MCSYM-DB/4_2/CCAACC/4_2-CCAACC.mcs
MCSYM-DB/4_2/CCAACC/ds-4_2-CCAACC_x.pdb.gz
MCSYM-DB/4_2/CCAAGG/
MCSYM-DB/4_2/CCAAGG/4_2-CCAAGG.mcs
MCSYM-DB/4_2/CCAAUA/
MCSYM-DB/4_2/CCAAUA/4_2-CCAAUA.mcs
MCSYM-DB/4_2/CCAAUC/
MCSYM-DB/4_2/CCAAUC/4_2-CCAAUC.mcs
MCSYM-DB/4_2/CCAAUC/ds-4_2-CCAAUC_x.pdb.gz
MCSYM-DB/4_2/CCAAUG/
MCSYM-DB/4_2/CCAAUG/4_2-CCAAUG.mcs
MCSYM-DB/4_2/CCAAUG/ds-4_2-CCAAUG_x.pdb.gz
MCSYM-DB/4_2/CCACCC/
MCSYM-DB/4_2/CCACCC/4_2-CCACCC.mcs
MCSYM-DB/4_2/CCACCC/ds-4_2-CCACCC_x.pdb.gz
MCSYM-DB/4_2/CCACGA/
MCSYM-DB/4_2/CCACGA/4_2-CCACGA.mcs
MCSYM-DB/4_2/CCACGC/
MCSYM-DB/4_2/CCACGC/4_2-CCACGC.mcs
MCSYM-DB/4_2/CCACGC/ds-4_2-CCACGC_x.pdb.gz
MCSYM-DB/4_2/CCACGG/
MCSYM-DB/4_2/CCACGG/4_2-CCACGG.mcs
MCSYM-DB/4_2/CCACGG/ds-4_2-CCACGG_x.pdb.gz
MCSYM-DB/4_2/CCACUG/
MCSYM-DB/4_2/CCACUG/4_2-CCACUG.mcs
MCSYM-DB/4_2/CCACUG/ds-4_2-CCACUG_x.pdb.gz
MCSYM-DB/4_2/CCAGAG/
MCSYM-DB/4_2/CCAGAG/4_2-CCAGAG.mcs
MCSYM-DB/4_2/CCAGAG/ds-4_2-CCAGAG_x.pdb.gz
MCSYM-DB/4_2/CCAGCA/
MCSYM-DB/4_2/CCAGCA/4_2-CCAGCA.mcs
MCSYM-DB/4_2/CCAGCC/
MCSYM-DB/4_2/CCAGCC/4_2-CCAGCC.mcs
MCSYM-DB/4_2/CCAGCG/
MCSYM-DB/4_2/CCAGCG/1VQ7_model_1.pdb.gz
MCSYM-DB/4_2/CCAGCG/4_2-CCAGCG.mcs
MCSYM-DB/4_2/CCAGCG/ds-4_2-CCAGCG_x.pdb.gz
MCSYM-DB/4_2/CCAGCU/
MCSYM-DB/4_2/CCAGCU/4_2-CCAGCU.mcs
MCSYM-DB/4_2/CCAGUG/
MCSYM-DB/4_2/CCAGUG/4_2-CCAGUG.mcs
MCSYM-DB/4_2/CCAGUG/ds-4_2-CCAGUG_x.pdb.gz
MCSYM-DB/4_2/CCAUAA/
MCSYM-DB/4_2/CCAUAA/4_2-CCAUAA.mcs
MCSYM-DB/4_2/CCAUAA/ds-4_2-CCAUAA_x.pdb.gz
MCSYM-DB/4_2/CCAUAC/
MCSYM-DB/4_2/CCAUAC/4_2-CCAUAC.mcs
MCSYM-DB/4_2/CCAUAC/ds-4_2-CCAUAC_x.pdb.gz
MCSYM-DB/4_2/CCAUAG/
MCSYM-DB/4_2/CCAUAG/4_2-CCAUAG.mcs
MCSYM-DB/4_2/CCAUAG/ds-4_2-CCAUAG_x.pdb.gz
MCSYM-DB/4_2/CCAUCG/
MCSYM-DB/4_2/CCAUCG/4_2-CCAUCG.mcs
MCSYM-DB/4_2/CCAUGG/
MCSYM-DB/4_2/CCAUGG/4_2-CCAUGG.mcs
MCSYM-DB/4_2/CCAUUA/
MCSYM-DB/4_2/CCAUUA/4_2-CCAUUA.mcs
MCSYM-DB/4_2/CCAUUG/
MCSYM-DB/4_2/CCAUUG/4_2-CCAUUG.mcs
MCSYM-DB/4_2/CCAUUG/ds-4_2-CCAUUG_x.pdb.gz
MCSYM-DB/4_2/CCAUUU/
MCSYM-DB/4_2/CCAUUU/4_2-CCAUUU.mcs
MCSYM-DB/4_2/CCCAAC/
MCSYM-DB/4_2/CCCAAC/4_2-CCCAAC.mcs
MCSYM-DB/4_2/CCCAAC/ds-4_2-CCCAAC_x.pdb.gz
MCSYM-DB/4_2/CCCAAG/
MCSYM-DB/4_2/CCCAAG/4_2-CCCAAG.mcs
MCSYM-DB/4_2/CCCAAG/ds-4_2-CCCAAG_x.pdb.gz
MCSYM-DB/4_2/CCCACG/
MCSYM-DB/4_2/CCCACG/4_2-CCCACG.mcs
MCSYM-DB/4_2/CCCACG/ds-4_2-CCCACG_x.pdb.gz
MCSYM-DB/4_2/CCCAUC/
MCSYM-DB/4_2/CCCAUC/4_2-CCCAUC.mcs
MCSYM-DB/4_2/CCCAUC/ds-4_2-CCCAUC_x.pdb.gz
MCSYM-DB/4_2/CCCAUG/
MCSYM-DB/4_2/CCCAUG/4_2-CCCAUG.mcs
MCSYM-DB/4_2/CCCAUG/ds-4_2-CCCAUG_x.pdb.gz
MCSYM-DB/4_2/CCCAUU/
MCSYM-DB/4_2/CCCAUU/4_2-CCCAUU.mcs
MCSYM-DB/4_2/CCCCAG/
MCSYM-DB/4_2/CCCCAG/4_2-CCCCAG.mcs
MCSYM-DB/4_2/CCCCAG/ds-4_2-CCCCAG_x.pdb.gz
MCSYM-DB/4_2/CCCCCA/
MCSYM-DB/4_2/CCCCCA/4_2-CCCCCA.mcs
MCSYM-DB/4_2/CCCCCA/ds-4_2-CCCCCA_x.pdb.gz
MCSYM-DB/4_2/CCCCCC/
MCSYM-DB/4_2/CCCCCC/4_2-CCCCCC.mcs
MCSYM-DB/4_2/CCCCCC/ds-4_2-CCCCCC_x.pdb.gz
MCSYM-DB/4_2/CCCCCG/
MCSYM-DB/4_2/CCCCCG/4_2-CCCCCG.mcs
MCSYM-DB/4_2/CCCCCG/ds-4_2-CCCCCG_x.pdb.gz
MCSYM-DB/4_2/CCCCGG/
MCSYM-DB/4_2/CCCCGG/4_2-CCCCGG.mcs
MCSYM-DB/4_2/CCCCGG/ds-4_2-CCCCGG_x.pdb.gz
MCSYM-DB/4_2/CCCCGU/
MCSYM-DB/4_2/CCCCGU/4_2-CCCCGU.mcs
MCSYM-DB/4_2/CCCCUG/
MCSYM-DB/4_2/CCCCUG/4_2-CCCCUG.mcs
MCSYM-DB/4_2/CCCCUG/ds-4_2-CCCCUG_x.pdb.gz
MCSYM-DB/4_2/CCCGAG/
MCSYM-DB/4_2/CCCGAG/4_2-CCCGAG.mcs
MCSYM-DB/4_2/CCCGAG/ds-4_2-CCCGAG_x.pdb.gz
MCSYM-DB/4_2/CCCGCA/
MCSYM-DB/4_2/CCCGCA/4_2-CCCGCA.mcs
MCSYM-DB/4_2/CCCGCA/ds-4_2-CCCGCA_x.pdb.gz
MCSYM-DB/4_2/CCCGCC/
MCSYM-DB/4_2/CCCGCC/4_2-CCCGCC.mcs
MCSYM-DB/4_2/CCCGCC/ds-4_2-CCCGCC_x.pdb.gz
MCSYM-DB/4_2/CCCGCG/
MCSYM-DB/4_2/CCCGCG/4_2-CCCGCG.mcs
MCSYM-DB/4_2/CCCGCG/ds-4_2-CCCGCG_x.pdb.gz
MCSYM-DB/4_2/CCCGCU/
MCSYM-DB/4_2/CCCGCU/4_2-CCCGCU.mcs
MCSYM-DB/4_2/CCCGUA/
MCSYM-DB/4_2/CCCGUA/4_2-CCCGUA.mcs
MCSYM-DB/4_2/CCCGUA/ds-4_2-CCCGUA_x.pdb.gz
MCSYM-DB/4_2/CCCGUG/
MCSYM-DB/4_2/CCCGUG/4_2-CCCGUG.mcs
MCSYM-DB/4_2/CCCGUG/ds-4_2-CCCGUG_x.pdb.gz
MCSYM-DB/4_2/CCCUAA/
MCSYM-DB/4_2/CCCUAA/4_2-CCCUAA.mcs
MCSYM-DB/4_2/CCCUAA/ds-4_2-CCCUAA_x.pdb.gz
MCSYM-DB/4_2/CCCUAC/
MCSYM-DB/4_2/CCCUAC/4_2-CCCUAC.mcs
MCSYM-DB/4_2/CCCUAC/ds-4_2-CCCUAC_x.pdb.gz
MCSYM-DB/4_2/CCCUAG/
MCSYM-DB/4_2/CCCUAG/4_2-CCCUAG.mcs
MCSYM-DB/4_2/CCCUAG/ds-4_2-CCCUAG_x.pdb.gz
MCSYM-DB/4_2/CCCUAU/
MCSYM-DB/4_2/CCCUAU/4_2-CCCUAU.mcs
MCSYM-DB/4_2/CCCUGG/
MCSYM-DB/4_2/CCCUGG/4_2-CCCUGG.mcs
MCSYM-DB/4_2/CCCUGU/
MCSYM-DB/4_2/CCCUGU/4_2-CCCUGU.mcs
MCSYM-DB/4_2/CCCUUA/
MCSYM-DB/4_2/CCCUUA/4_2-CCCUUA.mcs
MCSYM-DB/4_2/CCCUUC/
MCSYM-DB/4_2/CCCUUC/4_2-CCCUUC.mcs
MCSYM-DB/4_2/CCCUUC/ds-4_2-CCCUUC_x.pdb.gz
MCSYM-DB/4_2/CCCUUG/
MCSYM-DB/4_2/CCCUUG/4_2-CCCUUG.mcs
MCSYM-DB/4_2/CCCUUG/ds-4_2-CCCUUG_x.pdb.gz
MCSYM-DB/4_2/CCGAAG/
MCSYM-DB/4_2/CCGAAG/4_2-CCGAAG.mcs
MCSYM-DB/4_2/CCGAAG/ds-4_2-CCGAAG_x.pdb.gz
MCSYM-DB/4_2/CCGAGC/
MCSYM-DB/4_2/CCGAGC/4_2-CCGAGC.mcs
MCSYM-DB/4_2/CCGAGC/ds-4_2-CCGAGC_x.pdb.gz
MCSYM-DB/4_2/CCGAUG/
MCSYM-DB/4_2/CCGAUG/4_2-CCGAUG.mcs
MCSYM-DB/4_2/CCGAUG/ds-4_2-CCGAUG_x.pdb.gz
MCSYM-DB/4_2/CCGCAG/
MCSYM-DB/4_2/CCGCAG/4_2-CCGCAG.mcs
MCSYM-DB/4_2/CCGCAG/ds-4_2-CCGCAG_x.pdb.gz
MCSYM-DB/4_2/CCGCCC/
MCSYM-DB/4_2/CCGCCC/4_2-CCGCCC.mcs
MCSYM-DB/4_2/CCGCCC/ds-4_2-CCGCCC_x.pdb.gz
MCSYM-DB/4_2/CCGCGG/
MCSYM-DB/4_2/CCGCGG/4_2-CCGCGG.mcs
MCSYM-DB/4_2/CCGCUU/
MCSYM-DB/4_2/CCGCUU/4_2-CCGCUU.mcs
MCSYM-DB/4_2/CCGCUU/ds-4_2-CCGCUU_x.pdb.gz
MCSYM-DB/4_2/CCGGAG/
MCSYM-DB/4_2/CCGGAG/4_2-CCGGAG.mcs
MCSYM-DB/4_2/CCGGAG/ds-4_2-CCGGAG_x.pdb.gz
MCSYM-DB/4_2/CCGGCA/
MCSYM-DB/4_2/CCGGCA/4_2-CCGGCA.mcs
MCSYM-DB/4_2/CCGGCA/ds-4_2-CCGGCA_x.pdb.gz
MCSYM-DB/4_2/CCGGCG/
MCSYM-DB/4_2/CCGGCG/4_2-CCGGCG.mcs
MCSYM-DB/4_2/CCGGCG/ds-4_2-CCGGCG_x.pdb.gz
MCSYM-DB/4_2/CCGGUG/
MCSYM-DB/4_2/CCGGUG/4_2-CCGGUG.mcs
MCSYM-DB/4_2/CCGGUG/ds-4_2-CCGGUG_x.pdb.gz
MCSYM-DB/4_2/CCGUAA/
MCSYM-DB/4_2/CCGUAA/4_2-CCGUAA.mcs
MCSYM-DB/4_2/CCGUAA/ds-4_2-CCGUAA_x.pdb.gz
MCSYM-DB/4_2/CCGUAG/
MCSYM-DB/4_2/CCGUAG/4_2-CCGUAG.mcs
MCSYM-DB/4_2/CCGUAG/ds-4_2-CCGUAG_x.pdb.gz
MCSYM-DB/4_2/CCGUUG/
MCSYM-DB/4_2/CCGUUG/4_2-CCGUUG.mcs
MCSYM-DB/4_2/CCGUUG/ds-4_2-CCGUUG_x.pdb.gz
MCSYM-DB/4_2/CCUACG/
MCSYM-DB/4_2/CCUACG/4_2-CCUACG.mcs
MCSYM-DB/4_2/CCUACG/ds-4_2-CCUACG_x.pdb.gz
MCSYM-DB/4_2/CCUAUA/
MCSYM-DB/4_2/CCUAUA/4_2-CCUAUA.mcs
MCSYM-DB/4_2/CCUAUC/
MCSYM-DB/4_2/CCUAUC/4_2-CCUAUC.mcs
MCSYM-DB/4_2/CCUAUC/ds-4_2-CCUAUC_x.pdb.gz
MCSYM-DB/4_2/CCUAUG/
MCSYM-DB/4_2/CCUAUG/4_2-CCUAUG.mcs
MCSYM-DB/4_2/CCUAUG/ds-4_2-CCUAUG_x.pdb.gz
MCSYM-DB/4_2/CCUCAU/
MCSYM-DB/4_2/CCUCAU/4_2-CCUCAU.mcs
MCSYM-DB/4_2/CCUCCC/
MCSYM-DB/4_2/CCUCCC/4_2-CCUCCC.mcs
MCSYM-DB/4_2/CCUCCC/ds-4_2-CCUCCC_x.pdb.gz
MCSYM-DB/4_2/CCUCCG/
MCSYM-DB/4_2/CCUCCG/4_2-CCUCCG.mcs
MCSYM-DB/4_2/CCUCCG/ds-4_2-CCUCCG_x.pdb.gz
MCSYM-DB/4_2/CCUCCU/
MCSYM-DB/4_2/CCUCCU/4_2-CCUCCU.mcs
MCSYM-DB/4_2/CCUCCU/ds-4_2-CCUCCU_x.pdb.gz
MCSYM-DB/4_2/CCUCGA/
MCSYM-DB/4_2/CCUCGA/4_2-CCUCGA.mcs
MCSYM-DB/4_2/CCUCGA/ds-4_2-CCUCGA_x.pdb.gz
MCSYM-DB/4_2/CCUCGG/
MCSYM-DB/4_2/CCUCGG/4_2-CCUCGG.mcs
MCSYM-DB/4_2/CCUCGG/ds-4_2-CCUCGG_x.pdb.gz
MCSYM-DB/4_2/CCUCGU/
MCSYM-DB/4_2/CCUCGU/4_2-CCUCGU.mcs
MCSYM-DB/4_2/CCUCUG/
MCSYM-DB/4_2/CCUCUG/4_2-CCUCUG.mcs
MCSYM-DB/4_2/CCUCUG/ds-4_2-CCUCUG_x.pdb.gz
MCSYM-DB/4_2/CCUCUU/
MCSYM-DB/4_2/CCUCUU/4_2-CCUCUU.mcs
MCSYM-DB/4_2/CCUGAC/
MCSYM-DB/4_2/CCUGAC/4_2-CCUGAC.mcs
MCSYM-DB/4_2/CCUGAC/ds-4_2-CCUGAC_x.pdb.gz
MCSYM-DB/4_2/CCUGCA/
MCSYM-DB/4_2/CCUGCA/4_2-CCUGCA.mcs
MCSYM-DB/4_2/CCUGCC/
MCSYM-DB/4_2/CCUGCC/4_2-CCUGCC.mcs
MCSYM-DB/4_2/CCUGCC/ds-4_2-CCUGCC_x.pdb.gz
MCSYM-DB/4_2/CCUGCG/
MCSYM-DB/4_2/CCUGCG/4_2-CCUGCG.mcs
MCSYM-DB/4_2/CCUGCG/ds-4_2-CCUGCG_x.pdb.gz
MCSYM-DB/4_2/CCUGCU/
MCSYM-DB/4_2/CCUGCU/4_2-CCUGCU.mcs
MCSYM-DB/4_2/CCUGGC/
MCSYM-DB/4_2/CCUGGC/4_2-CCUGGC.mcs
MCSYM-DB/4_2/CCUGGG/
MCSYM-DB/4_2/CCUGGG/4_2-CCUGGG.mcs
MCSYM-DB/4_2/CCUGUA/
MCSYM-DB/4_2/CCUGUA/4_2-CCUGUA.mcs
MCSYM-DB/4_2/CCUGUG/
MCSYM-DB/4_2/CCUGUG/4_2-CCUGUG.mcs
MCSYM-DB/4_2/CCUGUG/ds-4_2-CCUGUG_x.pdb.gz
MCSYM-DB/4_2/CCUGUU/
MCSYM-DB/4_2/CCUGUU/4_2-CCUGUU.mcs
MCSYM-DB/4_2/CCUUAA/
MCSYM-DB/4_2/CCUUAA/4_2-CCUUAA.mcs
MCSYM-DB/4_2/CCUUAC/
MCSYM-DB/4_2/CCUUAC/4_2-CCUUAC.mcs
MCSYM-DB/4_2/CCUUAC/ds-4_2-CCUUAC_x.pdb.gz
MCSYM-DB/4_2/CCUUAG/
MCSYM-DB/4_2/CCUUAG/4_2-CCUUAG.mcs
MCSYM-DB/4_2/CCUUAG/ds-4_2-CCUUAG_x.pdb.gz
MCSYM-DB/4_2/CCUUCG/
MCSYM-DB/4_2/CCUUCG/4_2-CCUUCG.mcs
MCSYM-DB/4_2/CCUUCU/
MCSYM-DB/4_2/CCUUCU/4_2-CCUUCU.mcs
MCSYM-DB/4_2/CCUUGA/
MCSYM-DB/4_2/CCUUGA/4_2-CCUUGA.mcs
MCSYM-DB/4_2/CCUUGG/
MCSYM-DB/4_2/CCUUGG/4_2-CCUUGG.mcs
MCSYM-DB/4_2/CCUUUC/
MCSYM-DB/4_2/CCUUUC/4_2-CCUUUC.mcs
MCSYM-DB/4_2/CCUUUC/ds-4_2-CCUUUC_x.pdb.gz
MCSYM-DB/4_2/CCUUUG/
MCSYM-DB/4_2/CCUUUG/4_2-CCUUUG.mcs
MCSYM-DB/4_2/CCUUUG/ds-4_2-CCUUUG_x.pdb.gz
MCSYM-DB/4_2/CCUUUU/
MCSYM-DB/4_2/CCUUUU/4_2-CCUUUU.mcs
MCSYM-DB/4_2/CGAAAG/
MCSYM-DB/4_2/CGAAAG/4_2-CGAAAG.mcs
MCSYM-DB/4_2/CGAAAG/ds-4_2-CGAAAG_x.pdb.gz
MCSYM-DB/4_2/CGAAUG/
MCSYM-DB/4_2/CGAAUG/4_2-CGAAUG.mcs
MCSYM-DB/4_2/CGAAUG/ds-4_2-CGAAUG_x.pdb.gz
MCSYM-DB/4_2/CGACCC/
MCSYM-DB/4_2/CGACCC/4_2-CGACCC.mcs
MCSYM-DB/4_2/CGACCC/ds-4_2-CGACCC_x.pdb.gz
MCSYM-DB/4_2/CGACGG/
MCSYM-DB/4_2/CGACGG/1EXY_model_1.pdb.gz
MCSYM-DB/4_2/CGACGG/4_2-CGACGG.mcs
MCSYM-DB/4_2/CGACGG/ds-4_2-CGACGG.pdb.gz
MCSYM-DB/4_2/CGACGG/ds-4_2-CGACGG_x.pdb.gz
MCSYM-DB/4_2/CGACUG/
MCSYM-DB/4_2/CGACUG/4_2-CGACUG.mcs
MCSYM-DB/4_2/CGAGCA/
MCSYM-DB/4_2/CGAGCA/4_2-CGAGCA.mcs
MCSYM-DB/4_2/CGAGCG/
MCSYM-DB/4_2/CGAGCG/4_2-CGAGCG.mcs
MCSYM-DB/4_2/CGAGCG/ds-4_2-CGAGCG_x.pdb.gz
MCSYM-DB/4_2/CGAGCU/
MCSYM-DB/4_2/CGAGCU/4_2-CGAGCU.mcs
MCSYM-DB/4_2/CGAGGA/
MCSYM-DB/4_2/CGAGGA/4_2-CGAGGA.mcs
MCSYM-DB/4_2/CGAGGA/ds-4_2-CGAGGA_x.pdb.gz
MCSYM-DB/4_2/CGAGGG/
MCSYM-DB/4_2/CGAGGG/4_2-CGAGGG.mcs
MCSYM-DB/4_2/CGAGGG/ds-4_2-CGAGGG_x.pdb.gz
MCSYM-DB/4_2/CGAGUA/
MCSYM-DB/4_2/CGAGUA/4_2-CGAGUA.mcs
MCSYM-DB/4_2/CGAGUG/
MCSYM-DB/4_2/CGAGUG/4_2-CGAGUG.mcs
MCSYM-DB/4_2/CGAGUG/ds-4_2-CGAGUG_x.pdb.gz
MCSYM-DB/4_2/CGAUAG/
MCSYM-DB/4_2/CGAUAG/4_2-CGAUAG.mcs
MCSYM-DB/4_2/CGAUAG/ds-4_2-CGAUAG_x.pdb.gz
MCSYM-DB/4_2/CGAUGG/
MCSYM-DB/4_2/CGAUGG/4_2-CGAUGG.mcs
MCSYM-DB/4_2/CGAUGG/ds-4_2-CGAUGG_x.pdb.gz
MCSYM-DB/4_2/CGCAGG/
MCSYM-DB/4_2/CGCAGG/4_2-CGCAGG.mcs
MCSYM-DB/4_2/CGCAUG/
MCSYM-DB/4_2/CGCAUG/4_2-CGCAUG.mcs
MCSYM-DB/4_2/CGCAUG/ds-4_2-CGCAUG_x.pdb.gz
MCSYM-DB/4_2/CGCCCG/
MCSYM-DB/4_2/CGCCCG/4_2-CGCCCG.mcs
MCSYM-DB/4_2/CGCCGA/
MCSYM-DB/4_2/CGCCGA/4_2-CGCCGA.mcs
MCSYM-DB/4_2/CGCCGA/ds-4_2-CGCCGA_x.pdb.gz
MCSYM-DB/4_2/CGCCGC/
MCSYM-DB/4_2/CGCCGC/4_2-CGCCGC.mcs
MCSYM-DB/4_2/CGCCGG/
MCSYM-DB/4_2/CGCCGG/4_2-CGCCGG.mcs
MCSYM-DB/4_2/CGCCGG/ds-4_2-CGCCGG_x.pdb.gz
MCSYM-DB/4_2/CGCGCC/
MCSYM-DB/4_2/CGCGCC/4_2-CGCGCC.mcs
MCSYM-DB/4_2/CGCGCC/ds-4_2-CGCGCC_x.pdb.gz
MCSYM-DB/4_2/CGCGCG/
MCSYM-DB/4_2/CGCGCG/4_2-CGCGCG.mcs
MCSYM-DB/4_2/CGCGCG/ds-4_2-CGCGCG_x.pdb.gz
MCSYM-DB/4_2/CGCGGG/
MCSYM-DB/4_2/CGCGGG/4_2-CGCGGG.mcs
MCSYM-DB/4_2/CGCGGG/ds-4_2-CGCGGG_x.pdb.gz
MCSYM-DB/4_2/CGCGUA/
MCSYM-DB/4_2/CGCGUA/4_2-CGCGUA.mcs
MCSYM-DB/4_2/CGCGUA/ds-4_2-CGCGUA_x.pdb.gz
MCSYM-DB/4_2/CGCGUG/
MCSYM-DB/4_2/CGCGUG/4_2-CGCGUG.mcs
MCSYM-DB/4_2/CGCGUG/ds-4_2-CGCGUG_x.pdb.gz
MCSYM-DB/4_2/CGCUAG/
MCSYM-DB/4_2/CGCUAG/4_2-CGCUAG.mcs
MCSYM-DB/4_2/CGCUCG/
MCSYM-DB/4_2/CGCUCG/4_2-CGCUCG.mcs
MCSYM-DB/4_2/CGCUUG/
MCSYM-DB/4_2/CGCUUG/4_2-CGCUUG.mcs
MCSYM-DB/4_2/CGGAGG/
MCSYM-DB/4_2/CGGAGG/4_2-CGGAGG.mcs
MCSYM-DB/4_2/CGGAGG/ds-4_2-CGGAGG_x.pdb.gz
MCSYM-DB/4_2/CGGAUG/
MCSYM-DB/4_2/CGGAUG/4_2-CGGAUG.mcs
MCSYM-DB/4_2/CGGAUG/ds-4_2-CGGAUG_x.pdb.gz
MCSYM-DB/4_2/CGGCCC/
MCSYM-DB/4_2/CGGCCC/4_2-CGGCCC.mcs
MCSYM-DB/4_2/CGGCCC/ds-4_2-CGGCCC_x.pdb.gz
MCSYM-DB/4_2/CGGCGG/
MCSYM-DB/4_2/CGGCGG/4_2-CGGCGG.mcs
MCSYM-DB/4_2/CGGCGG/ds-4_2-CGGCGG_x.pdb.gz
MCSYM-DB/4_2/CGGGAG/
MCSYM-DB/4_2/CGGGAG/4_2-CGGGAG.mcs
MCSYM-DB/4_2/CGGGCC/
MCSYM-DB/4_2/CGGGCC/4_2-CGGGCC.mcs
MCSYM-DB/4_2/CGGGCC/ds-4_2-CGGGCC_x.pdb.gz
MCSYM-DB/4_2/CGGGCG/
MCSYM-DB/4_2/CGGGCG/4_2-CGGGCG.mcs
MCSYM-DB/4_2/CGGGCG/ds-4_2-CGGGCG_x.pdb.gz
MCSYM-DB/4_2/CGGGGG/
MCSYM-DB/4_2/CGGGGG/4_2-CGGGGG.mcs
MCSYM-DB/4_2/CGGGGG/ds-4_2-CGGGGG_x.pdb.gz
MCSYM-DB/4_2/CGGGUG/
MCSYM-DB/4_2/CGGGUG/4_2-CGGGUG.mcs
MCSYM-DB/4_2/CGGGUG/ds-4_2-CGGGUG_x.pdb.gz
MCSYM-DB/4_2/CGGGUU/
MCSYM-DB/4_2/CGGGUU/4_2-CGGGUU.mcs
MCSYM-DB/4_2/CGGGUU/ds-4_2-CGGGUU_x.pdb.gz
MCSYM-DB/4_2/CGGUAG/
MCSYM-DB/4_2/CGGUAG/4_2-CGGUAG.mcs
MCSYM-DB/4_2/CGGUAG/ds-4_2-CGGUAG_x.pdb.gz
MCSYM-DB/4_2/CGGUGG/
MCSYM-DB/4_2/CGGUGG/4_2-CGGUGG.mcs
MCSYM-DB/4_2/CGGUGG/ds-4_2-CGGUGG_x.pdb.gz
MCSYM-DB/4_2/CGUAUG/
MCSYM-DB/4_2/CGUAUG/4_2-CGUAUG.mcs
MCSYM-DB/4_2/CGUAUG/ds-4_2-CGUAUG_x.pdb.gz
MCSYM-DB/4_2/CGUCGG/
MCSYM-DB/4_2/CGUCGG/4_2-CGUCGG.mcs
MCSYM-DB/4_2/CGUCGG/ds-4_2-CGUCGG_x.pdb.gz
MCSYM-DB/4_2/CGUGAG/
MCSYM-DB/4_2/CGUGAG/4_2-CGUGAG.mcs
MCSYM-DB/4_2/CGUGCG/
MCSYM-DB/4_2/CGUGCG/4_2-CGUGCG.mcs
MCSYM-DB/4_2/CGUGCG/ds-4_2-CGUGCG_x.pdb.gz
MCSYM-DB/4_2/CGUGGG/
MCSYM-DB/4_2/CGUGGG/4_2-CGUGGG.mcs
MCSYM-DB/4_2/CGUGUG/
MCSYM-DB/4_2/CGUGUG/4_2-CGUGUG.mcs
MCSYM-DB/4_2/CGUGUG/ds-4_2-CGUGUG_x.pdb.gz
MCSYM-DB/4_2/CGUUAG/
MCSYM-DB/4_2/CGUUAG/4_2-CGUUAG.mcs
MCSYM-DB/4_2/CGUUAG/ds-4_2-CGUUAG_x.pdb.gz
MCSYM-DB/4_2/CGUUCG/
MCSYM-DB/4_2/CGUUCG/4_2-CGUUCG.mcs
MCSYM-DB/4_2/CGUUGG/
MCSYM-DB/4_2/CGUUGG/4_2-CGUUGG.mcs
MCSYM-DB/4_2/CGUUGG/ds-4_2-CGUUGG_x.pdb.gz
MCSYM-DB/4_2/CGUUUG/
MCSYM-DB/4_2/CGUUUG/4_2-CGUUUG.mcs
MCSYM-DB/4_2/CUAAAG/
MCSYM-DB/4_2/CUAAAG/4_2-CUAAAG.mcs
MCSYM-DB/4_2/CUAACG/
MCSYM-DB/4_2/CUAACG/4_2-CUAACG.mcs
MCSYM-DB/4_2/CUAACG/ds-4_2-CUAACG_x.pdb.gz
MCSYM-DB/4_2/CUAAGG/
MCSYM-DB/4_2/CUAAGG/4_2-CUAAGG.mcs
MCSYM-DB/4_2/CUAAUC/
MCSYM-DB/4_2/CUAAUC/4_2-CUAAUC.mcs
MCSYM-DB/4_2/CUAAUC/ds-4_2-CUAAUC_x.pdb.gz
MCSYM-DB/4_2/CUAAUG/
MCSYM-DB/4_2/CUAAUG/4_2-CUAAUG.mcs
MCSYM-DB/4_2/CUAAUG/ds-4_2-CUAAUG_x.pdb.gz
MCSYM-DB/4_2/CUACCA/
MCSYM-DB/4_2/CUACCA/4_2-CUACCA.mcs
MCSYM-DB/4_2/CUACCA/ds-4_2-CUACCA_x.pdb.gz
MCSYM-DB/4_2/CUACGG/
MCSYM-DB/4_2/CUACGG/4_2-CUACGG.mcs
MCSYM-DB/4_2/CUACGG/ds-4_2-CUACGG_x.pdb.gz
MCSYM-DB/4_2/CUACGU/
MCSYM-DB/4_2/CUACGU/4_2-CUACGU.mcs
MCSYM-DB/4_2/CUACGU/ds-4_2-CUACGU_x.pdb.gz
MCSYM-DB/4_2/CUACUU/
MCSYM-DB/4_2/CUACUU/4_2-CUACUU.mcs
MCSYM-DB/4_2/CUAGCA/
MCSYM-DB/4_2/CUAGCA/4_2-CUAGCA.mcs
MCSYM-DB/4_2/CUAGCC/
MCSYM-DB/4_2/CUAGCC/4_2-CUAGCC.mcs
MCSYM-DB/4_2/CUAGCC/ds-4_2-CUAGCC_x.pdb.gz
MCSYM-DB/4_2/CUAGCG/
MCSYM-DB/4_2/CUAGCG/1TXS_model_1.pdb.gz
MCSYM-DB/4_2/CUAGCG/4_2-CUAGCG.mcs
MCSYM-DB/4_2/CUAGCG/ds-4_2-CUAGCG_x.pdb.gz
MCSYM-DB/4_2/CUAGCU/
MCSYM-DB/4_2/CUAGCU/4_2-CUAGCU.mcs
MCSYM-DB/4_2/CUAGUG/
MCSYM-DB/4_2/CUAGUG/4_2-CUAGUG.mcs
MCSYM-DB/4_2/CUAGUG/ds-4_2-CUAGUG_x.pdb.gz
MCSYM-DB/4_2/CUAGUU/
MCSYM-DB/4_2/CUAGUU/4_2-CUAGUU.mcs
MCSYM-DB/4_2/CUAUAG/
MCSYM-DB/4_2/CUAUAG/4_2-CUAUAG.mcs
MCSYM-DB/4_2/CUAUAG/ds-4_2-CUAUAG_x.pdb.gz
MCSYM-DB/4_2/CUAUAU/
MCSYM-DB/4_2/CUAUAU/4_2-CUAUAU.mcs
MCSYM-DB/4_2/CUAUGG/
MCSYM-DB/4_2/CUAUGG/4_2-CUAUGG.mcs
MCSYM-DB/4_2/CUAUGU/
MCSYM-DB/4_2/CUAUGU/4_2-CUAUGU.mcs
MCSYM-DB/4_2/CUAUUG/
MCSYM-DB/4_2/CUAUUG/4_2-CUAUUG.mcs
MCSYM-DB/4_2/CUAUUG/ds-4_2-CUAUUG_x.pdb.gz
MCSYM-DB/4_2/CUCAAA/
MCSYM-DB/4_2/CUCAAA/4_2-CUCAAA.mcs
MCSYM-DB/4_2/CUCAAU/
MCSYM-DB/4_2/CUCAAU/4_2-CUCAAU.mcs
MCSYM-DB/4_2/CUCACG/
MCSYM-DB/4_2/CUCACG/4_2-CUCACG.mcs
MCSYM-DB/4_2/CUCACG/ds-4_2-CUCACG_x.pdb.gz
MCSYM-DB/4_2/CUCAGG/
MCSYM-DB/4_2/CUCAGG/4_2-CUCAGG.mcs
MCSYM-DB/4_2/CUCAGG/ds-4_2-CUCAGG_x.pdb.gz
MCSYM-DB/4_2/CUCAUA/
MCSYM-DB/4_2/CUCAUA/4_2-CUCAUA.mcs
MCSYM-DB/4_2/CUCAUC/
MCSYM-DB/4_2/CUCAUC/4_2-CUCAUC.mcs
MCSYM-DB/4_2/CUCAUG/
MCSYM-DB/4_2/CUCAUG/4_2-CUCAUG.mcs
MCSYM-DB/4_2/CUCAUG/ds-4_2-CUCAUG_x.pdb.gz
MCSYM-DB/4_2/CUCCCG/
MCSYM-DB/4_2/CUCCCG/4_2-CUCCCG.mcs
MCSYM-DB/4_2/CUCCCG/ds-4_2-CUCCCG_x.pdb.gz
MCSYM-DB/4_2/CUCCGA/
MCSYM-DB/4_2/CUCCGA/4_2-CUCCGA.mcs
MCSYM-DB/4_2/CUCCGA/ds-4_2-CUCCGA_x.pdb.gz
MCSYM-DB/4_2/CUCCGC/
MCSYM-DB/4_2/CUCCGC/4_2-CUCCGC.mcs
MCSYM-DB/4_2/CUCCGC/ds-4_2-CUCCGC_x.pdb.gz
MCSYM-DB/4_2/CUCCGG/
MCSYM-DB/4_2/CUCCGG/4_2-CUCCGG.mcs
MCSYM-DB/4_2/CUCCGG/ds-4_2-CUCCGG_x.pdb.gz
MCSYM-DB/4_2/CUCCGU/
MCSYM-DB/4_2/CUCCGU/4_2-CUCCGU.mcs
MCSYM-DB/4_2/CUCCUA/
MCSYM-DB/4_2/CUCCUA/4_2-CUCCUA.mcs
MCSYM-DB/4_2/CUCCUU/
MCSYM-DB/4_2/CUCCUU/4_2-CUCCUU.mcs
MCSYM-DB/4_2/CUCGAG/
MCSYM-DB/4_2/CUCGAG/4_2-CUCGAG.mcs
MCSYM-DB/4_2/CUCGCA/
MCSYM-DB/4_2/CUCGCA/4_2-CUCGCA.mcs
MCSYM-DB/4_2/CUCGCA/ds-4_2-CUCGCA_x.pdb.gz
MCSYM-DB/4_2/CUCGCC/
MCSYM-DB/4_2/CUCGCC/4_2-CUCGCC.mcs
MCSYM-DB/4_2/CUCGCC/ds-4_2-CUCGCC_x.pdb.gz
MCSYM-DB/4_2/CUCGCG/
MCSYM-DB/4_2/CUCGCG/4_2-CUCGCG.mcs
MCSYM-DB/4_2/CUCGCG/ds-4_2-CUCGCG_x.pdb.gz
MCSYM-DB/4_2/CUCGCU/
MCSYM-DB/4_2/CUCGCU/4_2-CUCGCU.mcs
MCSYM-DB/4_2/CUCGCU/ds-4_2-CUCGCU_x.pdb.gz
MCSYM-DB/4_2/CUCGUG/
MCSYM-DB/4_2/CUCGUG/4_2-CUCGUG.mcs
MCSYM-DB/4_2/CUCGUG/ds-4_2-CUCGUG_x.pdb.gz
MCSYM-DB/4_2/CUCUAA/
MCSYM-DB/4_2/CUCUAA/4_2-CUCUAA.mcs
MCSYM-DB/4_2/CUCUAG/
MCSYM-DB/4_2/CUCUAG/4_2-CUCUAG.mcs
MCSYM-DB/4_2/CUCUAU/
MCSYM-DB/4_2/CUCUAU/4_2-CUCUAU.mcs
MCSYM-DB/4_2/CUCUAU/ds-4_2-CUCUAU_x.pdb.gz
MCSYM-DB/4_2/CUCUCA/
MCSYM-DB/4_2/CUCUCA/4_2-CUCUCA.mcs
MCSYM-DB/4_2/CUCUCC/
MCSYM-DB/4_2/CUCUCC/4_2-CUCUCC.mcs
MCSYM-DB/4_2/CUCUCC/ds-4_2-CUCUCC_x.pdb.gz
MCSYM-DB/4_2/CUCUCG/
MCSYM-DB/4_2/CUCUCG/4_2-CUCUCG.mcs
MCSYM-DB/4_2/CUCUGC/
MCSYM-DB/4_2/CUCUGC/4_2-CUCUGC.mcs
MCSYM-DB/4_2/CUCUGG/
MCSYM-DB/4_2/CUCUGG/4_2-CUCUGG.mcs
MCSYM-DB/4_2/CUCUGU/
MCSYM-DB/4_2/CUCUGU/4_2-CUCUGU.mcs
MCSYM-DB/4_2/CUCUUC/
MCSYM-DB/4_2/CUCUUC/4_2-CUCUUC.mcs
MCSYM-DB/4_2/CUCUUC/ds-4_2-CUCUUC_x.pdb.gz
MCSYM-DB/4_2/CUCUUG/
MCSYM-DB/4_2/CUCUUG/4_2-CUCUUG.mcs
MCSYM-DB/4_2/CUCUUG/ds-4_2-CUCUUG_x.pdb.gz
MCSYM-DB/4_2/CUGAAA/
MCSYM-DB/4_2/CUGAAA/4_2-CUGAAA.mcs
MCSYM-DB/4_2/CUGAAG/
MCSYM-DB/4_2/CUGAAG/4_2-CUGAAG.mcs
MCSYM-DB/4_2/CUGACG/
MCSYM-DB/4_2/CUGACG/4_2-CUGACG.mcs
MCSYM-DB/4_2/CUGACG/ds-4_2-CUGACG_x.pdb.gz
MCSYM-DB/4_2/CUGAGG/
MCSYM-DB/4_2/CUGAGG/4_2-CUGAGG.mcs
MCSYM-DB/4_2/CUGAUA/
MCSYM-DB/4_2/CUGAUA/4_2-CUGAUA.mcs
MCSYM-DB/4_2/CUGAUC/
MCSYM-DB/4_2/CUGAUC/4_2-CUGAUC.mcs
MCSYM-DB/4_2/CUGAUC/ds-4_2-CUGAUC_x.pdb.gz
MCSYM-DB/4_2/CUGAUG/
MCSYM-DB/4_2/CUGAUG/4_2-CUGAUG.mcs
MCSYM-DB/4_2/CUGAUG/ds-4_2-CUGAUG_x.pdb.gz
MCSYM-DB/4_2/CUGAUU/
MCSYM-DB/4_2/CUGAUU/4_2-CUGAUU.mcs
MCSYM-DB/4_2/CUGCAG/
MCSYM-DB/4_2/CUGCAG/4_2-CUGCAG.mcs
MCSYM-DB/4_2/CUGCCA/
MCSYM-DB/4_2/CUGCCA/4_2-CUGCCA.mcs
MCSYM-DB/4_2/CUGCCC/
MCSYM-DB/4_2/CUGCCC/4_2-CUGCCC.mcs
MCSYM-DB/4_2/CUGCCC/ds-4_2-CUGCCC_x.pdb.gz
MCSYM-DB/4_2/CUGCGG/
MCSYM-DB/4_2/CUGCGG/4_2-CUGCGG.mcs
MCSYM-DB/4_2/CUGCGG/ds-4_2-CUGCGG_x.pdb.gz
MCSYM-DB/4_2/CUGCGU/
MCSYM-DB/4_2/CUGCGU/4_2-CUGCGU.mcs
MCSYM-DB/4_2/CUGCUG/
MCSYM-DB/4_2/CUGCUG/4_2-CUGCUG.mcs
MCSYM-DB/4_2/CUGCUU/
MCSYM-DB/4_2/CUGCUU/4_2-CUGCUU.mcs
MCSYM-DB/4_2/CUGGAG/
MCSYM-DB/4_2/CUGGAG/4_2-CUGGAG.mcs
MCSYM-DB/4_2/CUGGCA/
MCSYM-DB/4_2/CUGGCA/4_2-CUGGCA.mcs
MCSYM-DB/4_2/CUGGCG/
MCSYM-DB/4_2/CUGGCG/4_2-CUGGCG.mcs
MCSYM-DB/4_2/CUGGCG/ds-4_2-CUGGCG_x.pdb.gz
MCSYM-DB/4_2/CUGGCU/
MCSYM-DB/4_2/CUGGCU/4_2-CUGGCU.mcs
MCSYM-DB/4_2/CUGGCU/ds-4_2-CUGGCU_x.pdb.gz
MCSYM-DB/4_2/CUGGGC/
MCSYM-DB/4_2/CUGGGC/4_2-CUGGGC.mcs
MCSYM-DB/4_2/CUGGGC/ds-4_2-CUGGGC_x.pdb.gz
MCSYM-DB/4_2/CUGGGG/
MCSYM-DB/4_2/CUGGGG/4_2-CUGGGG.mcs
MCSYM-DB/4_2/CUGGUA/
MCSYM-DB/4_2/CUGGUA/4_2-CUGGUA.mcs
MCSYM-DB/4_2/CUGGUA/ds-4_2-CUGGUA_x.pdb.gz
MCSYM-DB/4_2/CUGGUG/
MCSYM-DB/4_2/CUGGUG/4_2-CUGGUG.mcs
MCSYM-DB/4_2/CUGGUG/ds-4_2-CUGGUG_x.pdb.gz
MCSYM-DB/4_2/CUGGUU/
MCSYM-DB/4_2/CUGGUU/4_2-CUGGUU.mcs
MCSYM-DB/4_2/CUGUAA/
MCSYM-DB/4_2/CUGUAA/4_2-CUGUAA.mcs
MCSYM-DB/4_2/CUGUAA/ds-4_2-CUGUAA_x.pdb.gz
MCSYM-DB/4_2/CUGUAG/
MCSYM-DB/4_2/CUGUAG/4_2-CUGUAG.mcs
MCSYM-DB/4_2/CUGUAG/ds-4_2-CUGUAG_x.pdb.gz
MCSYM-DB/4_2/CUGUAU/
MCSYM-DB/4_2/CUGUAU/4_2-CUGUAU.mcs
MCSYM-DB/4_2/CUGUCC/
MCSYM-DB/4_2/CUGUCC/4_2-CUGUCC.mcs
MCSYM-DB/4_2/CUGUCC/ds-4_2-CUGUCC_x.pdb.gz
MCSYM-DB/4_2/CUGUCG/
MCSYM-DB/4_2/CUGUCG/4_2-CUGUCG.mcs
MCSYM-DB/4_2/CUGUGA/
MCSYM-DB/4_2/CUGUGA/4_2-CUGUGA.mcs
MCSYM-DB/4_2/CUGUGG/
MCSYM-DB/4_2/CUGUGG/4_2-CUGUGG.mcs
MCSYM-DB/4_2/CUGUGG/ds-4_2-CUGUGG_x.pdb.gz
MCSYM-DB/4_2/CUGUGU/
MCSYM-DB/4_2/CUGUGU/4_2-CUGUGU.mcs
MCSYM-DB/4_2/CUGUUA/
MCSYM-DB/4_2/CUGUUA/4_2-CUGUUA.mcs
MCSYM-DB/4_2/CUGUUG/
MCSYM-DB/4_2/CUGUUG/4_2-CUGUUG.mcs
MCSYM-DB/4_2/CUGUUG/ds-4_2-CUGUUG_x.pdb.gz
MCSYM-DB/4_2/CUUAUC/
MCSYM-DB/4_2/CUUAUC/4_2-CUUAUC.mcs
MCSYM-DB/4_2/CUUAUC/ds-4_2-CUUAUC_x.pdb.gz
MCSYM-DB/4_2/CUUAUG/
MCSYM-DB/4_2/CUUAUG/4_2-CUUAUG.mcs
MCSYM-DB/4_2/CUUAUG/ds-4_2-CUUAUG_x.pdb.gz
MCSYM-DB/4_2/CUUCAG/
MCSYM-DB/4_2/CUUCAG/4_2-CUUCAG.mcs
MCSYM-DB/4_2/CUUCAG/ds-4_2-CUUCAG_x.pdb.gz
MCSYM-DB/4_2/CUUCCG/
MCSYM-DB/4_2/CUUCCG/4_2-CUUCCG.mcs
MCSYM-DB/4_2/CUUCGA/
MCSYM-DB/4_2/CUUCGA/4_2-CUUCGA.mcs
MCSYM-DB/4_2/CUUCGG/
MCSYM-DB/4_2/CUUCGG/4_2-CUUCGG.mcs
MCSYM-DB/4_2/CUUCGG/ds-4_2-CUUCGG_x.pdb.gz
MCSYM-DB/4_2/CUUCGU/
MCSYM-DB/4_2/CUUCGU/4_2-CUUCGU.mcs
MCSYM-DB/4_2/CUUCUC/
MCSYM-DB/4_2/CUUCUC/4_2-CUUCUC.mcs
MCSYM-DB/4_2/CUUCUG/
MCSYM-DB/4_2/CUUCUG/4_2-CUUCUG.mcs
MCSYM-DB/4_2/CUUCUG/ds-4_2-CUUCUG_x.pdb.gz
MCSYM-DB/4_2/CUUCUU/
MCSYM-DB/4_2/CUUCUU/4_2-CUUCUU.mcs
MCSYM-DB/4_2/CUUGAA/
MCSYM-DB/4_2/CUUGAA/4_2-CUUGAA.mcs
MCSYM-DB/4_2/CUUGAG/
MCSYM-DB/4_2/CUUGAG/4_2-CUUGAG.mcs
MCSYM-DB/4_2/CUUGCA/
MCSYM-DB/4_2/CUUGCA/4_2-CUUGCA.mcs
MCSYM-DB/4_2/CUUGCC/
MCSYM-DB/4_2/CUUGCC/4_2-CUUGCC.mcs
MCSYM-DB/4_2/CUUGCC/ds-4_2-CUUGCC_x.pdb.gz
MCSYM-DB/4_2/CUUGCG/
MCSYM-DB/4_2/CUUGCG/1NBK_model_1.pdb.gz
MCSYM-DB/4_2/CUUGCG/4_2-CUUGCG.mcs
MCSYM-DB/4_2/CUUGCG/ds-4_2-CUUGCG_x.pdb.gz
MCSYM-DB/4_2/CUUGGG/
MCSYM-DB/4_2/CUUGGG/4_2-CUUGGG.mcs
MCSYM-DB/4_2/CUUGGG/ds-4_2-CUUGGG_x.pdb.gz
MCSYM-DB/4_2/CUUGUG/
MCSYM-DB/4_2/CUUGUG/4_2-CUUGUG.mcs
MCSYM-DB/4_2/CUUGUG/ds-4_2-CUUGUG_x.pdb.gz
MCSYM-DB/4_2/CUUUAC/
MCSYM-DB/4_2/CUUUAC/4_2-CUUUAC.mcs
MCSYM-DB/4_2/CUUUAG/
MCSYM-DB/4_2/CUUUAG/4_2-CUUUAG.mcs
MCSYM-DB/4_2/CUUUAG/ds-4_2-CUUUAG_x.pdb.gz
MCSYM-DB/4_2/CUUUAU/
MCSYM-DB/4_2/CUUUAU/4_2-CUUUAU.mcs
MCSYM-DB/4_2/CUUUCC/
MCSYM-DB/4_2/CUUUCC/4_2-CUUUCC.mcs
MCSYM-DB/4_2/CUUUGA/
MCSYM-DB/4_2/CUUUGA/4_2-CUUUGA.mcs
MCSYM-DB/4_2/CUUUGC/
MCSYM-DB/4_2/CUUUGC/4_2-CUUUGC.mcs
MCSYM-DB/4_2/CUUUGC/ds-4_2-CUUUGC_x.pdb.gz
MCSYM-DB/4_2/CUUUGG/
MCSYM-DB/4_2/CUUUGG/4_2-CUUUGG.mcs
MCSYM-DB/4_2/CUUUGG/ds-4_2-CUUUGG_x.pdb.gz
MCSYM-DB/4_2/CUUUGU/
MCSYM-DB/4_2/CUUUGU/4_2-CUUUGU.mcs
MCSYM-DB/4_2/CUUUGU/ds-4_2-CUUUGU_x.pdb.gz
MCSYM-DB/4_2/CUUUUC/
MCSYM-DB/4_2/CUUUUC/4_2-CUUUUC.mcs
MCSYM-DB/4_2/CUUUUC/ds-4_2-CUUUUC_x.pdb.gz
MCSYM-DB/4_2/CUUUUG/
MCSYM-DB/4_2/CUUUUG/4_2-CUUUUG.mcs
MCSYM-DB/4_2/CUUUUG/ds-4_2-CUUUUG_x.pdb.gz
MCSYM-DB/4_2/GAAAAA/
MCSYM-DB/4_2/GAAAAA/4_2-GAAAAA.mcs
MCSYM-DB/4_2/GAAAAA/ds-4_2-GAAAAA_x.pdb.gz
MCSYM-DB/4_2/GAAAAC/
MCSYM-DB/4_2/GAAAAC/4_2-GAAAAC.mcs
MCSYM-DB/4_2/GAAAAC/ds-4_2-GAAAAC_x.pdb.gz
MCSYM-DB/4_2/GAAAAG/
MCSYM-DB/4_2/GAAAAG/4_2-GAAAAG.mcs
MCSYM-DB/4_2/GAAAAG/ds-4_2-GAAAAG_x.pdb.gz
MCSYM-DB/4_2/GAAACC/
MCSYM-DB/4_2/GAAACC/4_2-GAAACC.mcs
MCSYM-DB/4_2/GAAACU/
MCSYM-DB/4_2/GAAACU/4_2-GAAACU.mcs
MCSYM-DB/4_2/GAAAGC/
MCSYM-DB/4_2/GAAAGC/4_2-GAAAGC.mcs
MCSYM-DB/4_2/GAAAGU/
MCSYM-DB/4_2/GAAAGU/4_2-GAAAGU.mcs
MCSYM-DB/4_2/GAAAGU/ds-4_2-GAAAGU_x.pdb.gz
MCSYM-DB/4_2/GAAAUA/
MCSYM-DB/4_2/GAAAUA/4_2-GAAAUA.mcs
MCSYM-DB/4_2/GAAAUA/ds-4_2-GAAAUA_x.pdb.gz
MCSYM-DB/4_2/GAAAUC/
MCSYM-DB/4_2/GAAAUC/1HC8_model_1.pdb.gz
MCSYM-DB/4_2/GAAAUC/1S03_model_1.pdb.gz
MCSYM-DB/4_2/GAAAUC/4_2-GAAAUC.mcs
MCSYM-DB/4_2/GAAAUC/ds-4_2-GAAAUC_x.pdb.gz
MCSYM-DB/4_2/GAAAUG/
MCSYM-DB/4_2/GAAAUG/4_2-GAAAUG.mcs
MCSYM-DB/4_2/GAAAUG/ds-4_2-GAAAUG_x.pdb.gz
MCSYM-DB/4_2/GAAAUU/
MCSYM-DB/4_2/GAAAUU/4_2-GAAAUU.mcs
MCSYM-DB/4_2/GAACAA/
MCSYM-DB/4_2/GAACAA/4_2-GAACAA.mcs
MCSYM-DB/4_2/GAACAA/ds-4_2-GAACAA_x.pdb.gz
MCSYM-DB/4_2/GAACAC/
MCSYM-DB/4_2/GAACAC/4_2-GAACAC.mcs
MCSYM-DB/4_2/GAACCA/
MCSYM-DB/4_2/GAACCA/4_2-GAACCA.mcs
MCSYM-DB/4_2/GAACCC/
MCSYM-DB/4_2/GAACCC/4_2-GAACCC.mcs
MCSYM-DB/4_2/GAACCC/ds-4_2-GAACCC_x.pdb.gz
MCSYM-DB/4_2/GAACGA/
MCSYM-DB/4_2/GAACGA/4_2-GAACGA.mcs
MCSYM-DB/4_2/GAACGA/ds-4_2-GAACGA_x.pdb.gz
MCSYM-DB/4_2/GAACGC/
MCSYM-DB/4_2/GAACGC/4_2-GAACGC.mcs
MCSYM-DB/4_2/GAACGC/ds-4_2-GAACGC_x.pdb.gz
MCSYM-DB/4_2/GAACGG/
MCSYM-DB/4_2/GAACGG/4_2-GAACGG.mcs
MCSYM-DB/4_2/GAACGU/
MCSYM-DB/4_2/GAACGU/4_2-GAACGU.mcs
MCSYM-DB/4_2/GAACGU/ds-4_2-GAACGU_x.pdb.gz
MCSYM-DB/4_2/GAACUU/
MCSYM-DB/4_2/GAACUU/4_2-GAACUU.mcs
MCSYM-DB/4_2/GAAGAC/
MCSYM-DB/4_2/GAAGAC/4_2-GAAGAC.mcs
MCSYM-DB/4_2/GAAGAC/ds-4_2-GAAGAC_x.pdb.gz
MCSYM-DB/4_2/GAAGAG/
MCSYM-DB/4_2/GAAGAG/4_2-GAAGAG.mcs
MCSYM-DB/4_2/GAAGAG/ds-4_2-GAAGAG_x.pdb.gz
MCSYM-DB/4_2/GAAGAU/
MCSYM-DB/4_2/GAAGAU/4_2-GAAGAU.mcs
MCSYM-DB/4_2/GAAGCA/
MCSYM-DB/4_2/GAAGCA/4_2-GAAGCA.mcs
MCSYM-DB/4_2/GAAGCA/ds-4_2-GAAGCA_x.pdb.gz
MCSYM-DB/4_2/GAAGCC/
MCSYM-DB/4_2/GAAGCC/1JUR_model_1.pdb.gz
MCSYM-DB/4_2/GAAGCC/1MJI_model_1.pdb.gz
MCSYM-DB/4_2/GAAGCC/1VQ7_model_1.pdb.gz
MCSYM-DB/4_2/GAAGCC/4_2-GAAGCC.mcs
MCSYM-DB/4_2/GAAGCC/ds-4_2-GAAGCC_x.pdb.gz
MCSYM-DB/4_2/GAAGCU/
MCSYM-DB/4_2/GAAGCU/4_2-GAAGCU.mcs
MCSYM-DB/4_2/GAAGGC/
MCSYM-DB/4_2/GAAGGC/4_2-GAAGGC.mcs
MCSYM-DB/4_2/GAAGUA/
MCSYM-DB/4_2/GAAGUA/4_2-GAAGUA.mcs
MCSYM-DB/4_2/GAAGUC/
MCSYM-DB/4_2/GAAGUC/4_2-GAAGUC.mcs
MCSYM-DB/4_2/GAAGUC/ds-4_2-GAAGUC_x.pdb.gz
MCSYM-DB/4_2/GAAGUG/
MCSYM-DB/4_2/GAAGUG/4_2-GAAGUG.mcs
MCSYM-DB/4_2/GAAGUU/
MCSYM-DB/4_2/GAAGUU/4_2-GAAGUU.mcs
MCSYM-DB/4_2/GAAGUU/ds-4_2-GAAGUU_x.pdb.gz
MCSYM-DB/4_2/GAAUAA/
MCSYM-DB/4_2/GAAUAA/4_2-GAAUAA.mcs
MCSYM-DB/4_2/GAAUAA/ds-4_2-GAAUAA_x.pdb.gz
MCSYM-DB/4_2/GAAUAC/
MCSYM-DB/4_2/GAAUAC/4_2-GAAUAC.mcs
MCSYM-DB/4_2/GAAUAC/ds-4_2-GAAUAC_x.pdb.gz
MCSYM-DB/4_2/GAAUAG/
MCSYM-DB/4_2/GAAUAG/4_2-GAAUAG.mcs
MCSYM-DB/4_2/GAAUAG/ds-4_2-GAAUAG_x.pdb.gz
MCSYM-DB/4_2/GAAUAU/
MCSYM-DB/4_2/GAAUAU/4_2-GAAUAU.mcs
MCSYM-DB/4_2/GAAUAU/ds-4_2-GAAUAU_x.pdb.gz
MCSYM-DB/4_2/GAAUCC/
MCSYM-DB/4_2/GAAUCC/4_2-GAAUCC.mcs
MCSYM-DB/4_2/GAAUCC/ds-4_2-GAAUCC_x.pdb.gz
MCSYM-DB/4_2/GAAUGA/
MCSYM-DB/4_2/GAAUGA/1IL2_model_1.pdb.gz
MCSYM-DB/4_2/GAAUGA/4_2-GAAUGA.mcs
MCSYM-DB/4_2/GAAUGA/ds-4_2-GAAUGA_x.pdb.gz
MCSYM-DB/4_2/GAAUGC/
MCSYM-DB/4_2/GAAUGC/4_2-GAAUGC.mcs
MCSYM-DB/4_2/GAAUGC/ds-4_2-GAAUGC_x.pdb.gz
MCSYM-DB/4_2/GAAUUA/
MCSYM-DB/4_2/GAAUUA/4_2-GAAUUA.mcs
MCSYM-DB/4_2/GAAUUC/
MCSYM-DB/4_2/GAAUUC/4_2-GAAUUC.mcs
MCSYM-DB/4_2/GACAAC/
MCSYM-DB/4_2/GACAAC/4_2-GACAAC.mcs
MCSYM-DB/4_2/GACACA/
MCSYM-DB/4_2/GACACA/4_2-GACACA.mcs
MCSYM-DB/4_2/GACACA/ds-4_2-GACACA_x.pdb.gz
MCSYM-DB/4_2/GACACC/
MCSYM-DB/4_2/GACACC/4_2-GACACC.mcs
MCSYM-DB/4_2/GACACC/ds-4_2-GACACC_x.pdb.gz
MCSYM-DB/4_2/GACAGC/
MCSYM-DB/4_2/GACAGC/4_2-GACAGC.mcs
MCSYM-DB/4_2/GACAGU/
MCSYM-DB/4_2/GACAGU/4_2-GACAGU.mcs
MCSYM-DB/4_2/GACAGU/ds-4_2-GACAGU_x.pdb.gz
MCSYM-DB/4_2/GACAUA/
MCSYM-DB/4_2/GACAUA/4_2-GACAUA.mcs
MCSYM-DB/4_2/GACAUA/ds-4_2-GACAUA_x.pdb.gz
MCSYM-DB/4_2/GACAUC/
MCSYM-DB/4_2/GACAUC/4_2-GACAUC.mcs
MCSYM-DB/4_2/GACAUC/ds-4_2-GACAUC_x.pdb.gz
MCSYM-DB/4_2/GACAUG/
MCSYM-DB/4_2/GACAUG/4_2-GACAUG.mcs
MCSYM-DB/4_2/GACAUG/ds-4_2-GACAUG_x.pdb.gz
MCSYM-DB/4_2/GACAUU/
MCSYM-DB/4_2/GACAUU/4_2-GACAUU.mcs
MCSYM-DB/4_2/GACAUU/ds-4_2-GACAUU_x.pdb.gz
MCSYM-DB/4_2/GACCAA/
MCSYM-DB/4_2/GACCAA/4_2-GACCAA.mcs
MCSYM-DB/4_2/GACCAC/
MCSYM-DB/4_2/GACCAC/4_2-GACCAC.mcs
MCSYM-DB/4_2/GACCAU/
MCSYM-DB/4_2/GACCAU/4_2-GACCAU.mcs
MCSYM-DB/4_2/GACCCC/
MCSYM-DB/4_2/GACCCC/4_2-GACCCC.mcs
MCSYM-DB/4_2/GACCCC/ds-4_2-GACCCC_x.pdb.gz
MCSYM-DB/4_2/GACCCU/
MCSYM-DB/4_2/GACCCU/4_2-GACCCU.mcs
MCSYM-DB/4_2/GACCCU/ds-4_2-GACCCU_x.pdb.gz
MCSYM-DB/4_2/GACCGA/
MCSYM-DB/4_2/GACCGA/4_2-GACCGA.mcs
MCSYM-DB/4_2/GACCGA/ds-4_2-GACCGA_x.pdb.gz
MCSYM-DB/4_2/GACCGC/
MCSYM-DB/4_2/GACCGC/1U6P_model_1.pdb.gz
MCSYM-DB/4_2/GACCGC/4_2-GACCGC.mcs
MCSYM-DB/4_2/GACCGC/ds-4_2-GACCGC_x.pdb.gz
MCSYM-DB/4_2/GACCGG/
MCSYM-DB/4_2/GACCGG/4_2-GACCGG.mcs
MCSYM-DB/4_2/GACCGU/
MCSYM-DB/4_2/GACCGU/4_2-GACCGU.mcs
MCSYM-DB/4_2/GACCGU/ds-4_2-GACCGU_x.pdb.gz
MCSYM-DB/4_2/GACCUG/
MCSYM-DB/4_2/GACCUG/4_2-GACCUG.mcs
MCSYM-DB/4_2/GACCUG/ds-4_2-GACCUG_x.pdb.gz
MCSYM-DB/4_2/GACGCA/
MCSYM-DB/4_2/GACGCA/4_2-GACGCA.mcs
MCSYM-DB/4_2/GACGCA/ds-4_2-GACGCA_x.pdb.gz
MCSYM-DB/4_2/GACGCC/
MCSYM-DB/4_2/GACGCC/4_2-GACGCC.mcs
MCSYM-DB/4_2/GACGCC/ds-4_2-GACGCC_x.pdb.gz
MCSYM-DB/4_2/GACGCU/
MCSYM-DB/4_2/GACGCU/4_2-GACGCU.mcs
MCSYM-DB/4_2/GACGCU/ds-4_2-GACGCU_x.pdb.gz
MCSYM-DB/4_2/GACGUA/
MCSYM-DB/4_2/GACGUA/4_2-GACGUA.mcs
MCSYM-DB/4_2/GACGUA/ds-4_2-GACGUA_x.pdb.gz
MCSYM-DB/4_2/GACGUC/
MCSYM-DB/4_2/GACGUC/4_2-GACGUC.mcs
MCSYM-DB/4_2/GACGUC/ds-4_2-GACGUC_x.pdb.gz
MCSYM-DB/4_2/GACUAA/
MCSYM-DB/4_2/GACUAA/4_2-GACUAA.mcs
MCSYM-DB/4_2/GACUAA/ds-4_2-GACUAA_x.pdb.gz
MCSYM-DB/4_2/GACUAC/
MCSYM-DB/4_2/GACUAC/4_2-GACUAC.mcs
MCSYM-DB/4_2/GACUAC/ds-4_2-GACUAC_x.pdb.gz
MCSYM-DB/4_2/GACUAG/
MCSYM-DB/4_2/GACUAG/4_2-GACUAG.mcs
MCSYM-DB/4_2/GACUAU/
MCSYM-DB/4_2/GACUAU/4_2-GACUAU.mcs
MCSYM-DB/4_2/GACUAU/ds-4_2-GACUAU_x.pdb.gz
MCSYM-DB/4_2/GACUGA/
MCSYM-DB/4_2/GACUGA/4_2-GACUGA.mcs
MCSYM-DB/4_2/GACUGC/
MCSYM-DB/4_2/GACUGC/4_2-GACUGC.mcs
MCSYM-DB/4_2/GACUGC/ds-4_2-GACUGC_x.pdb.gz
MCSYM-DB/4_2/GACUUC/
MCSYM-DB/4_2/GACUUC/4_2-GACUUC.mcs
MCSYM-DB/4_2/GACUUC/ds-4_2-GACUUC_x.pdb.gz
MCSYM-DB/4_2/GAGACA/
MCSYM-DB/4_2/GAGACA/4_2-GAGACA.mcs
MCSYM-DB/4_2/GAGACC/
MCSYM-DB/4_2/GAGACC/4_2-GAGACC.mcs
MCSYM-DB/4_2/GAGAGC/
MCSYM-DB/4_2/GAGAGC/4_2-GAGAGC.mcs
MCSYM-DB/4_2/GAGAUA/
MCSYM-DB/4_2/GAGAUA/4_2-GAGAUA.mcs
MCSYM-DB/4_2/GAGAUA/ds-4_2-GAGAUA_x.pdb.gz
MCSYM-DB/4_2/GAGAUC/
MCSYM-DB/4_2/GAGAUC/4_2-GAGAUC.mcs
MCSYM-DB/4_2/GAGCAG/
MCSYM-DB/4_2/GAGCAG/4_2-GAGCAG.mcs
MCSYM-DB/4_2/GAGCAG/ds-4_2-GAGCAG_x.pdb.gz
MCSYM-DB/4_2/GAGCCU/
MCSYM-DB/4_2/GAGCCU/4_2-GAGCCU.mcs
MCSYM-DB/4_2/GAGCGA/
MCSYM-DB/4_2/GAGCGA/4_2-GAGCGA.mcs
MCSYM-DB/4_2/GAGCGA/ds-4_2-GAGCGA_x.pdb.gz
MCSYM-DB/4_2/GAGCGC/
MCSYM-DB/4_2/GAGCGC/4_2-GAGCGC.mcs
MCSYM-DB/4_2/GAGCGC/ds-4_2-GAGCGC_x.pdb.gz
MCSYM-DB/4_2/GAGCGG/
MCSYM-DB/4_2/GAGCGG/4_2-GAGCGG.mcs
MCSYM-DB/4_2/GAGCGG/ds-4_2-GAGCGG_x.pdb.gz
MCSYM-DB/4_2/GAGCGU/
MCSYM-DB/4_2/GAGCGU/4_2-GAGCGU.mcs
MCSYM-DB/4_2/GAGCUC/
MCSYM-DB/4_2/GAGCUC/4_2-GAGCUC.mcs
MCSYM-DB/4_2/GAGGAG/
MCSYM-DB/4_2/GAGGAG/4_2-GAGGAG.mcs
MCSYM-DB/4_2/GAGGAG/ds-4_2-GAGGAG_x.pdb.gz
MCSYM-DB/4_2/GAGGCA/
MCSYM-DB/4_2/GAGGCA/4_2-GAGGCA.mcs
MCSYM-DB/4_2/GAGGCA/ds-4_2-GAGGCA_x.pdb.gz
MCSYM-DB/4_2/GAGGCC/
MCSYM-DB/4_2/GAGGCC/4_2-GAGGCC.mcs
MCSYM-DB/4_2/GAGGCC/ds-4_2-GAGGCC_x.pdb.gz
MCSYM-DB/4_2/GAGGCG/
MCSYM-DB/4_2/GAGGCG/4_2-GAGGCG.mcs
MCSYM-DB/4_2/GAGGCG/ds-4_2-GAGGCG_x.pdb.gz
MCSYM-DB/4_2/GAGGCU/
MCSYM-DB/4_2/GAGGCU/4_2-GAGGCU.mcs
MCSYM-DB/4_2/GAGGGC/
MCSYM-DB/4_2/GAGGGC/4_2-GAGGGC.mcs
MCSYM-DB/4_2/GAGGUC/
MCSYM-DB/4_2/GAGGUC/4_2-GAGGUC.mcs
MCSYM-DB/4_2/GAGGUC/ds-4_2-GAGGUC_x.pdb.gz
MCSYM-DB/4_2/GAGGUU/
MCSYM-DB/4_2/GAGGUU/4_2-GAGGUU.mcs
MCSYM-DB/4_2/GAGUAC/
MCSYM-DB/4_2/GAGUAC/4_2-GAGUAC.mcs
MCSYM-DB/4_2/GAGUAC/ds-4_2-GAGUAC_x.pdb.gz
MCSYM-DB/4_2/GAGUAG/
MCSYM-DB/4_2/GAGUAG/4_2-GAGUAG.mcs
MCSYM-DB/4_2/GAGUAU/
MCSYM-DB/4_2/GAGUAU/4_2-GAGUAU.mcs
MCSYM-DB/4_2/GAGUAU/ds-4_2-GAGUAU_x.pdb.gz
MCSYM-DB/4_2/GAGUCC/
MCSYM-DB/4_2/GAGUCC/4_2-GAGUCC.mcs
MCSYM-DB/4_2/GAGUGC/
MCSYM-DB/4_2/GAGUGC/4_2-GAGUGC.mcs
MCSYM-DB/4_2/GAGUGC/ds-4_2-GAGUGC_x.pdb.gz
MCSYM-DB/4_2/GAGUGG/
MCSYM-DB/4_2/GAGUGG/4_2-GAGUGG.mcs
MCSYM-DB/4_2/GAGUGU/
MCSYM-DB/4_2/GAGUGU/4_2-GAGUGU.mcs
MCSYM-DB/4_2/GAGUUC/
MCSYM-DB/4_2/GAGUUC/4_2-GAGUUC.mcs
MCSYM-DB/4_2/GAGUUU/
MCSYM-DB/4_2/GAGUUU/4_2-GAGUUU.mcs
MCSYM-DB/4_2/GAUAAC/
MCSYM-DB/4_2/GAUAAC/4_2-GAUAAC.mcs
MCSYM-DB/4_2/GAUACC/
MCSYM-DB/4_2/GAUACC/4_2-GAUACC.mcs
MCSYM-DB/4_2/GAUACC/ds-4_2-GAUACC_x.pdb.gz
MCSYM-DB/4_2/GAUACU/
MCSYM-DB/4_2/GAUACU/4_2-GAUACU.mcs
MCSYM-DB/4_2/GAUAGA/
MCSYM-DB/4_2/GAUAGA/4_2-GAUAGA.mcs
MCSYM-DB/4_2/GAUAGC/
MCSYM-DB/4_2/GAUAGC/4_2-GAUAGC.mcs
MCSYM-DB/4_2/GAUAUC/
MCSYM-DB/4_2/GAUAUC/4_2-GAUAUC.mcs
MCSYM-DB/4_2/GAUAUC/ds-4_2-GAUAUC_x.pdb.gz
MCSYM-DB/4_2/GAUAUU/
MCSYM-DB/4_2/GAUAUU/4_2-GAUAUU.mcs
MCSYM-DB/4_2/GAUCCC/
MCSYM-DB/4_2/GAUCCC/4_2-GAUCCC.mcs
MCSYM-DB/4_2/GAUCGC/
MCSYM-DB/4_2/GAUCGC/4_2-GAUCGC.mcs
MCSYM-DB/4_2/GAUCGC/ds-4_2-GAUCGC_x.pdb.gz
MCSYM-DB/4_2/GAUCGG/
MCSYM-DB/4_2/GAUCGG/4_2-GAUCGG.mcs
MCSYM-DB/4_2/GAUCGU/
MCSYM-DB/4_2/GAUCGU/4_2-GAUCGU.mcs
MCSYM-DB/4_2/GAUCGU/ds-4_2-GAUCGU_x.pdb.gz
MCSYM-DB/4_2/GAUCUA/
MCSYM-DB/4_2/GAUCUA/4_2-GAUCUA.mcs
MCSYM-DB/4_2/GAUCUC/
MCSYM-DB/4_2/GAUCUC/4_2-GAUCUC.mcs
MCSYM-DB/4_2/GAUGCA/
MCSYM-DB/4_2/GAUGCA/4_2-GAUGCA.mcs
MCSYM-DB/4_2/GAUGCC/
MCSYM-DB/4_2/GAUGCC/1XOK_model_1.pdb.gz
MCSYM-DB/4_2/GAUGCC/4_2-GAUGCC.mcs
MCSYM-DB/4_2/GAUGCC/ds-4_2-GAUGCC_x.pdb.gz
MCSYM-DB/4_2/GAUGCG/
MCSYM-DB/4_2/GAUGCG/4_2-GAUGCG.mcs
MCSYM-DB/4_2/GAUGCG/ds-4_2-GAUGCG_x.pdb.gz
MCSYM-DB/4_2/GAUGCU/
MCSYM-DB/4_2/GAUGCU/4_2-GAUGCU.mcs
MCSYM-DB/4_2/GAUGCU/ds-4_2-GAUGCU_x.pdb.gz
MCSYM-DB/4_2/GAUGGC/
MCSYM-DB/4_2/GAUGGC/4_2-GAUGGC.mcs
MCSYM-DB/4_2/GAUGGC/ds-4_2-GAUGGC_x.pdb.gz
MCSYM-DB/4_2/GAUGGU/
MCSYM-DB/4_2/GAUGGU/4_2-GAUGGU.mcs
MCSYM-DB/4_2/GAUGUC/
MCSYM-DB/4_2/GAUGUC/4_2-GAUGUC.mcs
MCSYM-DB/4_2/GAUGUC/ds-4_2-GAUGUC_x.pdb.gz
MCSYM-DB/4_2/GAUGUU/
MCSYM-DB/4_2/GAUGUU/4_2-GAUGUU.mcs
MCSYM-DB/4_2/GAUUAA/
MCSYM-DB/4_2/GAUUAA/4_2-GAUUAA.mcs
MCSYM-DB/4_2/GAUUAA/ds-4_2-GAUUAA_x.pdb.gz
MCSYM-DB/4_2/GAUUAC/
MCSYM-DB/4_2/GAUUAC/4_2-GAUUAC.mcs
MCSYM-DB/4_2/GAUUAC/ds-4_2-GAUUAC_x.pdb.gz
MCSYM-DB/4_2/GAUUAG/
MCSYM-DB/4_2/GAUUAG/4_2-GAUUAG.mcs
MCSYM-DB/4_2/GAUUAU/
MCSYM-DB/4_2/GAUUAU/4_2-GAUUAU.mcs
MCSYM-DB/4_2/GAUUAU/ds-4_2-GAUUAU_x.pdb.gz
MCSYM-DB/4_2/GAUUCC/
MCSYM-DB/4_2/GAUUCC/4_2-GAUUCC.mcs
MCSYM-DB/4_2/GAUUCC/ds-4_2-GAUUCC_x.pdb.gz
MCSYM-DB/4_2/GAUUGA/
MCSYM-DB/4_2/GAUUGA/4_2-GAUUGA.mcs
MCSYM-DB/4_2/GAUUGC/
MCSYM-DB/4_2/GAUUGC/4_2-GAUUGC.mcs
MCSYM-DB/4_2/GAUUGC/ds-4_2-GAUUGC_x.pdb.gz
MCSYM-DB/4_2/GAUUGG/
MCSYM-DB/4_2/GAUUGG/4_2-GAUUGG.mcs
MCSYM-DB/4_2/GAUUGU/
MCSYM-DB/4_2/GAUUGU/4_2-GAUUGU.mcs
MCSYM-DB/4_2/GAUUUC/
MCSYM-DB/4_2/GAUUUC/4_2-GAUUUC.mcs
MCSYM-DB/4_2/GAUUUC/ds-4_2-GAUUUC_x.pdb.gz
MCSYM-DB/4_2/GAUUUU/
MCSYM-DB/4_2/GAUUUU/4_2-GAUUUU.mcs
MCSYM-DB/4_2/GCAAAA/
MCSYM-DB/4_2/GCAAAA/4_2-GCAAAA.mcs
MCSYM-DB/4_2/GCAAAA/ds-4_2-GCAAAA_x.pdb.gz
MCSYM-DB/4_2/GCAAAC/
MCSYM-DB/4_2/GCAAAC/4_2-GCAAAC.mcs
MCSYM-DB/4_2/GCAAAC/ds-4_2-GCAAAC_x.pdb.gz
MCSYM-DB/4_2/GCAACA/
MCSYM-DB/4_2/GCAACA/4_2-GCAACA.mcs
MCSYM-DB/4_2/GCAACC/
MCSYM-DB/4_2/GCAACC/4_2-GCAACC.mcs
MCSYM-DB/4_2/GCAAGC/
MCSYM-DB/4_2/GCAAGC/4_2-GCAAGC.mcs
MCSYM-DB/4_2/GCAAGC/ds-4_2-GCAAGC_x.pdb.gz
MCSYM-DB/4_2/GCAAGU/
MCSYM-DB/4_2/GCAAGU/4_2-GCAAGU.mcs
MCSYM-DB/4_2/GCAAUA/
MCSYM-DB/4_2/GCAAUA/4_2-GCAAUA.mcs
MCSYM-DB/4_2/GCAAUA/ds-4_2-GCAAUA_x.pdb.gz
MCSYM-DB/4_2/GCAAUC/
MCSYM-DB/4_2/GCAAUC/4_2-GCAAUC.mcs
MCSYM-DB/4_2/GCAAUC/ds-4_2-GCAAUC_x.pdb.gz
MCSYM-DB/4_2/GCAAUU/
MCSYM-DB/4_2/GCAAUU/4_2-GCAAUU.mcs
MCSYM-DB/4_2/GCACAA/
MCSYM-DB/4_2/GCACAA/4_2-GCACAA.mcs
MCSYM-DB/4_2/GCACAA/ds-4_2-GCACAA_x.pdb.gz
MCSYM-DB/4_2/GCACAC/
MCSYM-DB/4_2/GCACAC/4_2-GCACAC.mcs
MCSYM-DB/4_2/GCACGA/
MCSYM-DB/4_2/GCACGA/4_2-GCACGA.mcs
MCSYM-DB/4_2/GCACGA/ds-4_2-GCACGA_x.pdb.gz
MCSYM-DB/4_2/GCACGC/
MCSYM-DB/4_2/GCACGC/4_2-GCACGC.mcs
MCSYM-DB/4_2/GCACGC/ds-4_2-GCACGC_x.pdb.gz
MCSYM-DB/4_2/GCACGU/
MCSYM-DB/4_2/GCACGU/4_2-GCACGU.mcs
MCSYM-DB/4_2/GCACUU/
MCSYM-DB/4_2/GCACUU/4_2-GCACUU.mcs
MCSYM-DB/4_2/GCACUU/ds-4_2-GCACUU_x.pdb.gz
MCSYM-DB/4_2/GCAGAC/
MCSYM-DB/4_2/GCAGAC/4_2-GCAGAC.mcs
MCSYM-DB/4_2/GCAGAC/ds-4_2-GCAGAC_x.pdb.gz
MCSYM-DB/4_2/GCAGAG/
MCSYM-DB/4_2/GCAGAG/4_2-GCAGAG.mcs
MCSYM-DB/4_2/GCAGAG/ds-4_2-GCAGAG_x.pdb.gz
MCSYM-DB/4_2/GCAGCA/
MCSYM-DB/4_2/GCAGCA/4_2-GCAGCA.mcs
MCSYM-DB/4_2/GCAGCA/ds-4_2-GCAGCA_x.pdb.gz
MCSYM-DB/4_2/GCAGCC/
MCSYM-DB/4_2/GCAGCC/4_2-GCAGCC.mcs
MCSYM-DB/4_2/GCAGCC/ds-4_2-GCAGCC_x.pdb.gz
MCSYM-DB/4_2/GCAGCU/
MCSYM-DB/4_2/GCAGCU/4_2-GCAGCU.mcs
MCSYM-DB/4_2/GCAGGG/
MCSYM-DB/4_2/GCAGGG/4_2-GCAGGG.mcs
MCSYM-DB/4_2/GCAGGG/ds-4_2-GCAGGG_x.pdb.gz
MCSYM-DB/4_2/GCAGUC/
MCSYM-DB/4_2/GCAGUC/4_2-GCAGUC.mcs
MCSYM-DB/4_2/GCAGUC/ds-4_2-GCAGUC_x.pdb.gz
MCSYM-DB/4_2/GCAUAA/
MCSYM-DB/4_2/GCAUAA/4_2-GCAUAA.mcs
MCSYM-DB/4_2/GCAUAA/ds-4_2-GCAUAA_x.pdb.gz
MCSYM-DB/4_2/GCAUAC/
MCSYM-DB/4_2/GCAUAC/4_2-GCAUAC.mcs
MCSYM-DB/4_2/GCAUAC/ds-4_2-GCAUAC_x.pdb.gz
MCSYM-DB/4_2/GCAUAG/
MCSYM-DB/4_2/GCAUAG/4_2-GCAUAG.mcs
MCSYM-DB/4_2/GCAUGA/
MCSYM-DB/4_2/GCAUGA/4_2-GCAUGA.mcs
MCSYM-DB/4_2/GCAUGA/ds-4_2-GCAUGA_x.pdb.gz
MCSYM-DB/4_2/GCAUGC/
MCSYM-DB/4_2/GCAUGC/4_2-GCAUGC.mcs
MCSYM-DB/4_2/GCAUGU/
MCSYM-DB/4_2/GCAUGU/4_2-GCAUGU.mcs
MCSYM-DB/4_2/GCAUUC/
MCSYM-DB/4_2/GCAUUC/4_2-GCAUUC.mcs
MCSYM-DB/4_2/GCAUUC/ds-4_2-GCAUUC_x.pdb.gz
MCSYM-DB/4_2/GCCAAC/
MCSYM-DB/4_2/GCCAAC/4_2-GCCAAC.mcs
MCSYM-DB/4_2/GCCAAC/ds-4_2-GCCAAC_x.pdb.gz
MCSYM-DB/4_2/GCCACC/
MCSYM-DB/4_2/GCCACC/4_2-GCCACC.mcs
MCSYM-DB/4_2/GCCAGC/
MCSYM-DB/4_2/GCCAGC/4_2-GCCAGC.mcs
MCSYM-DB/4_2/GCCAUC/
MCSYM-DB/4_2/GCCAUC/4_2-GCCAUC.mcs
MCSYM-DB/4_2/GCCAUC/ds-4_2-GCCAUC_x.pdb.gz
MCSYM-DB/4_2/GCCAUG/
MCSYM-DB/4_2/GCCAUG/4_2-GCCAUG.mcs
MCSYM-DB/4_2/GCCAUG/ds-4_2-GCCAUG_x.pdb.gz
MCSYM-DB/4_2/GCCAUU/
MCSYM-DB/4_2/GCCAUU/4_2-GCCAUU.mcs
MCSYM-DB/4_2/GCCAUU/ds-4_2-GCCAUU_x.pdb.gz
MCSYM-DB/4_2/GCCCAA/
MCSYM-DB/4_2/GCCCAA/4_2-GCCCAA.mcs
MCSYM-DB/4_2/GCCCAC/
MCSYM-DB/4_2/GCCCAC/4_2-GCCCAC.mcs
MCSYM-DB/4_2/GCCCAC/ds-4_2-GCCCAC_x.pdb.gz
MCSYM-DB/4_2/GCCCCC/
MCSYM-DB/4_2/GCCCCC/4_2-GCCCCC.mcs
MCSYM-DB/4_2/GCCCCC/ds-4_2-GCCCCC_x.pdb.gz
MCSYM-DB/4_2/GCCCCU/
MCSYM-DB/4_2/GCCCCU/4_2-GCCCCU.mcs
MCSYM-DB/4_2/GCCCCU/ds-4_2-GCCCCU_x.pdb.gz
MCSYM-DB/4_2/GCCCGA/
MCSYM-DB/4_2/GCCCGA/4_2-GCCCGA.mcs
MCSYM-DB/4_2/GCCCGA/ds-4_2-GCCCGA_x.pdb.gz
MCSYM-DB/4_2/GCCCGC/
MCSYM-DB/4_2/GCCCGC/4_2-GCCCGC.mcs
MCSYM-DB/4_2/GCCCGC/ds-4_2-GCCCGC_x.pdb.gz
MCSYM-DB/4_2/GCCCGU/
MCSYM-DB/4_2/GCCCGU/4_2-GCCCGU.mcs
MCSYM-DB/4_2/GCCCGU/ds-4_2-GCCCGU_x.pdb.gz
MCSYM-DB/4_2/GCCCUA/
MCSYM-DB/4_2/GCCCUA/4_2-GCCCUA.mcs
MCSYM-DB/4_2/GCCCUC/
MCSYM-DB/4_2/GCCCUC/4_2-GCCCUC.mcs
MCSYM-DB/4_2/GCCCUU/
MCSYM-DB/4_2/GCCCUU/4_2-GCCCUU.mcs
MCSYM-DB/4_2/GCCGAA/
MCSYM-DB/4_2/GCCGAA/4_2-GCCGAA.mcs
MCSYM-DB/4_2/GCCGAA/ds-4_2-GCCGAA_x.pdb.gz
MCSYM-DB/4_2/GCCGAC/
MCSYM-DB/4_2/GCCGAC/4_2-GCCGAC.mcs
MCSYM-DB/4_2/GCCGAC/ds-4_2-GCCGAC_x.pdb.gz
MCSYM-DB/4_2/GCCGAU/
MCSYM-DB/4_2/GCCGAU/4_2-GCCGAU.mcs
MCSYM-DB/4_2/GCCGAU/ds-4_2-GCCGAU_x.pdb.gz
MCSYM-DB/4_2/GCCGCA/
MCSYM-DB/4_2/GCCGCA/4_2-GCCGCA.mcs
MCSYM-DB/4_2/GCCGCA/ds-4_2-GCCGCA_x.pdb.gz
MCSYM-DB/4_2/GCCGCC/
MCSYM-DB/4_2/GCCGCC/4_2-GCCGCC.mcs
MCSYM-DB/4_2/GCCGCC/ds-4_2-GCCGCC_x.pdb.gz
MCSYM-DB/4_2/GCCGCU/
MCSYM-DB/4_2/GCCGCU/4_2-GCCGCU.mcs
MCSYM-DB/4_2/GCCGCU/ds-4_2-GCCGCU_x.pdb.gz
MCSYM-DB/4_2/GCCGUA/
MCSYM-DB/4_2/GCCGUA/4_2-GCCGUA.mcs
MCSYM-DB/4_2/GCCGUA/ds-4_2-GCCGUA_x.pdb.gz
MCSYM-DB/4_2/GCCGUC/
MCSYM-DB/4_2/GCCGUC/4_2-GCCGUC.mcs
MCSYM-DB/4_2/GCCGUC/ds-4_2-GCCGUC_x.pdb.gz
MCSYM-DB/4_2/GCCGUG/
MCSYM-DB/4_2/GCCGUG/4_2-GCCGUG.mcs
MCSYM-DB/4_2/GCCGUG/ds-4_2-GCCGUG_x.pdb.gz
MCSYM-DB/4_2/GCCGUU/
MCSYM-DB/4_2/GCCGUU/4_2-GCCGUU.mcs
MCSYM-DB/4_2/GCCGUU/ds-4_2-GCCGUU_x.pdb.gz
MCSYM-DB/4_2/GCCUAA/
MCSYM-DB/4_2/GCCUAA/4_2-GCCUAA.mcs
MCSYM-DB/4_2/GCCUAA/ds-4_2-GCCUAA_x.pdb.gz
MCSYM-DB/4_2/GCCUAC/
MCSYM-DB/4_2/GCCUAC/4_2-GCCUAC.mcs
MCSYM-DB/4_2/GCCUAC/ds-4_2-GCCUAC_x.pdb.gz
MCSYM-DB/4_2/GCCUAU/
MCSYM-DB/4_2/GCCUAU/4_2-GCCUAU.mcs
MCSYM-DB/4_2/GCCUAU/ds-4_2-GCCUAU_x.pdb.gz
MCSYM-DB/4_2/GCCUCC/
MCSYM-DB/4_2/GCCUCC/4_2-GCCUCC.mcs
MCSYM-DB/4_2/GCCUCC/ds-4_2-GCCUCC_x.pdb.gz
MCSYM-DB/4_2/GCCUCU/
MCSYM-DB/4_2/GCCUCU/4_2-GCCUCU.mcs
MCSYM-DB/4_2/GCCUGC/
MCSYM-DB/4_2/GCCUGC/4_2-GCCUGC.mcs
MCSYM-DB/4_2/GCCUGG/
MCSYM-DB/4_2/GCCUGG/4_2-GCCUGG.mcs
MCSYM-DB/4_2/GCCUGG/ds-4_2-GCCUGG_x.pdb.gz
MCSYM-DB/4_2/GCCUUC/
MCSYM-DB/4_2/GCCUUC/4_2-GCCUUC.mcs
MCSYM-DB/4_2/GCCUUC/ds-4_2-GCCUUC_x.pdb.gz
MCSYM-DB/4_2/GCGAUC/
MCSYM-DB/4_2/GCGAUC/4_2-GCGAUC.mcs
MCSYM-DB/4_2/GCGAUC/ds-4_2-GCGAUC_x.pdb.gz
MCSYM-DB/4_2/GCGCCA/
MCSYM-DB/4_2/GCGCCA/4_2-GCGCCA.mcs
MCSYM-DB/4_2/GCGCCA/ds-4_2-GCGCCA_x.pdb.gz
MCSYM-DB/4_2/GCGCGC/
MCSYM-DB/4_2/GCGCGC/4_2-GCGCGC.mcs
MCSYM-DB/4_2/GCGCGC/ds-4_2-GCGCGC_x.pdb.gz
MCSYM-DB/4_2/GCGGAG/
MCSYM-DB/4_2/GCGGAG/4_2-GCGGAG.mcs
MCSYM-DB/4_2/GCGGAG/ds-4_2-GCGGAG_x.pdb.gz
MCSYM-DB/4_2/GCGGCA/
MCSYM-DB/4_2/GCGGCA/4_2-GCGGCA.mcs
MCSYM-DB/4_2/GCGGCA/ds-4_2-GCGGCA_x.pdb.gz
MCSYM-DB/4_2/GCGGCC/
MCSYM-DB/4_2/GCGGCC/4_2-GCGGCC.mcs
MCSYM-DB/4_2/GCGGCC/ds-4_2-GCGGCC_x.pdb.gz
MCSYM-DB/4_2/GCGGCU/
MCSYM-DB/4_2/GCGGCU/4_2-GCGGCU.mcs
MCSYM-DB/4_2/GCGGGA/
MCSYM-DB/4_2/GCGGGA/4_2-GCGGGA.mcs
MCSYM-DB/4_2/GCGGUC/
MCSYM-DB/4_2/GCGGUC/4_2-GCGGUC.mcs
MCSYM-DB/4_2/GCGGUC/ds-4_2-GCGGUC_x.pdb.gz
MCSYM-DB/4_2/GCGGUG/
MCSYM-DB/4_2/GCGGUG/4_2-GCGGUG.mcs
MCSYM-DB/4_2/GCGGUG/ds-4_2-GCGGUG_x.pdb.gz
MCSYM-DB/4_2/GCGUAC/
MCSYM-DB/4_2/GCGUAC/4_2-GCGUAC.mcs
MCSYM-DB/4_2/GCGUAC/ds-4_2-GCGUAC_x.pdb.gz
MCSYM-DB/4_2/GCGUCG/
MCSYM-DB/4_2/GCGUCG/4_2-GCGUCG.mcs
MCSYM-DB/4_2/GCGUCG/ds-4_2-GCGUCG_x.pdb.gz
MCSYM-DB/4_2/GCGUUC/
MCSYM-DB/4_2/GCGUUC/4_2-GCGUUC.mcs
MCSYM-DB/4_2/GCUAAC/
MCSYM-DB/4_2/GCUAAC/4_2-GCUAAC.mcs
MCSYM-DB/4_2/GCUAAC/ds-4_2-GCUAAC_x.pdb.gz
MCSYM-DB/4_2/GCUAAU/
MCSYM-DB/4_2/GCUAAU/4_2-GCUAAU.mcs
MCSYM-DB/4_2/GCUACU/
MCSYM-DB/4_2/GCUACU/4_2-GCUACU.mcs
MCSYM-DB/4_2/GCUACU/ds-4_2-GCUACU_x.pdb.gz
MCSYM-DB/4_2/GCUAGC/
MCSYM-DB/4_2/GCUAGC/4_2-GCUAGC.mcs
MCSYM-DB/4_2/GCUAGC/ds-4_2-GCUAGC_x.pdb.gz
MCSYM-DB/4_2/GCUAGU/
MCSYM-DB/4_2/GCUAGU/4_2-GCUAGU.mcs
MCSYM-DB/4_2/GCUAUC/
MCSYM-DB/4_2/GCUAUC/4_2-GCUAUC.mcs
MCSYM-DB/4_2/GCUAUC/ds-4_2-GCUAUC_x.pdb.gz
MCSYM-DB/4_2/GCUAUG/
MCSYM-DB/4_2/GCUAUG/4_2-GCUAUG.mcs
MCSYM-DB/4_2/GCUAUU/
MCSYM-DB/4_2/GCUAUU/4_2-GCUAUU.mcs
MCSYM-DB/4_2/GCUAUU/ds-4_2-GCUAUU_x.pdb.gz
MCSYM-DB/4_2/GCUCAC/
MCSYM-DB/4_2/GCUCAC/4_2-GCUCAC.mcs
MCSYM-DB/4_2/GCUCAC/ds-4_2-GCUCAC_x.pdb.gz
MCSYM-DB/4_2/GCUCAU/
MCSYM-DB/4_2/GCUCAU/4_2-GCUCAU.mcs
MCSYM-DB/4_2/GCUCCC/
MCSYM-DB/4_2/GCUCCC/4_2-GCUCCC.mcs
MCSYM-DB/4_2/GCUCCC/ds-4_2-GCUCCC_x.pdb.gz
MCSYM-DB/4_2/GCUCGC/
MCSYM-DB/4_2/GCUCGC/4_2-GCUCGC.mcs
MCSYM-DB/4_2/GCUCGG/
MCSYM-DB/4_2/GCUCGG/4_2-GCUCGG.mcs
MCSYM-DB/4_2/GCUCGU/
MCSYM-DB/4_2/GCUCGU/4_2-GCUCGU.mcs
MCSYM-DB/4_2/GCUCUC/
MCSYM-DB/4_2/GCUCUC/4_2-GCUCUC.mcs
MCSYM-DB/4_2/GCUCUC/ds-4_2-GCUCUC_x.pdb.gz
MCSYM-DB/4_2/GCUCUG/
MCSYM-DB/4_2/GCUCUG/4_2-GCUCUG.mcs
MCSYM-DB/4_2/GCUCUU/
MCSYM-DB/4_2/GCUCUU/4_2-GCUCUU.mcs
MCSYM-DB/4_2/GCUCUU/ds-4_2-GCUCUU_x.pdb.gz
MCSYM-DB/4_2/GCUGAC/
MCSYM-DB/4_2/GCUGAC/4_2-GCUGAC.mcs
MCSYM-DB/4_2/GCUGAC/ds-4_2-GCUGAC_x.pdb.gz
MCSYM-DB/4_2/GCUGCA/
MCSYM-DB/4_2/GCUGCA/4_2-GCUGCA.mcs
MCSYM-DB/4_2/GCUGCC/
MCSYM-DB/4_2/GCUGCC/4_2-GCUGCC.mcs
MCSYM-DB/4_2/GCUGCC/ds-4_2-GCUGCC_x.pdb.gz
MCSYM-DB/4_2/GCUGCU/
MCSYM-DB/4_2/GCUGCU/4_2-GCUGCU.mcs
MCSYM-DB/4_2/GCUGCU/ds-4_2-GCUGCU_x.pdb.gz
MCSYM-DB/4_2/GCUGGC/
MCSYM-DB/4_2/GCUGGC/4_2-GCUGGC.mcs
MCSYM-DB/4_2/GCUGGG/
MCSYM-DB/4_2/GCUGGG/4_2-GCUGGG.mcs
MCSYM-DB/4_2/GCUGGG/ds-4_2-GCUGGG_x.pdb.gz
MCSYM-DB/4_2/GCUGUA/
MCSYM-DB/4_2/GCUGUA/4_2-GCUGUA.mcs
MCSYM-DB/4_2/GCUGUC/
MCSYM-DB/4_2/GCUGUC/4_2-GCUGUC.mcs
MCSYM-DB/4_2/GCUGUC/ds-4_2-GCUGUC_x.pdb.gz
MCSYM-DB/4_2/GCUGUG/
MCSYM-DB/4_2/GCUGUG/4_2-GCUGUG.mcs
MCSYM-DB/4_2/GCUGUU/
MCSYM-DB/4_2/GCUGUU/4_2-GCUGUU.mcs
MCSYM-DB/4_2/GCUGUU/ds-4_2-GCUGUU_x.pdb.gz
MCSYM-DB/4_2/GCUUAA/
MCSYM-DB/4_2/GCUUAA/4_2-GCUUAA.mcs
MCSYM-DB/4_2/GCUUAC/
MCSYM-DB/4_2/GCUUAC/4_2-GCUUAC.mcs
MCSYM-DB/4_2/GCUUAC/ds-4_2-GCUUAC_x.pdb.gz
MCSYM-DB/4_2/GCUUAU/
MCSYM-DB/4_2/GCUUAU/4_2-GCUUAU.mcs
MCSYM-DB/4_2/GCUUAU/ds-4_2-GCUUAU_x.pdb.gz
MCSYM-DB/4_2/GCUUCC/
MCSYM-DB/4_2/GCUUCC/4_2-GCUUCC.mcs
MCSYM-DB/4_2/GCUUCC/ds-4_2-GCUUCC_x.pdb.gz
MCSYM-DB/4_2/GCUUGC/
MCSYM-DB/4_2/GCUUGC/4_2-GCUUGC.mcs
MCSYM-DB/4_2/GCUUUA/
MCSYM-DB/4_2/GCUUUA/4_2-GCUUUA.mcs
MCSYM-DB/4_2/GCUUUC/
MCSYM-DB/4_2/GCUUUC/4_2-GCUUUC.mcs
MCSYM-DB/4_2/GCUUUC/ds-4_2-GCUUUC_x.pdb.gz
MCSYM-DB/4_2/GCUUUU/
MCSYM-DB/4_2/GCUUUU/4_2-GCUUUU.mcs
MCSYM-DB/4_2/GCUUUU/ds-4_2-GCUUUU_x.pdb.gz
MCSYM-DB/4_2/GGAAAG/
MCSYM-DB/4_2/GGAAAG/4_2-GGAAAG.mcs
MCSYM-DB/4_2/GGAAAG/ds-4_2-GGAAAG_x.pdb.gz
MCSYM-DB/4_2/GGAAAU/
MCSYM-DB/4_2/GGAAAU/4_2-GGAAAU.mcs
MCSYM-DB/4_2/GGAAAU/ds-4_2-GGAAAU_x.pdb.gz
MCSYM-DB/4_2/GGAACC/
MCSYM-DB/4_2/GGAACC/4_2-GGAACC.mcs
MCSYM-DB/4_2/GGAACU/
MCSYM-DB/4_2/GGAACU/4_2-GGAACU.mcs
MCSYM-DB/4_2/GGAAGC/
MCSYM-DB/4_2/GGAAGC/4_2-GGAAGC.mcs
MCSYM-DB/4_2/GGAAGC/ds-4_2-GGAAGC_x.pdb.gz
MCSYM-DB/4_2/GGAAGU/
MCSYM-DB/4_2/GGAAGU/4_2-GGAAGU.mcs
MCSYM-DB/4_2/GGAAUA/
MCSYM-DB/4_2/GGAAUA/4_2-GGAAUA.mcs
MCSYM-DB/4_2/GGAAUC/
MCSYM-DB/4_2/GGAAUC/1VQ7_model_1.pdb.gz
MCSYM-DB/4_2/GGAAUC/4_2-GGAAUC.mcs
MCSYM-DB/4_2/GGAAUC/ds-4_2-GGAAUC_x.pdb.gz
MCSYM-DB/4_2/GGAAUG/
MCSYM-DB/4_2/GGAAUG/4_2-GGAAUG.mcs
MCSYM-DB/4_2/GGAAUU/
MCSYM-DB/4_2/GGAAUU/4_2-GGAAUU.mcs
MCSYM-DB/4_2/GGACCC/
MCSYM-DB/4_2/GGACCC/4_2-GGACCC.mcs
MCSYM-DB/4_2/GGACGA/
MCSYM-DB/4_2/GGACGA/4_2-GGACGA.mcs
MCSYM-DB/4_2/GGACGA/ds-4_2-GGACGA_x.pdb.gz
MCSYM-DB/4_2/GGACGC/
MCSYM-DB/4_2/GGACGC/4_2-GGACGC.mcs
MCSYM-DB/4_2/GGACGC/ds-4_2-GGACGC_x.pdb.gz
MCSYM-DB/4_2/GGACGG/
MCSYM-DB/4_2/GGACGG/4_2-GGACGG.mcs
MCSYM-DB/4_2/GGACGU/
MCSYM-DB/4_2/GGACGU/4_2-GGACGU.mcs
MCSYM-DB/4_2/GGACUC/
MCSYM-DB/4_2/GGACUC/4_2-GGACUC.mcs
MCSYM-DB/4_2/GGAGAA/
MCSYM-DB/4_2/GGAGAA/4_2-GGAGAA.mcs
MCSYM-DB/4_2/GGAGAA/ds-4_2-GGAGAA_x.pdb.gz
MCSYM-DB/4_2/GGAGCA/
MCSYM-DB/4_2/GGAGCA/4_2-GGAGCA.mcs
MCSYM-DB/4_2/GGAGCA/ds-4_2-GGAGCA_x.pdb.gz
MCSYM-DB/4_2/GGAGCC/
MCSYM-DB/4_2/GGAGCC/4_2-GGAGCC.mcs
MCSYM-DB/4_2/GGAGCC/ds-4_2-GGAGCC_x.pdb.gz
MCSYM-DB/4_2/GGAGCU/
MCSYM-DB/4_2/GGAGCU/4_2-GGAGCU.mcs
MCSYM-DB/4_2/GGAGGC/
MCSYM-DB/4_2/GGAGGC/4_2-GGAGGC.mcs
MCSYM-DB/4_2/GGAGGC/ds-4_2-GGAGGC_x.pdb.gz
MCSYM-DB/4_2/GGAGUA/
MCSYM-DB/4_2/GGAGUA/4_2-GGAGUA.mcs
MCSYM-DB/4_2/GGAGUA/ds-4_2-GGAGUA_x.pdb.gz
MCSYM-DB/4_2/GGAGUC/
MCSYM-DB/4_2/GGAGUC/4_2-GGAGUC.mcs
MCSYM-DB/4_2/GGAGUC/ds-4_2-GGAGUC_x.pdb.gz
MCSYM-DB/4_2/GGAGUG/
MCSYM-DB/4_2/GGAGUG/4_2-GGAGUG.mcs
MCSYM-DB/4_2/GGAGUG/ds-4_2-GGAGUG_x.pdb.gz
MCSYM-DB/4_2/GGAGUU/
MCSYM-DB/4_2/GGAGUU/4_2-GGAGUU.mcs
MCSYM-DB/4_2/GGAUAA/
MCSYM-DB/4_2/GGAUAA/4_2-GGAUAA.mcs
MCSYM-DB/4_2/GGAUAC/
MCSYM-DB/4_2/GGAUAC/4_2-GGAUAC.mcs
MCSYM-DB/4_2/GGAUAC/ds-4_2-GGAUAC_x.pdb.gz
MCSYM-DB/4_2/GGAUCC/
MCSYM-DB/4_2/GGAUCC/4_2-GGAUCC.mcs
MCSYM-DB/4_2/GGAUCC/ds-4_2-GGAUCC_x.pdb.gz
MCSYM-DB/4_2/GGAUGA/
MCSYM-DB/4_2/GGAUGA/4_2-GGAUGA.mcs
MCSYM-DB/4_2/GGAUGA/ds-4_2-GGAUGA_x.pdb.gz
MCSYM-DB/4_2/GGAUGC/
MCSYM-DB/4_2/GGAUGC/4_2-GGAUGC.mcs
MCSYM-DB/4_2/GGAUGC/ds-4_2-GGAUGC_x.pdb.gz
MCSYM-DB/4_2/GGAUGG/
MCSYM-DB/4_2/GGAUGG/4_2-GGAUGG.mcs
MCSYM-DB/4_2/GGAUGU/
MCSYM-DB/4_2/GGAUGU/4_2-GGAUGU.mcs
MCSYM-DB/4_2/GGAUUC/
MCSYM-DB/4_2/GGAUUC/4_2-GGAUUC.mcs
MCSYM-DB/4_2/GGCACA/
MCSYM-DB/4_2/GGCACA/4_2-GGCACA.mcs
MCSYM-DB/4_2/GGCACA/ds-4_2-GGCACA_x.pdb.gz
MCSYM-DB/4_2/GGCACC/
MCSYM-DB/4_2/GGCACC/4_2-GGCACC.mcs
MCSYM-DB/4_2/GGCACC/ds-4_2-GGCACC_x.pdb.gz
MCSYM-DB/4_2/GGCAGC/
MCSYM-DB/4_2/GGCAGC/4_2-GGCAGC.mcs
MCSYM-DB/4_2/GGCAGC/ds-4_2-GGCAGC_x.pdb.gz
MCSYM-DB/4_2/GGCAGU/
MCSYM-DB/4_2/GGCAGU/4_2-GGCAGU.mcs
MCSYM-DB/4_2/GGCAGU/ds-4_2-GGCAGU_x.pdb.gz
MCSYM-DB/4_2/GGCAUA/
MCSYM-DB/4_2/GGCAUA/4_2-GGCAUA.mcs
MCSYM-DB/4_2/GGCAUA/ds-4_2-GGCAUA_x.pdb.gz
MCSYM-DB/4_2/GGCAUC/
MCSYM-DB/4_2/GGCAUC/4_2-GGCAUC.mcs
MCSYM-DB/4_2/GGCAUC/ds-4_2-GGCAUC_x.pdb.gz
MCSYM-DB/4_2/GGCAUU/
MCSYM-DB/4_2/GGCAUU/4_2-GGCAUU.mcs
MCSYM-DB/4_2/GGCAUU/ds-4_2-GGCAUU_x.pdb.gz
MCSYM-DB/4_2/GGCCAC/
MCSYM-DB/4_2/GGCCAC/4_2-GGCCAC.mcs
MCSYM-DB/4_2/GGCCAC/ds-4_2-GGCCAC_x.pdb.gz
MCSYM-DB/4_2/GGCCGC/
MCSYM-DB/4_2/GGCCGC/4_2-GGCCGC.mcs
MCSYM-DB/4_2/GGCCGC/ds-4_2-GGCCGC_x.pdb.gz
MCSYM-DB/4_2/GGCCGU/
MCSYM-DB/4_2/GGCCGU/4_2-GGCCGU.mcs
MCSYM-DB/4_2/GGCCGU/ds-4_2-GGCCGU_x.pdb.gz
MCSYM-DB/4_2/GGCGCA/
MCSYM-DB/4_2/GGCGCA/4_2-GGCGCA.mcs
MCSYM-DB/4_2/GGCGCA/ds-4_2-GGCGCA_x.pdb.gz
MCSYM-DB/4_2/GGCGCC/
MCSYM-DB/4_2/GGCGCC/4_2-GGCGCC.mcs
MCSYM-DB/4_2/GGCGCC/ds-4_2-GGCGCC_x.pdb.gz
MCSYM-DB/4_2/GGCGCU/
MCSYM-DB/4_2/GGCGCU/4_2-GGCGCU.mcs
MCSYM-DB/4_2/GGCGCU/ds-4_2-GGCGCU_x.pdb.gz
MCSYM-DB/4_2/GGCGUA/
MCSYM-DB/4_2/GGCGUA/4_2-GGCGUA.mcs
MCSYM-DB/4_2/GGCGUA/ds-4_2-GGCGUA_x.pdb.gz
MCSYM-DB/4_2/GGCGUC/
MCSYM-DB/4_2/GGCGUC/4_2-GGCGUC.mcs
MCSYM-DB/4_2/GGCGUC/ds-4_2-GGCGUC_x.pdb.gz
MCSYM-DB/4_2/GGCUAA/
MCSYM-DB/4_2/GGCUAA/4_2-GGCUAA.mcs
MCSYM-DB/4_2/GGCUAA/ds-4_2-GGCUAA_x.pdb.gz
MCSYM-DB/4_2/GGCUAC/
MCSYM-DB/4_2/GGCUAC/4_2-GGCUAC.mcs
MCSYM-DB/4_2/GGCUAC/ds-4_2-GGCUAC_x.pdb.gz
MCSYM-DB/4_2/GGCUAU/
MCSYM-DB/4_2/GGCUAU/4_2-GGCUAU.mcs
MCSYM-DB/4_2/GGCUAU/ds-4_2-GGCUAU_x.pdb.gz
MCSYM-DB/4_2/GGCUCC/
MCSYM-DB/4_2/GGCUCC/4_2-GGCUCC.mcs
MCSYM-DB/4_2/GGCUCG/
MCSYM-DB/4_2/GGCUCG/4_2-GGCUCG.mcs
MCSYM-DB/4_2/GGCUCG/ds-4_2-GGCUCG_x.pdb.gz
MCSYM-DB/4_2/GGCUGC/
MCSYM-DB/4_2/GGCUGC/4_2-GGCUGC.mcs
MCSYM-DB/4_2/GGCUGU/
MCSYM-DB/4_2/GGCUGU/4_2-GGCUGU.mcs
MCSYM-DB/4_2/GGCUGU/ds-4_2-GGCUGU_x.pdb.gz
MCSYM-DB/4_2/GGCUUC/
MCSYM-DB/4_2/GGCUUC/4_2-GGCUUC.mcs
MCSYM-DB/4_2/GGGAAG/
MCSYM-DB/4_2/GGGAAG/4_2-GGGAAG.mcs
MCSYM-DB/4_2/GGGAAG/ds-4_2-GGGAAG_x.pdb.gz
MCSYM-DB/4_2/GGGAGA/
MCSYM-DB/4_2/GGGAGA/4_2-GGGAGA.mcs
MCSYM-DB/4_2/GGGAGA/ds-4_2-GGGAGA_x.pdb.gz
MCSYM-DB/4_2/GGGAGC/
MCSYM-DB/4_2/GGGAGC/4_2-GGGAGC.mcs
MCSYM-DB/4_2/GGGAGC/ds-4_2-GGGAGC_x.pdb.gz
MCSYM-DB/4_2/GGGAUA/
MCSYM-DB/4_2/GGGAUA/4_2-GGGAUA.mcs
MCSYM-DB/4_2/GGGAUC/
MCSYM-DB/4_2/GGGAUC/4_2-GGGAUC.mcs
MCSYM-DB/4_2/GGGAUG/
MCSYM-DB/4_2/GGGAUG/4_2-GGGAUG.mcs
MCSYM-DB/4_2/GGGAUU/
MCSYM-DB/4_2/GGGAUU/4_2-GGGAUU.mcs
MCSYM-DB/4_2/GGGCCG/
MCSYM-DB/4_2/GGGCCG/4_2-GGGCCG.mcs
MCSYM-DB/4_2/GGGCCG/ds-4_2-GGGCCG_x.pdb.gz
MCSYM-DB/4_2/GGGCCU/
MCSYM-DB/4_2/GGGCCU/4_2-GGGCCU.mcs
MCSYM-DB/4_2/GGGCCU/ds-4_2-GGGCCU_x.pdb.gz
MCSYM-DB/4_2/GGGCGA/
MCSYM-DB/4_2/GGGCGA/4_2-GGGCGA.mcs
MCSYM-DB/4_2/GGGCGA/ds-4_2-GGGCGA_x.pdb.gz
MCSYM-DB/4_2/GGGCGC/
MCSYM-DB/4_2/GGGCGC/4_2-GGGCGC.mcs
MCSYM-DB/4_2/GGGCGG/
MCSYM-DB/4_2/GGGCGG/4_2-GGGCGG.mcs
MCSYM-DB/4_2/GGGCUC/
MCSYM-DB/4_2/GGGCUC/4_2-GGGCUC.mcs
MCSYM-DB/4_2/GGGCUC/ds-4_2-GGGCUC_x.pdb.gz
MCSYM-DB/4_2/GGGGAG/
MCSYM-DB/4_2/GGGGAG/4_2-GGGGAG.mcs
MCSYM-DB/4_2/GGGGAG/ds-4_2-GGGGAG_x.pdb.gz
MCSYM-DB/4_2/GGGGCA/
MCSYM-DB/4_2/GGGGCA/4_2-GGGGCA.mcs
MCSYM-DB/4_2/GGGGCC/
MCSYM-DB/4_2/GGGGCC/4_2-GGGGCC.mcs
MCSYM-DB/4_2/GGGGCG/
MCSYM-DB/4_2/GGGGCG/4_2-GGGGCG.mcs
MCSYM-DB/4_2/GGGGCG/ds-4_2-GGGGCG_x.pdb.gz
MCSYM-DB/4_2/GGGGCU/
MCSYM-DB/4_2/GGGGCU/4_2-GGGGCU.mcs
MCSYM-DB/4_2/GGGGGC/
MCSYM-DB/4_2/GGGGGC/4_2-GGGGGC.mcs
MCSYM-DB/4_2/GGGGUC/
MCSYM-DB/4_2/GGGGUC/4_2-GGGGUC.mcs
MCSYM-DB/4_2/GGGGUC/ds-4_2-GGGGUC_x.pdb.gz
MCSYM-DB/4_2/GGGUAC/
MCSYM-DB/4_2/GGGUAC/4_2-GGGUAC.mcs
MCSYM-DB/4_2/GGGUAG/
MCSYM-DB/4_2/GGGUAG/4_2-GGGUAG.mcs
MCSYM-DB/4_2/GGGUAG/ds-4_2-GGGUAG_x.pdb.gz
MCSYM-DB/4_2/GGGUAU/
MCSYM-DB/4_2/GGGUAU/4_2-GGGUAU.mcs
MCSYM-DB/4_2/GGGUGC/
MCSYM-DB/4_2/GGGUGC/4_2-GGGUGC.mcs
MCSYM-DB/4_2/GGGUGC/ds-4_2-GGGUGC_x.pdb.gz
MCSYM-DB/4_2/GGGUUC/
MCSYM-DB/4_2/GGGUUC/4_2-GGGUUC.mcs
MCSYM-DB/4_2/GGUACU/
MCSYM-DB/4_2/GGUACU/4_2-GGUACU.mcs
MCSYM-DB/4_2/GGUAUC/
MCSYM-DB/4_2/GGUAUC/4_2-GGUAUC.mcs
MCSYM-DB/4_2/GGUAUU/
MCSYM-DB/4_2/GGUAUU/4_2-GGUAUU.mcs
MCSYM-DB/4_2/GGUAUU/ds-4_2-GGUAUU_x.pdb.gz
MCSYM-DB/4_2/GGUCAC/
MCSYM-DB/4_2/GGUCAC/4_2-GGUCAC.mcs
MCSYM-DB/4_2/GGUCAG/
MCSYM-DB/4_2/GGUCAG/4_2-GGUCAG.mcs
MCSYM-DB/4_2/GGUCAG/ds-4_2-GGUCAG_x.pdb.gz
MCSYM-DB/4_2/GGUCAU/
MCSYM-DB/4_2/GGUCAU/4_2-GGUCAU.mcs
MCSYM-DB/4_2/GGUCCA/
MCSYM-DB/4_2/GGUCCA/4_2-GGUCCA.mcs
MCSYM-DB/4_2/GGUCCC/
MCSYM-DB/4_2/GGUCCC/4_2-GGUCCC.mcs
MCSYM-DB/4_2/GGUCCG/
MCSYM-DB/4_2/GGUCCG/4_2-GGUCCG.mcs
MCSYM-DB/4_2/GGUCCG/ds-4_2-GGUCCG_x.pdb.gz
MCSYM-DB/4_2/GGUCGA/
MCSYM-DB/4_2/GGUCGA/4_2-GGUCGA.mcs
MCSYM-DB/4_2/GGUCGC/
MCSYM-DB/4_2/GGUCGC/4_2-GGUCGC.mcs
MCSYM-DB/4_2/GGUCGC/ds-4_2-GGUCGC_x.pdb.gz
MCSYM-DB/4_2/GGUCGU/
MCSYM-DB/4_2/GGUCGU/4_2-GGUCGU.mcs
MCSYM-DB/4_2/GGUCGU/ds-4_2-GGUCGU_x.pdb.gz
MCSYM-DB/4_2/GGUCUC/
MCSYM-DB/4_2/GGUCUC/4_2-GGUCUC.mcs
MCSYM-DB/4_2/GGUCUU/
MCSYM-DB/4_2/GGUCUU/4_2-GGUCUU.mcs
MCSYM-DB/4_2/GGUGCC/
MCSYM-DB/4_2/GGUGCC/4_2-GGUGCC.mcs
MCSYM-DB/4_2/GGUGCC/ds-4_2-GGUGCC_x.pdb.gz
MCSYM-DB/4_2/GGUGCU/
MCSYM-DB/4_2/GGUGCU/4_2-GGUGCU.mcs
MCSYM-DB/4_2/GGUGCU/ds-4_2-GGUGCU_x.pdb.gz
MCSYM-DB/4_2/GGUGGC/
MCSYM-DB/4_2/GGUGGC/4_2-GGUGGC.mcs
MCSYM-DB/4_2/GGUGUA/
MCSYM-DB/4_2/GGUGUA/4_2-GGUGUA.mcs
MCSYM-DB/4_2/GGUGUC/
MCSYM-DB/4_2/GGUGUC/4_2-GGUGUC.mcs
MCSYM-DB/4_2/GGUGUC/ds-4_2-GGUGUC_x.pdb.gz
MCSYM-DB/4_2/GGUGUU/
MCSYM-DB/4_2/GGUGUU/4_2-GGUGUU.mcs
MCSYM-DB/4_2/GGUGUU/ds-4_2-GGUGUU_x.pdb.gz
MCSYM-DB/4_2/GGUUAC/
MCSYM-DB/4_2/GGUUAC/4_2-GGUUAC.mcs
MCSYM-DB/4_2/GGUUAC/ds-4_2-GGUUAC_x.pdb.gz
MCSYM-DB/4_2/GGUUCU/
MCSYM-DB/4_2/GGUUCU/4_2-GGUUCU.mcs
MCSYM-DB/4_2/GGUUGC/
MCSYM-DB/4_2/GGUUGC/4_2-GGUUGC.mcs
MCSYM-DB/4_2/GGUUGC/ds-4_2-GGUUGC_x.pdb.gz
MCSYM-DB/4_2/GGUUGU/
MCSYM-DB/4_2/GGUUGU/4_2-GGUUGU.mcs
MCSYM-DB/4_2/GGUUUC/
MCSYM-DB/4_2/GGUUUC/4_2-GGUUUC.mcs
MCSYM-DB/4_2/GGUUUG/
MCSYM-DB/4_2/GGUUUG/4_2-GGUUUG.mcs
MCSYM-DB/4_2/GUAAAC/
MCSYM-DB/4_2/GUAAAC/4_2-GUAAAC.mcs
MCSYM-DB/4_2/GUAAGC/
MCSYM-DB/4_2/GUAAGC/4_2-GUAAGC.mcs
MCSYM-DB/4_2/GUAAGG/
MCSYM-DB/4_2/GUAAGG/4_2-GUAAGG.mcs
MCSYM-DB/4_2/GUAAUA/
MCSYM-DB/4_2/GUAAUA/4_2-GUAAUA.mcs
MCSYM-DB/4_2/GUAAUC/
MCSYM-DB/4_2/GUAAUC/4_2-GUAAUC.mcs
MCSYM-DB/4_2/GUAAUC/ds-4_2-GUAAUC_x.pdb.gz
MCSYM-DB/4_2/GUAAUU/
MCSYM-DB/4_2/GUAAUU/4_2-GUAAUU.mcs
MCSYM-DB/4_2/GUACCC/
MCSYM-DB/4_2/GUACCC/4_2-GUACCC.mcs
MCSYM-DB/4_2/GUACGA/
MCSYM-DB/4_2/GUACGA/4_2-GUACGA.mcs
MCSYM-DB/4_2/GUACGC/
MCSYM-DB/4_2/GUACGC/4_2-GUACGC.mcs
MCSYM-DB/4_2/GUACGC/ds-4_2-GUACGC_x.pdb.gz
MCSYM-DB/4_2/GUACGU/
MCSYM-DB/4_2/GUACGU/4_2-GUACGU.mcs
MCSYM-DB/4_2/GUACGU/ds-4_2-GUACGU_x.pdb.gz
MCSYM-DB/4_2/GUACUC/
MCSYM-DB/4_2/GUACUC/4_2-GUACUC.mcs
MCSYM-DB/4_2/GUAGAC/
MCSYM-DB/4_2/GUAGAC/4_2-GUAGAC.mcs
MCSYM-DB/4_2/GUAGCA/
MCSYM-DB/4_2/GUAGCA/4_2-GUAGCA.mcs
MCSYM-DB/4_2/GUAGCA/ds-4_2-GUAGCA_x.pdb.gz
MCSYM-DB/4_2/GUAGCC/
MCSYM-DB/4_2/GUAGCC/4_2-GUAGCC.mcs
MCSYM-DB/4_2/GUAGCC/ds-4_2-GUAGCC_x.pdb.gz
MCSYM-DB/4_2/GUAGCU/
MCSYM-DB/4_2/GUAGCU/4_2-GUAGCU.mcs
MCSYM-DB/4_2/GUAGGC/
MCSYM-DB/4_2/GUAGGC/4_2-GUAGGC.mcs
MCSYM-DB/4_2/GUAGUA/
MCSYM-DB/4_2/GUAGUA/4_2-GUAGUA.mcs
MCSYM-DB/4_2/GUAGUC/
MCSYM-DB/4_2/GUAGUC/4_2-GUAGUC.mcs
MCSYM-DB/4_2/GUAGUC/ds-4_2-GUAGUC_x.pdb.gz
MCSYM-DB/4_2/GUAGUU/
MCSYM-DB/4_2/GUAGUU/4_2-GUAGUU.mcs
MCSYM-DB/4_2/GUAUAC/
MCSYM-DB/4_2/GUAUAC/4_2-GUAUAC.mcs
MCSYM-DB/4_2/GUAUAC/ds-4_2-GUAUAC_x.pdb.gz
MCSYM-DB/4_2/GUAUAU/
MCSYM-DB/4_2/GUAUAU/4_2-GUAUAU.mcs
MCSYM-DB/4_2/GUAUGC/
MCSYM-DB/4_2/GUAUGC/4_2-GUAUGC.mcs
MCSYM-DB/4_2/GUCAAU/
MCSYM-DB/4_2/GUCAAU/4_2-GUCAAU.mcs
MCSYM-DB/4_2/GUCACC/
MCSYM-DB/4_2/GUCACC/4_2-GUCACC.mcs
MCSYM-DB/4_2/GUCAGU/
MCSYM-DB/4_2/GUCAGU/4_2-GUCAGU.mcs
MCSYM-DB/4_2/GUCAUA/
MCSYM-DB/4_2/GUCAUA/4_2-GUCAUA.mcs
MCSYM-DB/4_2/GUCAUA/ds-4_2-GUCAUA_x.pdb.gz
MCSYM-DB/4_2/GUCAUC/
MCSYM-DB/4_2/GUCAUC/4_2-GUCAUC.mcs
MCSYM-DB/4_2/GUCAUC/ds-4_2-GUCAUC_x.pdb
MCSYM-DB/4_2/GUCAUC/ds-4_2-GUCAUC_x.pdb.gz
MCSYM-DB/4_2/GUCAUU/
MCSYM-DB/4_2/GUCAUU/4_2-GUCAUU.mcs
MCSYM-DB/4_2/GUCAUU/ds-4_2-GUCAUU_x.pdb.gz
MCSYM-DB/4_2/GUCCAA/
MCSYM-DB/4_2/GUCCAA/4_2-GUCCAA.mcs
MCSYM-DB/4_2/GUCCAA/ds-4_2-GUCCAA_x.pdb.gz
MCSYM-DB/4_2/GUCCAC/
MCSYM-DB/4_2/GUCCAC/4_2-GUCCAC.mcs
MCSYM-DB/4_2/GUCCCC/
MCSYM-DB/4_2/GUCCCC/4_2-GUCCCC.mcs
MCSYM-DB/4_2/GUCCCC/ds-4_2-GUCCCC_x.pdb.gz
MCSYM-DB/4_2/GUCCGC/
MCSYM-DB/4_2/GUCCGC/4_2-GUCCGC.mcs
MCSYM-DB/4_2/GUCCGC/ds-4_2-GUCCGC_x.pdb.gz
MCSYM-DB/4_2/GUCCGU/
MCSYM-DB/4_2/GUCCGU/4_2-GUCCGU.mcs
MCSYM-DB/4_2/GUCCGU/ds-4_2-GUCCGU_x.pdb.gz
MCSYM-DB/4_2/GUCCUC/
MCSYM-DB/4_2/GUCCUC/4_2-GUCCUC.mcs
MCSYM-DB/4_2/GUCGCA/
MCSYM-DB/4_2/GUCGCA/4_2-GUCGCA.mcs
MCSYM-DB/4_2/GUCGCA/ds-4_2-GUCGCA_x.pdb.gz
MCSYM-DB/4_2/GUCGCC/
MCSYM-DB/4_2/GUCGCC/4_2-GUCGCC.mcs
MCSYM-DB/4_2/GUCGCC/ds-4_2-GUCGCC_x.pdb.gz
MCSYM-DB/4_2/GUCGCU/
MCSYM-DB/4_2/GUCGCU/4_2-GUCGCU.mcs
MCSYM-DB/4_2/GUCGCU/ds-4_2-GUCGCU_x.pdb.gz
MCSYM-DB/4_2/GUCGGC/
MCSYM-DB/4_2/GUCGGC/4_2-GUCGGC.mcs
MCSYM-DB/4_2/GUCGUC/
MCSYM-DB/4_2/GUCGUC/4_2-GUCGUC.mcs
MCSYM-DB/4_2/GUCGUC/ds-4_2-GUCGUC_x.pdb.gz
MCSYM-DB/4_2/GUCGUU/
MCSYM-DB/4_2/GUCGUU/4_2-GUCGUU.mcs
MCSYM-DB/4_2/GUCGUU/ds-4_2-GUCGUU_x.pdb.gz
MCSYM-DB/4_2/GUCUAA/
MCSYM-DB/4_2/GUCUAA/4_2-GUCUAA.mcs
MCSYM-DB/4_2/GUCUAC/
MCSYM-DB/4_2/GUCUAC/4_2-GUCUAC.mcs
MCSYM-DB/4_2/GUCUAG/
MCSYM-DB/4_2/GUCUAG/4_2-GUCUAG.mcs
MCSYM-DB/4_2/GUCUCC/
MCSYM-DB/4_2/GUCUCC/4_2-GUCUCC.mcs
MCSYM-DB/4_2/GUCUCC/ds-4_2-GUCUCC_x.pdb.gz
MCSYM-DB/4_2/GUCUCU/
MCSYM-DB/4_2/GUCUCU/4_2-GUCUCU.mcs
MCSYM-DB/4_2/GUCUGA/
MCSYM-DB/4_2/GUCUGA/4_2-GUCUGA.mcs
MCSYM-DB/4_2/GUCUGC/
MCSYM-DB/4_2/GUCUGC/4_2-GUCUGC.mcs
MCSYM-DB/4_2/GUCUGC/ds-4_2-GUCUGC_x.pdb.gz
MCSYM-DB/4_2/GUCUUC/
MCSYM-DB/4_2/GUCUUC/4_2-GUCUUC.mcs
MCSYM-DB/4_2/GUCUUC/ds-4_2-GUCUUC_x.pdb.gz
MCSYM-DB/4_2/GUCUUU/
MCSYM-DB/4_2/GUCUUU/4_2-GUCUUU.mcs
MCSYM-DB/4_2/GUCUUU/ds-4_2-GUCUUU_x.pdb.gz
MCSYM-DB/4_2/GUGAAC/
MCSYM-DB/4_2/GUGAAC/4_2-GUGAAC.mcs
MCSYM-DB/4_2/GUGAAG/
MCSYM-DB/4_2/GUGAAG/4_2-GUGAAG.mcs
MCSYM-DB/4_2/GUGACA/
MCSYM-DB/4_2/GUGACA/4_2-GUGACA.mcs
MCSYM-DB/4_2/GUGACC/
MCSYM-DB/4_2/GUGACC/4_2-GUGACC.mcs
MCSYM-DB/4_2/GUGAGA/
MCSYM-DB/4_2/GUGAGA/4_2-GUGAGA.mcs
MCSYM-DB/4_2/GUGAUA/
MCSYM-DB/4_2/GUGAUA/4_2-GUGAUA.mcs
MCSYM-DB/4_2/GUGAUC/
MCSYM-DB/4_2/GUGAUC/4_2-GUGAUC.mcs
MCSYM-DB/4_2/GUGAUC/ds-4_2-GUGAUC_x.pdb.gz
MCSYM-DB/4_2/GUGAUG/
MCSYM-DB/4_2/GUGAUG/4_2-GUGAUG.mcs
MCSYM-DB/4_2/GUGAUG/ds-4_2-GUGAUG_x.pdb.gz
MCSYM-DB/4_2/GUGAUU/
MCSYM-DB/4_2/GUGAUU/4_2-GUGAUU.mcs
MCSYM-DB/4_2/GUGCAU/
MCSYM-DB/4_2/GUGCAU/4_2-GUGCAU.mcs
MCSYM-DB/4_2/GUGCCC/
MCSYM-DB/4_2/GUGCCC/4_2-GUGCCC.mcs
MCSYM-DB/4_2/GUGCGC/
MCSYM-DB/4_2/GUGCGC/4_2-GUGCGC.mcs
MCSYM-DB/4_2/GUGCGC/ds-4_2-GUGCGC_x.pdb.gz
MCSYM-DB/4_2/GUGCGG/
MCSYM-DB/4_2/GUGCGG/4_2-GUGCGG.mcs
MCSYM-DB/4_2/GUGCGU/
MCSYM-DB/4_2/GUGCGU/4_2-GUGCGU.mcs
MCSYM-DB/4_2/GUGCGU/ds-4_2-GUGCGU_x.pdb.gz
MCSYM-DB/4_2/GUGGCA/
MCSYM-DB/4_2/GUGGCA/4_2-GUGGCA.mcs
MCSYM-DB/4_2/GUGGCC/
MCSYM-DB/4_2/GUGGCC/4_2-GUGGCC.mcs
MCSYM-DB/4_2/GUGGCC/ds-4_2-GUGGCC_x.pdb.gz
MCSYM-DB/4_2/GUGGCU/
MCSYM-DB/4_2/GUGGCU/4_2-GUGGCU.mcs
MCSYM-DB/4_2/GUGGCU/ds-4_2-GUGGCU_x.pdb.gz
MCSYM-DB/4_2/GUGGGA/
MCSYM-DB/4_2/GUGGGA/4_2-GUGGGA.mcs
MCSYM-DB/4_2/GUGGGC/
MCSYM-DB/4_2/GUGGGC/4_2-GUGGGC.mcs
MCSYM-DB/4_2/GUGGGU/
MCSYM-DB/4_2/GUGGGU/4_2-GUGGGU.mcs
MCSYM-DB/4_2/GUGGGU/ds-4_2-GUGGGU_x.pdb.gz
MCSYM-DB/4_2/GUGGUC/
MCSYM-DB/4_2/GUGGUC/4_2-GUGGUC.mcs
MCSYM-DB/4_2/GUGGUC/ds-4_2-GUGGUC_x.pdb.gz
MCSYM-DB/4_2/GUGGUG/
MCSYM-DB/4_2/GUGGUG/4_2-GUGGUG.mcs
MCSYM-DB/4_2/GUGGUU/
MCSYM-DB/4_2/GUGGUU/4_2-GUGGUU.mcs
MCSYM-DB/4_2/GUGUAC/
MCSYM-DB/4_2/GUGUAC/4_2-GUGUAC.mcs
MCSYM-DB/4_2/GUGUAC/ds-4_2-GUGUAC_x.pdb.gz
MCSYM-DB/4_2/GUGUAG/
MCSYM-DB/4_2/GUGUAG/4_2-GUGUAG.mcs
MCSYM-DB/4_2/GUGUAU/
MCSYM-DB/4_2/GUGUAU/4_2-GUGUAU.mcs
MCSYM-DB/4_2/GUGUCC/
MCSYM-DB/4_2/GUGUCC/4_2-GUGUCC.mcs
MCSYM-DB/4_2/GUGUCC/ds-4_2-GUGUCC_x.pdb.gz
MCSYM-DB/4_2/GUGUCG/
MCSYM-DB/4_2/GUGUCG/4_2-GUGUCG.mcs
MCSYM-DB/4_2/GUGUGC/
MCSYM-DB/4_2/GUGUGC/4_2-GUGUGC.mcs
MCSYM-DB/4_2/GUGUGU/
MCSYM-DB/4_2/GUGUGU/4_2-GUGUGU.mcs
MCSYM-DB/4_2/GUGUUC/
MCSYM-DB/4_2/GUGUUC/4_2-GUGUUC.mcs
MCSYM-DB/4_2/GUGUUG/
MCSYM-DB/4_2/GUGUUG/4_2-GUGUUG.mcs
MCSYM-DB/4_2/GUGUUU/
MCSYM-DB/4_2/GUGUUU/4_2-GUGUUU.mcs
MCSYM-DB/4_2/GUUAAC/
MCSYM-DB/4_2/GUUAAC/4_2-GUUAAC.mcs
MCSYM-DB/4_2/GUUACC/
MCSYM-DB/4_2/GUUACC/4_2-GUUACC.mcs
MCSYM-DB/4_2/GUUAGC/
MCSYM-DB/4_2/GUUAGC/4_2-GUUAGC.mcs
MCSYM-DB/4_2/GUUAGG/
MCSYM-DB/4_2/GUUAGG/4_2-GUUAGG.mcs
MCSYM-DB/4_2/GUUAUC/
MCSYM-DB/4_2/GUUAUC/4_2-GUUAUC.mcs
MCSYM-DB/4_2/GUUAUC/ds-4_2-GUUAUC_x.pdb.gz
MCSYM-DB/4_2/GUUAUG/
MCSYM-DB/4_2/GUUAUG/4_2-GUUAUG.mcs
MCSYM-DB/4_2/GUUAUU/
MCSYM-DB/4_2/GUUAUU/4_2-GUUAUU.mcs
MCSYM-DB/4_2/GUUAUU/ds-4_2-GUUAUU_x.pdb.gz
MCSYM-DB/4_2/GUUCCC/
MCSYM-DB/4_2/GUUCCC/4_2-GUUCCC.mcs
MCSYM-DB/4_2/GUUCCC/ds-4_2-GUUCCC_x.pdb.gz
MCSYM-DB/4_2/GUUCGC/
MCSYM-DB/4_2/GUUCGC/4_2-GUUCGC.mcs
MCSYM-DB/4_2/GUUCGC/ds-4_2-GUUCGC_x.pdb.gz
MCSYM-DB/4_2/GUUCGU/
MCSYM-DB/4_2/GUUCGU/4_2-GUUCGU.mcs
MCSYM-DB/4_2/GUUCGU/ds-4_2-GUUCGU_x.pdb.gz
MCSYM-DB/4_2/GUUGAA/
MCSYM-DB/4_2/GUUGAA/4_2-GUUGAA.mcs
MCSYM-DB/4_2/GUUGCA/
MCSYM-DB/4_2/GUUGCA/4_2-GUUGCA.mcs
MCSYM-DB/4_2/GUUGCC/
MCSYM-DB/4_2/GUUGCC/4_2-GUUGCC.mcs
MCSYM-DB/4_2/GUUGCC/ds-4_2-GUUGCC_x.pdb.gz
MCSYM-DB/4_2/GUUGCG/
MCSYM-DB/4_2/GUUGCG/4_2-GUUGCG.mcs
MCSYM-DB/4_2/GUUGCG/ds-4_2-GUUGCG_x.pdb.gz
MCSYM-DB/4_2/GUUGCU/
MCSYM-DB/4_2/GUUGCU/4_2-GUUGCU.mcs
MCSYM-DB/4_2/GUUGCU/ds-4_2-GUUGCU_x.pdb.gz
MCSYM-DB/4_2/GUUGUC/
MCSYM-DB/4_2/GUUGUC/4_2-GUUGUC.mcs
MCSYM-DB/4_2/GUUGUC/ds-4_2-GUUGUC_x.pdb.gz
MCSYM-DB/4_2/GUUGUU/
MCSYM-DB/4_2/GUUGUU/4_2-GUUGUU.mcs
MCSYM-DB/4_2/GUUUAA/
MCSYM-DB/4_2/GUUUAA/4_2-GUUUAA.mcs
MCSYM-DB/4_2/GUUUAC/
MCSYM-DB/4_2/GUUUAC/4_2-GUUUAC.mcs
MCSYM-DB/4_2/GUUUAC/ds-4_2-GUUUAC_x.pdb.gz
MCSYM-DB/4_2/GUUUAU/
MCSYM-DB/4_2/GUUUAU/4_2-GUUUAU.mcs
MCSYM-DB/4_2/GUUUAU/ds-4_2-GUUUAU_x.pdb.gz
MCSYM-DB/4_2/GUUUCA/
MCSYM-DB/4_2/GUUUCA/4_2-GUUUCA.mcs
MCSYM-DB/4_2/GUUUGC/
MCSYM-DB/4_2/GUUUGC/4_2-GUUUGC.mcs
MCSYM-DB/4_2/GUUUUC/
MCSYM-DB/4_2/GUUUUC/4_2-GUUUUC.mcs
MCSYM-DB/4_2/GUUUUC/ds-4_2-GUUUUC_x.pdb.gz
MCSYM-DB/4_2/UAAAAA/
MCSYM-DB/4_2/UAAAAA/4_2-UAAAAA.mcs
MCSYM-DB/4_2/UAAAAA/ds-4_2-UAAAAA_x.pdb.gz
MCSYM-DB/4_2/UAAAAC/
MCSYM-DB/4_2/UAAAAC/4_2-UAAAAC.mcs
MCSYM-DB/4_2/UAAAAG/
MCSYM-DB/4_2/UAAAAG/4_2-UAAAAG.mcs
MCSYM-DB/4_2/UAAACA/
MCSYM-DB/4_2/UAAACA/4_2-UAAACA.mcs
MCSYM-DB/4_2/UAAACA/ds-4_2-UAAACA_x.pdb.gz
MCSYM-DB/4_2/UAAAGA/
MCSYM-DB/4_2/UAAAGA/4_2-UAAAGA.mcs
MCSYM-DB/4_2/UAAAGG/
MCSYM-DB/4_2/UAAAGG/4_2-UAAAGG.mcs
MCSYM-DB/4_2/UAAAUA/
MCSYM-DB/4_2/UAAAUA/4_2-UAAAUA.mcs
MCSYM-DB/4_2/UAAAUA/ds-4_2-UAAAUA_x.pdb.gz
MCSYM-DB/4_2/UAAAUC/
MCSYM-DB/4_2/UAAAUC/4_2-UAAAUC.mcs
MCSYM-DB/4_2/UAAAUC/ds-4_2-UAAAUC_x.pdb.gz
MCSYM-DB/4_2/UAAAUG/
MCSYM-DB/4_2/UAAAUG/4_2-UAAAUG.mcs
MCSYM-DB/4_2/UAAAUU/
MCSYM-DB/4_2/UAAAUU/4_2-UAAAUU.mcs
MCSYM-DB/4_2/UAACAA/
MCSYM-DB/4_2/UAACAA/4_2-UAACAA.mcs
MCSYM-DB/4_2/UAACGA/
MCSYM-DB/4_2/UAACGA/4_2-UAACGA.mcs
MCSYM-DB/4_2/UAACGA/ds-4_2-UAACGA_x.pdb.gz
MCSYM-DB/4_2/UAACGC/
MCSYM-DB/4_2/UAACGC/4_2-UAACGC.mcs
MCSYM-DB/4_2/UAACGC/ds-4_2-UAACGC_x.pdb.gz
MCSYM-DB/4_2/UAACGG/
MCSYM-DB/4_2/UAACGG/4_2-UAACGG.mcs
MCSYM-DB/4_2/UAACGG/ds-4_2-UAACGG_x.pdb.gz
MCSYM-DB/4_2/UAACGU/
MCSYM-DB/4_2/UAACGU/4_2-UAACGU.mcs
MCSYM-DB/4_2/UAAGAA/
MCSYM-DB/4_2/UAAGAA/4_2-UAAGAA.mcs
MCSYM-DB/4_2/UAAGAA/ds-4_2-UAAGAA_x.pdb.gz
MCSYM-DB/4_2/UAAGAG/
MCSYM-DB/4_2/UAAGAG/4_2-UAAGAG.mcs
MCSYM-DB/4_2/UAAGAU/
MCSYM-DB/4_2/UAAGAU/4_2-UAAGAU.mcs
MCSYM-DB/4_2/UAAGCA/
MCSYM-DB/4_2/UAAGCA/4_2-UAAGCA.mcs
MCSYM-DB/4_2/UAAGCA/ds-4_2-UAAGCA_x.pdb.gz
MCSYM-DB/4_2/UAAGCC/
MCSYM-DB/4_2/UAAGCC/4_2-UAAGCC.mcs
MCSYM-DB/4_2/UAAGCC/ds-4_2-UAAGCC_x.pdb.gz
MCSYM-DB/4_2/UAAGCG/
MCSYM-DB/4_2/UAAGCG/4_2-UAAGCG.mcs
MCSYM-DB/4_2/UAAGCG/ds-4_2-UAAGCG_x.pdb.gz
MCSYM-DB/4_2/UAAGCU/
MCSYM-DB/4_2/UAAGCU/4_2-UAAGCU.mcs
MCSYM-DB/4_2/UAAGCU/ds-4_2-UAAGCU_x.pdb.gz
MCSYM-DB/4_2/UAAGGA/
MCSYM-DB/4_2/UAAGGA/4_2-UAAGGA.mcs
MCSYM-DB/4_2/UAAGUA/
MCSYM-DB/4_2/UAAGUA/1KXK_model_1.pdb.gz
MCSYM-DB/4_2/UAAGUA/1L8V_model_1.pdb.gz
MCSYM-DB/4_2/UAAGUA/2ADT_model_1.pdb.gz
MCSYM-DB/4_2/UAAGUA/4_2-UAAGUA.mcs
MCSYM-DB/4_2/UAAGUA/ds-4_2-UAAGUA_x.pdb.gz
MCSYM-DB/4_2/UAAGUG/
MCSYM-DB/4_2/UAAGUG/4_2-UAAGUG.mcs
MCSYM-DB/4_2/UAAGUG/ds-4_2-UAAGUG_x.pdb.gz
MCSYM-DB/4_2/UAAUAA/
MCSYM-DB/4_2/UAAUAA/4_2-UAAUAA.mcs
MCSYM-DB/4_2/UAAUAA/ds-4_2-UAAUAA_x.pdb.gz
MCSYM-DB/4_2/UAAUAC/
MCSYM-DB/4_2/UAAUAC/4_2-UAAUAC.mcs
MCSYM-DB/4_2/UAAUAC/ds-4_2-UAAUAC_x.pdb.gz
MCSYM-DB/4_2/UAAUAG/
MCSYM-DB/4_2/UAAUAG/4_2-UAAUAG.mcs
MCSYM-DB/4_2/UAAUAG/ds-4_2-UAAUAG_x.pdb.gz
MCSYM-DB/4_2/UAAUCA/
MCSYM-DB/4_2/UAAUCA/4_2-UAAUCA.mcs
MCSYM-DB/4_2/UAAUCG/
MCSYM-DB/4_2/UAAUCG/4_2-UAAUCG.mcs
MCSYM-DB/4_2/UAAUCG/ds-4_2-UAAUCG_x.pdb.gz
MCSYM-DB/4_2/UAAUCU/
MCSYM-DB/4_2/UAAUCU/4_2-UAAUCU.mcs
MCSYM-DB/4_2/UAAUGA/
MCSYM-DB/4_2/UAAUGA/4_2-UAAUGA.mcs
MCSYM-DB/4_2/UAAUGA/ds-4_2-UAAUGA_x.pdb.gz
MCSYM-DB/4_2/UAAUGC/
MCSYM-DB/4_2/UAAUGC/4_2-UAAUGC.mcs
MCSYM-DB/4_2/UAAUGC/ds-4_2-UAAUGC_x.pdb.gz
MCSYM-DB/4_2/UAAUGG/
MCSYM-DB/4_2/UAAUGG/4_2-UAAUGG.mcs
MCSYM-DB/4_2/UAAUGU/
MCSYM-DB/4_2/UAAUGU/4_2-UAAUGU.mcs
MCSYM-DB/4_2/UAAUUA/
MCSYM-DB/4_2/UAAUUA/4_2-UAAUUA.mcs
MCSYM-DB/4_2/UACAAA/
MCSYM-DB/4_2/UACAAA/4_2-UACAAA.mcs
MCSYM-DB/4_2/UACAAA/ds-4_2-UACAAA_x.pdb.gz
MCSYM-DB/4_2/UACAAG/
MCSYM-DB/4_2/UACAAG/4_2-UACAAG.mcs
MCSYM-DB/4_2/UACAAG/ds-4_2-UACAAG_x.pdb.gz
MCSYM-DB/4_2/UACACA/
MCSYM-DB/4_2/UACACA/4_2-UACACA.mcs
MCSYM-DB/4_2/UACACA/ds-4_2-UACACA_x.pdb.gz
MCSYM-DB/4_2/UACACG/
MCSYM-DB/4_2/UACACG/4_2-UACACG.mcs
MCSYM-DB/4_2/UACACG/ds-4_2-UACACG_x.pdb.gz
MCSYM-DB/4_2/UACAUA/
MCSYM-DB/4_2/UACAUA/4_2-UACAUA.mcs
MCSYM-DB/4_2/UACAUA/ds-4_2-UACAUA_x.pdb.gz
MCSYM-DB/4_2/UACAUC/
MCSYM-DB/4_2/UACAUC/4_2-UACAUC.mcs
MCSYM-DB/4_2/UACAUG/
MCSYM-DB/4_2/UACAUG/4_2-UACAUG.mcs
MCSYM-DB/4_2/UACCAA/
MCSYM-DB/4_2/UACCAA/4_2-UACCAA.mcs
MCSYM-DB/4_2/UACCAC/
MCSYM-DB/4_2/UACCAC/4_2-UACCAC.mcs
MCSYM-DB/4_2/UACCCA/
MCSYM-DB/4_2/UACCCA/4_2-UACCCA.mcs
MCSYM-DB/4_2/UACCCA/ds-4_2-UACCCA_x.pdb.gz
MCSYM-DB/4_2/UACCCU/
MCSYM-DB/4_2/UACCCU/4_2-UACCCU.mcs
MCSYM-DB/4_2/UACCGA/
MCSYM-DB/4_2/UACCGA/1VQ7_model_1.pdb.gz
MCSYM-DB/4_2/UACCGA/4_2-UACCGA.mcs
MCSYM-DB/4_2/UACCGA/ds-4_2-UACCGA_x.pdb.gz
MCSYM-DB/4_2/UACCGC/
MCSYM-DB/4_2/UACCGC/4_2-UACCGC.mcs
MCSYM-DB/4_2/UACCGC/ds-4_2-UACCGC_x.pdb.gz
MCSYM-DB/4_2/UACCGG/
MCSYM-DB/4_2/UACCGG/4_2-UACCGG.mcs
MCSYM-DB/4_2/UACCUG/
MCSYM-DB/4_2/UACCUG/4_2-UACCUG.mcs
MCSYM-DB/4_2/UACCUU/
MCSYM-DB/4_2/UACCUU/4_2-UACCUU.mcs
MCSYM-DB/4_2/UACGCA/
MCSYM-DB/4_2/UACGCA/4_2-UACGCA.mcs
MCSYM-DB/4_2/UACGCA/ds-4_2-UACGCA_x.pdb.gz
MCSYM-DB/4_2/UACGCU/
MCSYM-DB/4_2/UACGCU/4_2-UACGCU.mcs
MCSYM-DB/4_2/UACGUA/
MCSYM-DB/4_2/UACGUA/4_2-UACGUA.mcs
MCSYM-DB/4_2/UACGUA/ds-4_2-UACGUA_x.pdb.gz
MCSYM-DB/4_2/UACGUG/
MCSYM-DB/4_2/UACGUG/4_2-UACGUG.mcs
MCSYM-DB/4_2/UACUAA/
MCSYM-DB/4_2/UACUAA/4_2-UACUAA.mcs
MCSYM-DB/4_2/UACUAA/ds-4_2-UACUAA_x.pdb.gz
MCSYM-DB/4_2/UACUAC/
MCSYM-DB/4_2/UACUAC/4_2-UACUAC.mcs
MCSYM-DB/4_2/UACUAC/ds-4_2-UACUAC_x.pdb.gz
MCSYM-DB/4_2/UACUAG/
MCSYM-DB/4_2/UACUAG/4_2-UACUAG.mcs
MCSYM-DB/4_2/UACUAU/
MCSYM-DB/4_2/UACUAU/4_2-UACUAU.mcs
MCSYM-DB/4_2/UACUAU/ds-4_2-UACUAU_x.pdb.gz
MCSYM-DB/4_2/UACUCA/
MCSYM-DB/4_2/UACUCA/4_2-UACUCA.mcs
MCSYM-DB/4_2/UACUGA/
MCSYM-DB/4_2/UACUGA/4_2-UACUGA.mcs
MCSYM-DB/4_2/UACUGC/
MCSYM-DB/4_2/UACUGC/4_2-UACUGC.mcs
MCSYM-DB/4_2/UACUGC/ds-4_2-UACUGC_x.pdb.gz
MCSYM-DB/4_2/UACUUA/
MCSYM-DB/4_2/UACUUA/4_2-UACUUA.mcs
MCSYM-DB/4_2/UACUUG/
MCSYM-DB/4_2/UACUUG/4_2-UACUUG.mcs
MCSYM-DB/4_2/UAGAAA/
MCSYM-DB/4_2/UAGAAA/4_2-UAGAAA.mcs
MCSYM-DB/4_2/UAGAAA/ds-4_2-UAGAAA_x.pdb.gz
MCSYM-DB/4_2/UAGAAU/
MCSYM-DB/4_2/UAGAAU/4_2-UAGAAU.mcs
MCSYM-DB/4_2/UAGAGA/
MCSYM-DB/4_2/UAGAGA/4_2-UAGAGA.mcs
MCSYM-DB/4_2/UAGAUA/
MCSYM-DB/4_2/UAGAUA/4_2-UAGAUA.mcs
MCSYM-DB/4_2/UAGAUA/ds-4_2-UAGAUA_x.pdb.gz
MCSYM-DB/4_2/UAGAUG/
MCSYM-DB/4_2/UAGAUG/4_2-UAGAUG.mcs
MCSYM-DB/4_2/UAGAUG/ds-4_2-UAGAUG_x.pdb.gz
MCSYM-DB/4_2/UAGAUU/
MCSYM-DB/4_2/UAGAUU/4_2-UAGAUU.mcs
MCSYM-DB/4_2/UAGCGA/
MCSYM-DB/4_2/UAGCGA/4_2-UAGCGA.mcs
MCSYM-DB/4_2/UAGCGA/ds-4_2-UAGCGA_x.pdb.gz
MCSYM-DB/4_2/UAGCGC/
MCSYM-DB/4_2/UAGCGC/4_2-UAGCGC.mcs
MCSYM-DB/4_2/UAGCGG/
MCSYM-DB/4_2/UAGCGG/4_2-UAGCGG.mcs
MCSYM-DB/4_2/UAGCGG/ds-4_2-UAGCGG_x.pdb.gz
MCSYM-DB/4_2/UAGCGU/
MCSYM-DB/4_2/UAGCGU/4_2-UAGCGU.mcs
MCSYM-DB/4_2/UAGCUC/
MCSYM-DB/4_2/UAGCUC/4_2-UAGCUC.mcs
MCSYM-DB/4_2/UAGCUC/ds-4_2-UAGCUC_x.pdb.gz
MCSYM-DB/4_2/UAGGCA/
MCSYM-DB/4_2/UAGGCA/4_2-UAGGCA.mcs
MCSYM-DB/4_2/UAGGCA/ds-4_2-UAGGCA_x.pdb.gz
MCSYM-DB/4_2/UAGGCG/
MCSYM-DB/4_2/UAGGCG/4_2-UAGGCG.mcs
MCSYM-DB/4_2/UAGGCG/ds-4_2-UAGGCG_x.pdb.gz
MCSYM-DB/4_2/UAGGCU/
MCSYM-DB/4_2/UAGGCU/4_2-UAGGCU.mcs
MCSYM-DB/4_2/UAGGGA/
MCSYM-DB/4_2/UAGGGA/4_2-UAGGGA.mcs
MCSYM-DB/4_2/UAGGUA/
MCSYM-DB/4_2/UAGGUA/4_2-UAGGUA.mcs
MCSYM-DB/4_2/UAGGUA/ds-4_2-UAGGUA_x.pdb.gz
MCSYM-DB/4_2/UAGGUG/
MCSYM-DB/4_2/UAGGUG/4_2-UAGGUG.mcs
MCSYM-DB/4_2/UAGGUG/ds-4_2-UAGGUG_x.pdb.gz
MCSYM-DB/4_2/UAGUAA/
MCSYM-DB/4_2/UAGUAA/4_2-UAGUAA.mcs
MCSYM-DB/4_2/UAGUAA/ds-4_2-UAGUAA_x.pdb.gz
MCSYM-DB/4_2/UAGUAC/
MCSYM-DB/4_2/UAGUAC/4_2-UAGUAC.mcs
MCSYM-DB/4_2/UAGUAC/ds-4_2-UAGUAC_x.pdb.gz
MCSYM-DB/4_2/UAGUAG/
MCSYM-DB/4_2/UAGUAG/4_2-UAGUAG.mcs
MCSYM-DB/4_2/UAGUAG/ds-4_2-UAGUAG_x.pdb.gz
MCSYM-DB/4_2/UAGUCA/
MCSYM-DB/4_2/UAGUCA/4_2-UAGUCA.mcs
MCSYM-DB/4_2/UAGUCC/
MCSYM-DB/4_2/UAGUCC/4_2-UAGUCC.mcs
MCSYM-DB/4_2/UAGUCU/
MCSYM-DB/4_2/UAGUCU/4_2-UAGUCU.mcs
MCSYM-DB/4_2/UAGUGA/
MCSYM-DB/4_2/UAGUGA/4_2-UAGUGA.mcs
MCSYM-DB/4_2/UAGUGG/
MCSYM-DB/4_2/UAGUGG/4_2-UAGUGG.mcs
MCSYM-DB/4_2/UAGUGG/ds-4_2-UAGUGG_x.pdb.gz
MCSYM-DB/4_2/UAGUUA/
MCSYM-DB/4_2/UAGUUA/4_2-UAGUUA.mcs
MCSYM-DB/4_2/UAGUUG/
MCSYM-DB/4_2/UAGUUG/4_2-UAGUUG.mcs
MCSYM-DB/4_2/UAUAAA/
MCSYM-DB/4_2/UAUAAA/4_2-UAUAAA.mcs
MCSYM-DB/4_2/UAUAAA/ds-4_2-UAUAAA_x.pdb.gz
MCSYM-DB/4_2/UAUAGA/
MCSYM-DB/4_2/UAUAGA/4_2-UAUAGA.mcs
MCSYM-DB/4_2/UAUAUA/
MCSYM-DB/4_2/UAUAUA/4_2-UAUAUA.mcs
MCSYM-DB/4_2/UAUAUA/ds-4_2-UAUAUA_x.pdb.gz
MCSYM-DB/4_2/UAUAUG/
MCSYM-DB/4_2/UAUAUG/4_2-UAUAUG.mcs
MCSYM-DB/4_2/UAUAUG/ds-4_2-UAUAUG_x.pdb.gz
MCSYM-DB/4_2/UAUCAA/
MCSYM-DB/4_2/UAUCAA/4_2-UAUCAA.mcs
MCSYM-DB/4_2/UAUCGA/
MCSYM-DB/4_2/UAUCGA/4_2-UAUCGA.mcs
MCSYM-DB/4_2/UAUCGC/
MCSYM-DB/4_2/UAUCGC/4_2-UAUCGC.mcs
MCSYM-DB/4_2/UAUCGC/ds-4_2-UAUCGC_x.pdb.gz
MCSYM-DB/4_2/UAUCGG/
MCSYM-DB/4_2/UAUCGG/4_2-UAUCGG.mcs
MCSYM-DB/4_2/UAUCGG/ds-4_2-UAUCGG_x.pdb.gz
MCSYM-DB/4_2/UAUCGU/
MCSYM-DB/4_2/UAUCGU/4_2-UAUCGU.mcs
MCSYM-DB/4_2/UAUCGU/ds-4_2-UAUCGU_x.pdb.gz
MCSYM-DB/4_2/UAUGAA/
MCSYM-DB/4_2/UAUGAA/4_2-UAUGAA.mcs
MCSYM-DB/4_2/UAUGCA/
MCSYM-DB/4_2/UAUGCA/4_2-UAUGCA.mcs
MCSYM-DB/4_2/UAUGCA/ds-4_2-UAUGCA_x.pdb.gz
MCSYM-DB/4_2/UAUGCG/
MCSYM-DB/4_2/UAUGCG/4_2-UAUGCG.mcs
MCSYM-DB/4_2/UAUGCG/ds-4_2-UAUGCG_x.pdb.gz
MCSYM-DB/4_2/UAUGCU/
MCSYM-DB/4_2/UAUGCU/4_2-UAUGCU.mcs
MCSYM-DB/4_2/UAUGCU/ds-4_2-UAUGCU_x.pdb.gz
MCSYM-DB/4_2/UAUGUA/
MCSYM-DB/4_2/UAUGUA/4_2-UAUGUA.mcs
MCSYM-DB/4_2/UAUGUC/
MCSYM-DB/4_2/UAUGUC/4_2-UAUGUC.mcs
MCSYM-DB/4_2/UAUGUG/
MCSYM-DB/4_2/UAUGUG/4_2-UAUGUG.mcs
MCSYM-DB/4_2/UAUGUU/
MCSYM-DB/4_2/UAUGUU/4_2-UAUGUU.mcs
MCSYM-DB/4_2/UAUUAA/
MCSYM-DB/4_2/UAUUAA/4_2-UAUUAA.mcs
MCSYM-DB/4_2/UAUUAA/ds-4_2-UAUUAA_x.pdb.gz
MCSYM-DB/4_2/UAUUAG/
MCSYM-DB/4_2/UAUUAG/4_2-UAUUAG.mcs
MCSYM-DB/4_2/UAUUAG/ds-4_2-UAUUAG_x.pdb.gz
MCSYM-DB/4_2/UAUUAU/
MCSYM-DB/4_2/UAUUAU/4_2-UAUUAU.mcs
MCSYM-DB/4_2/UAUUAU/ds-4_2-UAUUAU_x.pdb.gz
MCSYM-DB/4_2/UAUUCA/
MCSYM-DB/4_2/UAUUCA/4_2-UAUUCA.mcs
MCSYM-DB/4_2/UAUUGA/
MCSYM-DB/4_2/UAUUGA/4_2-UAUUGA.mcs
MCSYM-DB/4_2/UAUUGU/
MCSYM-DB/4_2/UAUUGU/4_2-UAUUGU.mcs
MCSYM-DB/4_2/UAUUUA/
MCSYM-DB/4_2/UAUUUA/4_2-UAUUUA.mcs
MCSYM-DB/4_2/UAUUUG/
MCSYM-DB/4_2/UAUUUG/4_2-UAUUUG.mcs
MCSYM-DB/4_2/UAUUUU/
MCSYM-DB/4_2/UAUUUU/4_2-UAUUUU.mcs
MCSYM-DB/4_2/UCAAAA/
MCSYM-DB/4_2/UCAAAA/4_2-UCAAAA.mcs
MCSYM-DB/4_2/UCAAAA/ds-4_2-UCAAAA_x.pdb.gz
MCSYM-DB/4_2/UCAAAC/
MCSYM-DB/4_2/UCAAAC/4_2-UCAAAC.mcs
MCSYM-DB/4_2/UCAAAC/ds-4_2-UCAAAC_x.pdb.gz
MCSYM-DB/4_2/UCAAAG/
MCSYM-DB/4_2/UCAAAG/4_2-UCAAAG.mcs
MCSYM-DB/4_2/UCAAAG/ds-4_2-UCAAAG_x.pdb.gz
MCSYM-DB/4_2/UCAACA/
MCSYM-DB/4_2/UCAACA/4_2-UCAACA.mcs
MCSYM-DB/4_2/UCAAGA/
MCSYM-DB/4_2/UCAAGA/4_2-UCAAGA.mcs
MCSYM-DB/4_2/UCAAUA/
MCSYM-DB/4_2/UCAAUA/4_2-UCAAUA.mcs
MCSYM-DB/4_2/UCAAUA/ds-4_2-UCAAUA_x.pdb.gz
MCSYM-DB/4_2/UCAAUC/
MCSYM-DB/4_2/UCAAUC/4_2-UCAAUC.mcs
MCSYM-DB/4_2/UCAAUG/
MCSYM-DB/4_2/UCAAUG/4_2-UCAAUG.mcs
MCSYM-DB/4_2/UCAAUG/ds-4_2-UCAAUG_x.pdb.gz
MCSYM-DB/4_2/UCACAA/
MCSYM-DB/4_2/UCACAA/4_2-UCACAA.mcs
MCSYM-DB/4_2/UCACAU/
MCSYM-DB/4_2/UCACAU/4_2-UCACAU.mcs
MCSYM-DB/4_2/UCACCA/
MCSYM-DB/4_2/UCACCA/4_2-UCACCA.mcs
MCSYM-DB/4_2/UCACCU/
MCSYM-DB/4_2/UCACCU/4_2-UCACCU.mcs
MCSYM-DB/4_2/UCACGA/
MCSYM-DB/4_2/UCACGA/4_2-UCACGA.mcs
MCSYM-DB/4_2/UCACGC/
MCSYM-DB/4_2/UCACGC/4_2-UCACGC.mcs
MCSYM-DB/4_2/UCACGG/
MCSYM-DB/4_2/UCACGG/4_2-UCACGG.mcs
MCSYM-DB/4_2/UCACGG/ds-4_2-UCACGG_x.pdb.gz
MCSYM-DB/4_2/UCACGU/
MCSYM-DB/4_2/UCACGU/4_2-UCACGU.mcs
MCSYM-DB/4_2/UCACUA/
MCSYM-DB/4_2/UCACUA/4_2-UCACUA.mcs
MCSYM-DB/4_2/UCACUC/
MCSYM-DB/4_2/UCACUC/4_2-UCACUC.mcs
MCSYM-DB/4_2/UCACUU/
MCSYM-DB/4_2/UCACUU/4_2-UCACUU.mcs
MCSYM-DB/4_2/UCACUU/ds-4_2-UCACUU_x.pdb.gz
MCSYM-DB/4_2/UCAGAA/
MCSYM-DB/4_2/UCAGAA/4_2-UCAGAA.mcs
MCSYM-DB/4_2/UCAGAC/
MCSYM-DB/4_2/UCAGAC/4_2-UCAGAC.mcs
MCSYM-DB/4_2/UCAGCA/
MCSYM-DB/4_2/UCAGCA/4_2-UCAGCA.mcs
MCSYM-DB/4_2/UCAGCA/ds-4_2-UCAGCA_x.pdb.gz
MCSYM-DB/4_2/UCAGCC/
MCSYM-DB/4_2/UCAGCC/4_2-UCAGCC.mcs
MCSYM-DB/4_2/UCAGCC/ds-4_2-UCAGCC_x.pdb.gz
MCSYM-DB/4_2/UCAGCG/
MCSYM-DB/4_2/UCAGCG/4_2-UCAGCG.mcs
MCSYM-DB/4_2/UCAGCU/
MCSYM-DB/4_2/UCAGCU/4_2-UCAGCU.mcs
MCSYM-DB/4_2/UCAGGA/
MCSYM-DB/4_2/UCAGGA/4_2-UCAGGA.mcs
MCSYM-DB/4_2/UCAGGC/
MCSYM-DB/4_2/UCAGGC/4_2-UCAGGC.mcs
MCSYM-DB/4_2/UCAGUA/
MCSYM-DB/4_2/UCAGUA/4_2-UCAGUA.mcs
MCSYM-DB/4_2/UCAGUA/ds-4_2-UCAGUA_x.pdb.gz
MCSYM-DB/4_2/UCAGUC/
MCSYM-DB/4_2/UCAGUC/4_2-UCAGUC.mcs
MCSYM-DB/4_2/UCAGUC/ds-4_2-UCAGUC_x.pdb.gz
MCSYM-DB/4_2/UCAGUG/
MCSYM-DB/4_2/UCAGUG/4_2-UCAGUG.mcs
MCSYM-DB/4_2/UCAGUG/ds-4_2-UCAGUG_x.pdb.gz
MCSYM-DB/4_2/UCAUAA/
MCSYM-DB/4_2/UCAUAA/4_2-UCAUAA.mcs
MCSYM-DB/4_2/UCAUAA/ds-4_2-UCAUAA_x.pdb.gz
MCSYM-DB/4_2/UCAUAG/
MCSYM-DB/4_2/UCAUAG/4_2-UCAUAG.mcs
MCSYM-DB/4_2/UCAUAG/ds-4_2-UCAUAG_x.pdb.gz
MCSYM-DB/4_2/UCAUCA/
MCSYM-DB/4_2/UCAUCA/4_2-UCAUCA.mcs
MCSYM-DB/4_2/UCAUCC/
MCSYM-DB/4_2/UCAUCC/4_2-UCAUCC.mcs
MCSYM-DB/4_2/UCAUCC/ds-4_2-UCAUCC_x.pdb.gz
MCSYM-DB/4_2/UCAUCG/
MCSYM-DB/4_2/UCAUCG/4_2-UCAUCG.mcs
MCSYM-DB/4_2/UCAUCG/ds-4_2-UCAUCG_x.pdb.gz
MCSYM-DB/4_2/UCAUGA/
MCSYM-DB/4_2/UCAUGA/4_2-UCAUGA.mcs
MCSYM-DB/4_2/UCAUUA/
MCSYM-DB/4_2/UCAUUA/4_2-UCAUUA.mcs
MCSYM-DB/4_2/UCAUUG/
MCSYM-DB/4_2/UCAUUG/4_2-UCAUUG.mcs
MCSYM-DB/4_2/UCCAAA/
MCSYM-DB/4_2/UCCAAA/4_2-UCCAAA.mcs
MCSYM-DB/4_2/UCCAAA/ds-4_2-UCCAAA_x.pdb.gz
MCSYM-DB/4_2/UCCAAG/
MCSYM-DB/4_2/UCCAAG/4_2-UCCAAG.mcs
MCSYM-DB/4_2/UCCAAG/ds-4_2-UCCAAG_x.pdb.gz
MCSYM-DB/4_2/UCCAAU/
MCSYM-DB/4_2/UCCAAU/4_2-UCCAAU.mcs
MCSYM-DB/4_2/UCCAAU/ds-4_2-UCCAAU_x.pdb.gz
MCSYM-DB/4_2/UCCACA/
MCSYM-DB/4_2/UCCACA/4_2-UCCACA.mcs
MCSYM-DB/4_2/UCCACA/ds-4_2-UCCACA_x.pdb.gz
MCSYM-DB/4_2/UCCACG/
MCSYM-DB/4_2/UCCACG/4_2-UCCACG.mcs
MCSYM-DB/4_2/UCCAGC/
MCSYM-DB/4_2/UCCAGC/4_2-UCCAGC.mcs
MCSYM-DB/4_2/UCCAGC/ds-4_2-UCCAGC_x.pdb.gz
MCSYM-DB/4_2/UCCAUA/
MCSYM-DB/4_2/UCCAUA/4_2-UCCAUA.mcs
MCSYM-DB/4_2/UCCAUA/ds-4_2-UCCAUA_x.pdb.gz
MCSYM-DB/4_2/UCCAUC/
MCSYM-DB/4_2/UCCAUC/4_2-UCCAUC.mcs
MCSYM-DB/4_2/UCCAUC/ds-4_2-UCCAUC_x.pdb.gz
MCSYM-DB/4_2/UCCAUG/
MCSYM-DB/4_2/UCCAUG/4_2-UCCAUG.mcs
MCSYM-DB/4_2/UCCAUU/
MCSYM-DB/4_2/UCCAUU/4_2-UCCAUU.mcs
MCSYM-DB/4_2/UCCAUU/ds-4_2-UCCAUU_x.pdb.gz
MCSYM-DB/4_2/UCCCAC/
MCSYM-DB/4_2/UCCCAC/4_2-UCCCAC.mcs
MCSYM-DB/4_2/UCCCAC/ds-4_2-UCCCAC_x.pdb.gz
MCSYM-DB/4_2/UCCCCA/
MCSYM-DB/4_2/UCCCCA/4_2-UCCCCA.mcs
MCSYM-DB/4_2/UCCCCA/ds-4_2-UCCCCA_x.pdb.gz
MCSYM-DB/4_2/UCCCCC/
MCSYM-DB/4_2/UCCCCC/4_2-UCCCCC.mcs
MCSYM-DB/4_2/UCCCCC/ds-4_2-UCCCCC_x.pdb.gz
MCSYM-DB/4_2/UCCCGA/
MCSYM-DB/4_2/UCCCGA/4_2-UCCCGA.mcs
MCSYM-DB/4_2/UCCCGC/
MCSYM-DB/4_2/UCCCGC/4_2-UCCCGC.mcs
MCSYM-DB/4_2/UCCCGC/ds-4_2-UCCCGC_x.pdb.gz
MCSYM-DB/4_2/UCCCGG/
MCSYM-DB/4_2/UCCCGG/4_2-UCCCGG.mcs
MCSYM-DB/4_2/UCCCGU/
MCSYM-DB/4_2/UCCCGU/4_2-UCCCGU.mcs
MCSYM-DB/4_2/UCCCGU/ds-4_2-UCCCGU_x.pdb.gz
MCSYM-DB/4_2/UCCCUA/
MCSYM-DB/4_2/UCCCUA/4_2-UCCCUA.mcs
MCSYM-DB/4_2/UCCCUA/ds-4_2-UCCCUA_x.pdb.gz
MCSYM-DB/4_2/UCCCUU/
MCSYM-DB/4_2/UCCCUU/4_2-UCCCUU.mcs
MCSYM-DB/4_2/UCCCUU/ds-4_2-UCCCUU_x.pdb.gz
MCSYM-DB/4_2/UCCGAA/
MCSYM-DB/4_2/UCCGAA/4_2-UCCGAA.mcs
MCSYM-DB/4_2/UCCGAA/ds-4_2-UCCGAA_x.pdb.gz
MCSYM-DB/4_2/UCCGCA/
MCSYM-DB/4_2/UCCGCA/4_2-UCCGCA.mcs
MCSYM-DB/4_2/UCCGCA/ds-4_2-UCCGCA_x.pdb.gz
MCSYM-DB/4_2/UCCGCU/
MCSYM-DB/4_2/UCCGCU/4_2-UCCGCU.mcs
MCSYM-DB/4_2/UCCGCU/ds-4_2-UCCGCU_x.pdb.gz
MCSYM-DB/4_2/UCCGUA/
MCSYM-DB/4_2/UCCGUA/4_2-UCCGUA.mcs
MCSYM-DB/4_2/UCCGUA/ds-4_2-UCCGUA_x.pdb.gz
MCSYM-DB/4_2/UCCUAA/
MCSYM-DB/4_2/UCCUAA/4_2-UCCUAA.mcs
MCSYM-DB/4_2/UCCUAA/ds-4_2-UCCUAA_x.pdb.gz
MCSYM-DB/4_2/UCCUAC/
MCSYM-DB/4_2/UCCUAC/4_2-UCCUAC.mcs
MCSYM-DB/4_2/UCCUAC/ds-4_2-UCCUAC_x.pdb.gz
MCSYM-DB/4_2/UCCUAU/
MCSYM-DB/4_2/UCCUAU/4_2-UCCUAU.mcs
MCSYM-DB/4_2/UCCUAU/ds-4_2-UCCUAU_x.pdb.gz
MCSYM-DB/4_2/UCCUCA/
MCSYM-DB/4_2/UCCUCA/4_2-UCCUCA.mcs
MCSYM-DB/4_2/UCCUCA/ds-4_2-UCCUCA_x.pdb.gz
MCSYM-DB/4_2/UCCUCU/
MCSYM-DB/4_2/UCCUCU/4_2-UCCUCU.mcs
MCSYM-DB/4_2/UCCUCU/ds-4_2-UCCUCU_x.pdb.gz
MCSYM-DB/4_2/UCCUGA/
MCSYM-DB/4_2/UCCUGA/4_2-UCCUGA.mcs
MCSYM-DB/4_2/UCCUGA/ds-4_2-UCCUGA_x.pdb.gz
MCSYM-DB/4_2/UCCUGG/
MCSYM-DB/4_2/UCCUGG/4_2-UCCUGG.mcs
MCSYM-DB/4_2/UCCUUA/
MCSYM-DB/4_2/UCCUUA/4_2-UCCUUA.mcs
MCSYM-DB/4_2/UCCUUA/ds-4_2-UCCUUA_x.pdb.gz
MCSYM-DB/4_2/UCCUUG/
MCSYM-DB/4_2/UCCUUG/4_2-UCCUUG.mcs
MCSYM-DB/4_2/UCCUUU/
MCSYM-DB/4_2/UCCUUU/4_2-UCCUUU.mcs
MCSYM-DB/4_2/UCCUUU/ds-4_2-UCCUUU_x.pdb.gz
MCSYM-DB/4_2/UCGAAA/
MCSYM-DB/4_2/UCGAAA/4_2-UCGAAA.mcs
MCSYM-DB/4_2/UCGAAA/ds-4_2-UCGAAA_x.pdb.gz
MCSYM-DB/4_2/UCGAUG/
MCSYM-DB/4_2/UCGAUG/4_2-UCGAUG.mcs
MCSYM-DB/4_2/UCGAUG/ds-4_2-UCGAUG_x.pdb.gz
MCSYM-DB/4_2/UCGCCC/
MCSYM-DB/4_2/UCGCCC/4_2-UCGCCC.mcs
MCSYM-DB/4_2/UCGCCC/ds-4_2-UCGCCC_x.pdb.gz
MCSYM-DB/4_2/UCGCGA/
MCSYM-DB/4_2/UCGCGA/4_2-UCGCGA.mcs
MCSYM-DB/4_2/UCGCGC/
MCSYM-DB/4_2/UCGCGC/4_2-UCGCGC.mcs
MCSYM-DB/4_2/UCGCGG/
MCSYM-DB/4_2/UCGCGG/4_2-UCGCGG.mcs
MCSYM-DB/4_2/UCGGAG/
MCSYM-DB/4_2/UCGGAG/4_2-UCGGAG.mcs
MCSYM-DB/4_2/UCGGAG/ds-4_2-UCGGAG_x.pdb.gz
MCSYM-DB/4_2/UCGGCA/
MCSYM-DB/4_2/UCGGCA/4_2-UCGGCA.mcs
MCSYM-DB/4_2/UCGGCA/ds-4_2-UCGGCA_x.pdb.gz
MCSYM-DB/4_2/UCGGCU/
MCSYM-DB/4_2/UCGGCU/4_2-UCGGCU.mcs
MCSYM-DB/4_2/UCGGUA/
MCSYM-DB/4_2/UCGGUA/4_2-UCGGUA.mcs
MCSYM-DB/4_2/UCGGUU/
MCSYM-DB/4_2/UCGGUU/4_2-UCGGUU.mcs
MCSYM-DB/4_2/UCGUAA/
MCSYM-DB/4_2/UCGUAA/4_2-UCGUAA.mcs
MCSYM-DB/4_2/UCGUAA/ds-4_2-UCGUAA_x.pdb.gz
MCSYM-DB/4_2/UCGUCC/
MCSYM-DB/4_2/UCGUCC/4_2-UCGUCC.mcs
MCSYM-DB/4_2/UCGUCC/ds-4_2-UCGUCC_x.pdb.gz
MCSYM-DB/4_2/UCGUGC/
MCSYM-DB/4_2/UCGUGC/4_2-UCGUGC.mcs
MCSYM-DB/4_2/UCGUGC/ds-4_2-UCGUGC_x.pdb.gz
MCSYM-DB/4_2/UCGUUA/
MCSYM-DB/4_2/UCGUUA/4_2-UCGUUA.mcs
MCSYM-DB/4_2/UCGUUA/ds-4_2-UCGUUA_x.pdb.gz
MCSYM-DB/4_2/UCUAAA/
MCSYM-DB/4_2/UCUAAA/4_2-UCUAAA.mcs
MCSYM-DB/4_2/UCUAAA/ds-4_2-UCUAAA_x.pdb.gz
MCSYM-DB/4_2/UCUACC/
MCSYM-DB/4_2/UCUACC/4_2-UCUACC.mcs
MCSYM-DB/4_2/UCUACU/
MCSYM-DB/4_2/UCUACU/4_2-UCUACU.mcs
MCSYM-DB/4_2/UCUACU/ds-4_2-UCUACU_x.pdb.gz
MCSYM-DB/4_2/UCUAGU/
MCSYM-DB/4_2/UCUAGU/4_2-UCUAGU.mcs
MCSYM-DB/4_2/UCUAUA/
MCSYM-DB/4_2/UCUAUA/4_2-UCUAUA.mcs
MCSYM-DB/4_2/UCUAUA/ds-4_2-UCUAUA_x.pdb.gz
MCSYM-DB/4_2/UCUAUC/
MCSYM-DB/4_2/UCUAUC/4_2-UCUAUC.mcs
MCSYM-DB/4_2/UCUAUC/ds-4_2-UCUAUC_x.pdb.gz
MCSYM-DB/4_2/UCUAUG/
MCSYM-DB/4_2/UCUAUG/4_2-UCUAUG.mcs
MCSYM-DB/4_2/UCUCAA/
MCSYM-DB/4_2/UCUCAA/4_2-UCUCAA.mcs
MCSYM-DB/4_2/UCUCAC/
MCSYM-DB/4_2/UCUCAC/4_2-UCUCAC.mcs
MCSYM-DB/4_2/UCUCCA/
MCSYM-DB/4_2/UCUCCA/4_2-UCUCCA.mcs
MCSYM-DB/4_2/UCUCCA/ds-4_2-UCUCCA_x.pdb.gz
MCSYM-DB/4_2/UCUCCC/
MCSYM-DB/4_2/UCUCCC/4_2-UCUCCC.mcs
MCSYM-DB/4_2/UCUCCC/ds-4_2-UCUCCC_x.pdb.gz
MCSYM-DB/4_2/UCUCCU/
MCSYM-DB/4_2/UCUCCU/4_2-UCUCCU.mcs
MCSYM-DB/4_2/UCUCCU/ds-4_2-UCUCCU_x.pdb.gz
MCSYM-DB/4_2/UCUCGA/
MCSYM-DB/4_2/UCUCGA/4_2-UCUCGA.mcs
MCSYM-DB/4_2/UCUCGA/ds-4_2-UCUCGA_x.pdb.gz
MCSYM-DB/4_2/UCUCGC/
MCSYM-DB/4_2/UCUCGC/4_2-UCUCGC.mcs
MCSYM-DB/4_2/UCUCGC/ds-4_2-UCUCGC_x.pdb.gz
MCSYM-DB/4_2/UCUCGG/
MCSYM-DB/4_2/UCUCGG/4_2-UCUCGG.mcs
MCSYM-DB/4_2/UCUCGG/ds-4_2-UCUCGG_x.pdb.gz
MCSYM-DB/4_2/UCUCUA/
MCSYM-DB/4_2/UCUCUA/4_2-UCUCUA.mcs
MCSYM-DB/4_2/UCUCUC/
MCSYM-DB/4_2/UCUCUC/4_2-UCUCUC.mcs
MCSYM-DB/4_2/UCUCUC/ds-4_2-UCUCUC_x.pdb.gz
MCSYM-DB/4_2/UCUCUU/
MCSYM-DB/4_2/UCUCUU/4_2-UCUCUU.mcs
MCSYM-DB/4_2/UCUCUU/ds-4_2-UCUCUU_x.pdb.gz
MCSYM-DB/4_2/UCUGAA/
MCSYM-DB/4_2/UCUGAA/4_2-UCUGAA.mcs
MCSYM-DB/4_2/UCUGAA/ds-4_2-UCUGAA_x.pdb.gz
MCSYM-DB/4_2/UCUGAU/
MCSYM-DB/4_2/UCUGAU/4_2-UCUGAU.mcs
MCSYM-DB/4_2/UCUGCA/
MCSYM-DB/4_2/UCUGCA/4_2-UCUGCA.mcs
MCSYM-DB/4_2/UCUGCA/ds-4_2-UCUGCA_x.pdb.gz
MCSYM-DB/4_2/UCUGCC/
MCSYM-DB/4_2/UCUGCC/4_2-UCUGCC.mcs
MCSYM-DB/4_2/UCUGCC/ds-4_2-UCUGCC_x.pdb.gz
MCSYM-DB/4_2/UCUGCG/
MCSYM-DB/4_2/UCUGCG/4_2-UCUGCG.mcs
MCSYM-DB/4_2/UCUGCG/ds-4_2-UCUGCG_x.pdb.gz
MCSYM-DB/4_2/UCUGCU/
MCSYM-DB/4_2/UCUGCU/4_2-UCUGCU.mcs
MCSYM-DB/4_2/UCUGCU/ds-4_2-UCUGCU_x.pdb.gz
MCSYM-DB/4_2/UCUGGA/
MCSYM-DB/4_2/UCUGGA/4_2-UCUGGA.mcs
MCSYM-DB/4_2/UCUGUG/
MCSYM-DB/4_2/UCUGUG/4_2-UCUGUG.mcs
MCSYM-DB/4_2/UCUGUG/ds-4_2-UCUGUG_x.pdb.gz
MCSYM-DB/4_2/UCUGUU/
MCSYM-DB/4_2/UCUGUU/4_2-UCUGUU.mcs
MCSYM-DB/4_2/UCUGUU/ds-4_2-UCUGUU_x.pdb.gz
MCSYM-DB/4_2/UCUUAA/
MCSYM-DB/4_2/UCUUAA/4_2-UCUUAA.mcs
MCSYM-DB/4_2/UCUUAA/ds-4_2-UCUUAA_x.pdb.gz
MCSYM-DB/4_2/UCUUAG/
MCSYM-DB/4_2/UCUUAG/4_2-UCUUAG.mcs
MCSYM-DB/4_2/UCUUAG/ds-4_2-UCUUAG_x.pdb.gz
MCSYM-DB/4_2/UCUUAU/
MCSYM-DB/4_2/UCUUAU/4_2-UCUUAU.mcs
MCSYM-DB/4_2/UCUUCA/
MCSYM-DB/4_2/UCUUCA/4_2-UCUUCA.mcs
MCSYM-DB/4_2/UCUUCA/ds-4_2-UCUUCA_x.pdb.gz
MCSYM-DB/4_2/UCUUCU/
MCSYM-DB/4_2/UCUUCU/4_2-UCUUCU.mcs
MCSYM-DB/4_2/UCUUCU/ds-4_2-UCUUCU_x.pdb.gz
MCSYM-DB/4_2/UCUUGA/
MCSYM-DB/4_2/UCUUGA/4_2-UCUUGA.mcs
MCSYM-DB/4_2/UCUUGC/
MCSYM-DB/4_2/UCUUGC/4_2-UCUUGC.mcs
MCSYM-DB/4_2/UCUUGC/ds-4_2-UCUUGC_x.pdb.gz
MCSYM-DB/4_2/UCUUGG/
MCSYM-DB/4_2/UCUUGG/4_2-UCUUGG.mcs
MCSYM-DB/4_2/UCUUGU/
MCSYM-DB/4_2/UCUUGU/4_2-UCUUGU.mcs
MCSYM-DB/4_2/UCUUUA/
MCSYM-DB/4_2/UCUUUA/4_2-UCUUUA.mcs
MCSYM-DB/4_2/UCUUUA/ds-4_2-UCUUUA_x.pdb.gz
MCSYM-DB/4_2/UCUUUC/
MCSYM-DB/4_2/UCUUUC/4_2-UCUUUC.mcs
MCSYM-DB/4_2/UCUUUC/ds-4_2-UCUUUC_x.pdb.gz
MCSYM-DB/4_2/UCUUUG/
MCSYM-DB/4_2/UCUUUG/4_2-UCUUUG.mcs
MCSYM-DB/4_2/UCUUUU/
MCSYM-DB/4_2/UCUUUU/4_2-UCUUUU.mcs
MCSYM-DB/4_2/UCUUUU/ds-4_2-UCUUUU_x.pdb.gz
MCSYM-DB/4_2/UGAAAA/
MCSYM-DB/4_2/UGAAAA/4_2-UGAAAA.mcs
MCSYM-DB/4_2/UGAACA/
MCSYM-DB/4_2/UGAACA/4_2-UGAACA.mcs
MCSYM-DB/4_2/UGAACA/ds-4_2-UGAACA_x.pdb.gz
MCSYM-DB/4_2/UGAAGA/
MCSYM-DB/4_2/UGAAGA/4_2-UGAAGA.mcs
MCSYM-DB/4_2/UGAAGG/
MCSYM-DB/4_2/UGAAGG/4_2-UGAAGG.mcs
MCSYM-DB/4_2/UGAAGG/ds-4_2-UGAAGG_x.pdb.gz
MCSYM-DB/4_2/UGAAUA/
MCSYM-DB/4_2/UGAAUA/4_2-UGAAUA.mcs
MCSYM-DB/4_2/UGAAUA/ds-4_2-UGAAUA_x.pdb.gz
MCSYM-DB/4_2/UGAAUG/
MCSYM-DB/4_2/UGAAUG/4_2-UGAAUG.mcs
MCSYM-DB/4_2/UGAAUG/ds-4_2-UGAAUG_x.pdb.gz
MCSYM-DB/4_2/UGAAUU/
MCSYM-DB/4_2/UGAAUU/4_2-UGAAUU.mcs
MCSYM-DB/4_2/UGACAA/
MCSYM-DB/4_2/UGACAA/4_2-UGACAA.mcs
MCSYM-DB/4_2/UGACCA/
MCSYM-DB/4_2/UGACCA/4_2-UGACCA.mcs
MCSYM-DB/4_2/UGACCC/
MCSYM-DB/4_2/UGACCC/4_2-UGACCC.mcs
MCSYM-DB/4_2/UGACCC/ds-4_2-UGACCC_x.pdb.gz
MCSYM-DB/4_2/UGACCG/
MCSYM-DB/4_2/UGACCG/4_2-UGACCG.mcs
MCSYM-DB/4_2/UGACCG/ds-4_2-UGACCG_x.pdb.gz
MCSYM-DB/4_2/UGACGA/
MCSYM-DB/4_2/UGACGA/4_2-UGACGA.mcs
MCSYM-DB/4_2/UGACGA/ds-4_2-UGACGA_x.pdb.gz
MCSYM-DB/4_2/UGACGG/
MCSYM-DB/4_2/UGACGG/4_2-UGACGG.mcs
MCSYM-DB/4_2/UGACGG/ds-4_2-UGACGG_x.pdb.gz
MCSYM-DB/4_2/UGACGU/
MCSYM-DB/4_2/UGACGU/4_2-UGACGU.mcs
MCSYM-DB/4_2/UGAGAA/
MCSYM-DB/4_2/UGAGAA/4_2-UGAGAA.mcs
MCSYM-DB/4_2/UGAGAA/ds-4_2-UGAGAA_x.pdb.gz
MCSYM-DB/4_2/UGAGAG/
MCSYM-DB/4_2/UGAGAG/4_2-UGAGAG.mcs
MCSYM-DB/4_2/UGAGAG/ds-4_2-UGAGAG_x.pdb.gz
MCSYM-DB/4_2/UGAGCA/
MCSYM-DB/4_2/UGAGCA/4_2-UGAGCA.mcs
MCSYM-DB/4_2/UGAGCA/ds-4_2-UGAGCA_x.pdb.gz
MCSYM-DB/4_2/UGAGCC/
MCSYM-DB/4_2/UGAGCC/4_2-UGAGCC.mcs
MCSYM-DB/4_2/UGAGCG/
MCSYM-DB/4_2/UGAGCG/4_2-UGAGCG.mcs
MCSYM-DB/4_2/UGAGCG/ds-4_2-UGAGCG_x.pdb.gz
MCSYM-DB/4_2/UGAGCU/
MCSYM-DB/4_2/UGAGCU/4_2-UGAGCU.mcs
MCSYM-DB/4_2/UGAGGA/
MCSYM-DB/4_2/UGAGGA/4_2-UGAGGA.mcs
MCSYM-DB/4_2/UGAGGA/ds-4_2-UGAGGA_x.pdb.gz
MCSYM-DB/4_2/UGAGGG/
MCSYM-DB/4_2/UGAGGG/4_2-UGAGGG.mcs
MCSYM-DB/4_2/UGAGGG/ds-4_2-UGAGGG_x.pdb.gz
MCSYM-DB/4_2/UGAGUA/
MCSYM-DB/4_2/UGAGUA/4_2-UGAGUA.mcs
MCSYM-DB/4_2/UGAGUG/
MCSYM-DB/4_2/UGAGUG/4_2-UGAGUG.mcs
MCSYM-DB/4_2/UGAGUG/ds-4_2-UGAGUG_x.pdb.gz
MCSYM-DB/4_2/UGAGUU/
MCSYM-DB/4_2/UGAGUU/4_2-UGAGUU.mcs
MCSYM-DB/4_2/UGAUAA/
MCSYM-DB/4_2/UGAUAA/4_2-UGAUAA.mcs
MCSYM-DB/4_2/UGAUAA/ds-4_2-UGAUAA_x.pdb.gz
MCSYM-DB/4_2/UGAUAC/
MCSYM-DB/4_2/UGAUAC/4_2-UGAUAC.mcs
MCSYM-DB/4_2/UGAUAG/
MCSYM-DB/4_2/UGAUAG/4_2-UGAUAG.mcs
MCSYM-DB/4_2/UGAUAU/
MCSYM-DB/4_2/UGAUAU/4_2-UGAUAU.mcs
MCSYM-DB/4_2/UGAUAU/ds-4_2-UGAUAU_x.pdb.gz
MCSYM-DB/4_2/UGAUCA/
MCSYM-DB/4_2/UGAUCA/4_2-UGAUCA.mcs
MCSYM-DB/4_2/UGAUCU/
MCSYM-DB/4_2/UGAUCU/4_2-UGAUCU.mcs
MCSYM-DB/4_2/UGAUGA/
MCSYM-DB/4_2/UGAUGA/4_2-UGAUGA.mcs
MCSYM-DB/4_2/UGAUGA/ds-4_2-UGAUGA_x.pdb.gz
MCSYM-DB/4_2/UGAUGG/
MCSYM-DB/4_2/UGAUGG/4_2-UGAUGG.mcs
MCSYM-DB/4_2/UGAUUA/
MCSYM-DB/4_2/UGAUUA/4_2-UGAUUA.mcs
MCSYM-DB/4_2/UGAUUC/
MCSYM-DB/4_2/UGAUUC/4_2-UGAUUC.mcs
MCSYM-DB/4_2/UGAUUG/
MCSYM-DB/4_2/UGAUUG/4_2-UGAUUG.mcs
MCSYM-DB/4_2/UGAUUG/ds-4_2-UGAUUG_x.pdb.gz
MCSYM-DB/4_2/UGAUUU/
MCSYM-DB/4_2/UGAUUU/4_2-UGAUUU.mcs
MCSYM-DB/4_2/UGCAAA/
MCSYM-DB/4_2/UGCAAA/4_2-UGCAAA.mcs
MCSYM-DB/4_2/UGCAAA/ds-4_2-UGCAAA_x.pdb.gz
MCSYM-DB/4_2/UGCACU/
MCSYM-DB/4_2/UGCACU/4_2-UGCACU.mcs
MCSYM-DB/4_2/UGCAGA/
MCSYM-DB/4_2/UGCAGA/4_2-UGCAGA.mcs
MCSYM-DB/4_2/UGCAGU/
MCSYM-DB/4_2/UGCAGU/4_2-UGCAGU.mcs
MCSYM-DB/4_2/UGCAUA/
MCSYM-DB/4_2/UGCAUA/4_2-UGCAUA.mcs
MCSYM-DB/4_2/UGCAUA/ds-4_2-UGCAUA_x.pdb.gz
MCSYM-DB/4_2/UGCAUG/
MCSYM-DB/4_2/UGCAUG/4_2-UGCAUG.mcs
MCSYM-DB/4_2/UGCAUU/
MCSYM-DB/4_2/UGCAUU/4_2-UGCAUU.mcs
MCSYM-DB/4_2/UGCAUU/ds-4_2-UGCAUU_x.pdb.gz
MCSYM-DB/4_2/UGCCAA/
MCSYM-DB/4_2/UGCCAA/4_2-UGCCAA.mcs
MCSYM-DB/4_2/UGCCAC/
MCSYM-DB/4_2/UGCCAC/4_2-UGCCAC.mcs
MCSYM-DB/4_2/UGCCCA/
MCSYM-DB/4_2/UGCCCA/4_2-UGCCCA.mcs
MCSYM-DB/4_2/UGCCGA/
MCSYM-DB/4_2/UGCCGA/1XOK_model_1.pdb.gz
MCSYM-DB/4_2/UGCCGA/4_2-UGCCGA.mcs
MCSYM-DB/4_2/UGCCGA/ds-4_2-UGCCGA_x.pdb.gz
MCSYM-DB/4_2/UGCCGC/
MCSYM-DB/4_2/UGCCGC/4_2-UGCCGC.mcs
MCSYM-DB/4_2/UGCCGG/
MCSYM-DB/4_2/UGCCGG/4_2-UGCCGG.mcs
MCSYM-DB/4_2/UGCCGU/
MCSYM-DB/4_2/UGCCGU/4_2-UGCCGU.mcs
MCSYM-DB/4_2/UGCCGU/ds-4_2-UGCCGU_x.pdb.gz
MCSYM-DB/4_2/UGCGCA/
MCSYM-DB/4_2/UGCGCA/4_2-UGCGCA.mcs
MCSYM-DB/4_2/UGCGCA/ds-4_2-UGCGCA_x.pdb.gz
MCSYM-DB/4_2/UGCGCG/
MCSYM-DB/4_2/UGCGCG/4_2-UGCGCG.mcs
MCSYM-DB/4_2/UGCGGA/
MCSYM-DB/4_2/UGCGGA/4_2-UGCGGA.mcs
MCSYM-DB/4_2/UGCGUA/
MCSYM-DB/4_2/UGCGUA/4_2-UGCGUA.mcs
MCSYM-DB/4_2/UGCUAA/
MCSYM-DB/4_2/UGCUAA/4_2-UGCUAA.mcs
MCSYM-DB/4_2/UGCUAA/ds-4_2-UGCUAA_x.pdb.gz
MCSYM-DB/4_2/UGCUAC/
MCSYM-DB/4_2/UGCUAC/4_2-UGCUAC.mcs
MCSYM-DB/4_2/UGCUAG/
MCSYM-DB/4_2/UGCUAG/4_2-UGCUAG.mcs
MCSYM-DB/4_2/UGCUCA/
MCSYM-DB/4_2/UGCUCA/4_2-UGCUCA.mcs
MCSYM-DB/4_2/UGCUCG/
MCSYM-DB/4_2/UGCUCG/4_2-UGCUCG.mcs
MCSYM-DB/4_2/UGCUGA/
MCSYM-DB/4_2/UGCUGA/4_2-UGCUGA.mcs
MCSYM-DB/4_2/UGCUGC/
MCSYM-DB/4_2/UGCUGC/4_2-UGCUGC.mcs
MCSYM-DB/4_2/UGCUGC/ds-4_2-UGCUGC_x.pdb.gz
MCSYM-DB/4_2/UGCUGG/
MCSYM-DB/4_2/UGCUGG/4_2-UGCUGG.mcs
MCSYM-DB/4_2/UGCUGU/
MCSYM-DB/4_2/UGCUGU/4_2-UGCUGU.mcs
MCSYM-DB/4_2/UGCUUA/
MCSYM-DB/4_2/UGCUUA/4_2-UGCUUA.mcs
MCSYM-DB/4_2/UGCUUG/
MCSYM-DB/4_2/UGCUUG/4_2-UGCUUG.mcs
MCSYM-DB/4_2/UGCUUG/ds-4_2-UGCUUG_x.pdb.gz
MCSYM-DB/4_2/UGCUUU/
MCSYM-DB/4_2/UGCUUU/4_2-UGCUUU.mcs
MCSYM-DB/4_2/UGGAAG/
MCSYM-DB/4_2/UGGAAG/4_2-UGGAAG.mcs
MCSYM-DB/4_2/UGGAGA/
MCSYM-DB/4_2/UGGAGA/4_2-UGGAGA.mcs
MCSYM-DB/4_2/UGGAGG/
MCSYM-DB/4_2/UGGAGG/4_2-UGGAGG.mcs
MCSYM-DB/4_2/UGGAGG/ds-4_2-UGGAGG_x.pdb.gz
MCSYM-DB/4_2/UGGAGU/
MCSYM-DB/4_2/UGGAGU/4_2-UGGAGU.mcs
MCSYM-DB/4_2/UGGAUA/
MCSYM-DB/4_2/UGGAUA/4_2-UGGAUA.mcs
MCSYM-DB/4_2/UGGAUA/ds-4_2-UGGAUA_x.pdb.gz
MCSYM-DB/4_2/UGGAUC/
MCSYM-DB/4_2/UGGAUC/4_2-UGGAUC.mcs
MCSYM-DB/4_2/UGGAUC/ds-4_2-UGGAUC_x.pdb.gz
MCSYM-DB/4_2/UGGAUG/
MCSYM-DB/4_2/UGGAUG/4_2-UGGAUG.mcs
MCSYM-DB/4_2/UGGAUG/ds-4_2-UGGAUG_x.pdb.gz
MCSYM-DB/4_2/UGGCAG/
MCSYM-DB/4_2/UGGCAG/4_2-UGGCAG.mcs
MCSYM-DB/4_2/UGGCAG/ds-4_2-UGGCAG_x.pdb.gz
MCSYM-DB/4_2/UGGCGA/
MCSYM-DB/4_2/UGGCGA/4_2-UGGCGA.mcs
MCSYM-DB/4_2/UGGCGA/ds-4_2-UGGCGA_x.pdb.gz
MCSYM-DB/4_2/UGGCGG/
MCSYM-DB/4_2/UGGCGG/4_2-UGGCGG.mcs
MCSYM-DB/4_2/UGGCGG/ds-4_2-UGGCGG_x.pdb.gz
MCSYM-DB/4_2/UGGCGU/
MCSYM-DB/4_2/UGGCGU/4_2-UGGCGU.mcs
MCSYM-DB/4_2/UGGGCA/
MCSYM-DB/4_2/UGGGCA/4_2-UGGGCA.mcs
MCSYM-DB/4_2/UGGGCA/ds-4_2-UGGGCA_x.pdb.gz
MCSYM-DB/4_2/UGGGCC/
MCSYM-DB/4_2/UGGGCC/4_2-UGGGCC.mcs
MCSYM-DB/4_2/UGGGCG/
MCSYM-DB/4_2/UGGGCG/4_2-UGGGCG.mcs
MCSYM-DB/4_2/UGGGCG/ds-4_2-UGGGCG_x.pdb.gz
MCSYM-DB/4_2/UGGGCU/
MCSYM-DB/4_2/UGGGCU/4_2-UGGGCU.mcs
MCSYM-DB/4_2/UGGGCU/ds-4_2-UGGGCU_x.pdb.gz
MCSYM-DB/4_2/UGGGGA/
MCSYM-DB/4_2/UGGGGA/4_2-UGGGGA.mcs
MCSYM-DB/4_2/UGGGGG/
MCSYM-DB/4_2/UGGGGG/4_2-UGGGGG.mcs
MCSYM-DB/4_2/UGGGUA/
MCSYM-DB/4_2/UGGGUA/4_2-UGGGUA.mcs
MCSYM-DB/4_2/UGGGUA/ds-4_2-UGGGUA_x.pdb.gz
MCSYM-DB/4_2/UGGGUG/
MCSYM-DB/4_2/UGGGUG/4_2-UGGGUG.mcs
MCSYM-DB/4_2/UGGGUG/ds-4_2-UGGGUG_x.pdb.gz
MCSYM-DB/4_2/UGGGUU/
MCSYM-DB/4_2/UGGGUU/4_2-UGGGUU.mcs
MCSYM-DB/4_2/UGGUAA/
MCSYM-DB/4_2/UGGUAA/4_2-UGGUAA.mcs
MCSYM-DB/4_2/UGGUAA/ds-4_2-UGGUAA_x.pdb.gz
MCSYM-DB/4_2/UGGUAG/
MCSYM-DB/4_2/UGGUAG/4_2-UGGUAG.mcs
MCSYM-DB/4_2/UGGUAG/ds-4_2-UGGUAG_x.pdb.gz
MCSYM-DB/4_2/UGGUAU/
MCSYM-DB/4_2/UGGUAU/4_2-UGGUAU.mcs
MCSYM-DB/4_2/UGGUGA/
MCSYM-DB/4_2/UGGUGA/4_2-UGGUGA.mcs
MCSYM-DB/4_2/UGGUGA/ds-4_2-UGGUGA_x.pdb.gz
MCSYM-DB/4_2/UGGUGG/
MCSYM-DB/4_2/UGGUGG/4_2-UGGUGG.mcs
MCSYM-DB/4_2/UGGUGG/ds-4_2-UGGUGG_x.pdb.gz
MCSYM-DB/4_2/UGGUUA/
MCSYM-DB/4_2/UGGUUA/4_2-UGGUUA.mcs
MCSYM-DB/4_2/UGUAAA/
MCSYM-DB/4_2/UGUAAA/4_2-UGUAAA.mcs
MCSYM-DB/4_2/UGUAAG/
MCSYM-DB/4_2/UGUAAG/4_2-UGUAAG.mcs
MCSYM-DB/4_2/UGUACA/
MCSYM-DB/4_2/UGUACA/4_2-UGUACA.mcs
MCSYM-DB/4_2/UGUAGA/
MCSYM-DB/4_2/UGUAGA/4_2-UGUAGA.mcs
MCSYM-DB/4_2/UGUAGA/ds-4_2-UGUAGA_x.pdb.gz
MCSYM-DB/4_2/UGUAGU/
MCSYM-DB/4_2/UGUAGU/4_2-UGUAGU.mcs
MCSYM-DB/4_2/UGUAUA/
MCSYM-DB/4_2/UGUAUA/4_2-UGUAUA.mcs
MCSYM-DB/4_2/UGUAUA/ds-4_2-UGUAUA_x.pdb.gz
MCSYM-DB/4_2/UGUAUG/
MCSYM-DB/4_2/UGUAUG/4_2-UGUAUG.mcs
MCSYM-DB/4_2/UGUAUG/ds-4_2-UGUAUG_x.pdb.gz
MCSYM-DB/4_2/UGUCAA/
MCSYM-DB/4_2/UGUCAA/4_2-UGUCAA.mcs
MCSYM-DB/4_2/UGUCCA/
MCSYM-DB/4_2/UGUCCA/4_2-UGUCCA.mcs
MCSYM-DB/4_2/UGUCGA/
MCSYM-DB/4_2/UGUCGA/4_2-UGUCGA.mcs
MCSYM-DB/4_2/UGUCGA/ds-4_2-UGUCGA_x.pdb.gz
MCSYM-DB/4_2/UGUCGC/
MCSYM-DB/4_2/UGUCGC/4_2-UGUCGC.mcs
MCSYM-DB/4_2/UGUCGG/
MCSYM-DB/4_2/UGUCGG/4_2-UGUCGG.mcs
MCSYM-DB/4_2/UGUCGG/ds-4_2-UGUCGG_x.pdb.gz
MCSYM-DB/4_2/UGUCGU/
MCSYM-DB/4_2/UGUCGU/4_2-UGUCGU.mcs
MCSYM-DB/4_2/UGUCGU/ds-4_2-UGUCGU_x.pdb.gz
MCSYM-DB/4_2/UGUCUC/
MCSYM-DB/4_2/UGUCUC/4_2-UGUCUC.mcs
MCSYM-DB/4_2/UGUCUC/ds-4_2-UGUCUC_x.pdb.gz
MCSYM-DB/4_2/UGUGAA/
MCSYM-DB/4_2/UGUGAA/4_2-UGUGAA.mcs
MCSYM-DB/4_2/UGUGAA/ds-4_2-UGUGAA_x.pdb.gz
MCSYM-DB/4_2/UGUGCA/
MCSYM-DB/4_2/UGUGCA/4_2-UGUGCA.mcs
MCSYM-DB/4_2/UGUGCC/
MCSYM-DB/4_2/UGUGCC/4_2-UGUGCC.mcs
MCSYM-DB/4_2/UGUGCC/ds-4_2-UGUGCC_x.pdb.gz
MCSYM-DB/4_2/UGUGCG/
MCSYM-DB/4_2/UGUGCG/4_2-UGUGCG.mcs
MCSYM-DB/4_2/UGUGCG/ds-4_2-UGUGCG_x.pdb.gz
MCSYM-DB/4_2/UGUGCU/
MCSYM-DB/4_2/UGUGCU/4_2-UGUGCU.mcs
MCSYM-DB/4_2/UGUGCU/ds-4_2-UGUGCU_x.pdb.gz
MCSYM-DB/4_2/UGUGGA/
MCSYM-DB/4_2/UGUGGA/4_2-UGUGGA.mcs
MCSYM-DB/4_2/UGUGUA/
MCSYM-DB/4_2/UGUGUA/4_2-UGUGUA.mcs
MCSYM-DB/4_2/UGUGUA/ds-4_2-UGUGUA_x.pdb.gz
MCSYM-DB/4_2/UGUGUG/
MCSYM-DB/4_2/UGUGUG/4_2-UGUGUG.mcs
MCSYM-DB/4_2/UGUGUG/ds-4_2-UGUGUG_x.pdb.gz
MCSYM-DB/4_2/UGUGUU/
MCSYM-DB/4_2/UGUGUU/4_2-UGUGUU.mcs
MCSYM-DB/4_2/UGUGUU/ds-4_2-UGUGUU_x.pdb.gz
MCSYM-DB/4_2/UGUUAA/
MCSYM-DB/4_2/UGUUAA/4_2-UGUUAA.mcs
MCSYM-DB/4_2/UGUUAA/ds-4_2-UGUUAA_x.pdb.gz
MCSYM-DB/4_2/UGUUAC/
MCSYM-DB/4_2/UGUUAC/4_2-UGUUAC.mcs
MCSYM-DB/4_2/UGUUAG/
MCSYM-DB/4_2/UGUUAG/4_2-UGUUAG.mcs
MCSYM-DB/4_2/UGUUAU/
MCSYM-DB/4_2/UGUUAU/4_2-UGUUAU.mcs
MCSYM-DB/4_2/UGUUAU/ds-4_2-UGUUAU_x.pdb.gz
MCSYM-DB/4_2/UGUUCU/
MCSYM-DB/4_2/UGUUCU/4_2-UGUUCU.mcs
MCSYM-DB/4_2/UGUUCU/ds-4_2-UGUUCU_x.pdb.gz
MCSYM-DB/4_2/UGUUGA/
MCSYM-DB/4_2/UGUUGA/4_2-UGUUGA.mcs
MCSYM-DB/4_2/UGUUGA/ds-4_2-UGUUGA_x.pdb.gz
MCSYM-DB/4_2/UGUUGG/
MCSYM-DB/4_2/UGUUGG/4_2-UGUUGG.mcs
MCSYM-DB/4_2/UGUUGG/ds-4_2-UGUUGG_x.pdb.gz
MCSYM-DB/4_2/UGUUGU/
MCSYM-DB/4_2/UGUUGU/4_2-UGUUGU.mcs
MCSYM-DB/4_2/UGUUUA/
MCSYM-DB/4_2/UGUUUA/4_2-UGUUUA.mcs
MCSYM-DB/4_2/UUAAAA/
MCSYM-DB/4_2/UUAAAA/4_2-UUAAAA.mcs
MCSYM-DB/4_2/UUAAAC/
MCSYM-DB/4_2/UUAAAC/4_2-UUAAAC.mcs
MCSYM-DB/4_2/UUAAAG/
MCSYM-DB/4_2/UUAAAG/4_2-UUAAAG.mcs
MCSYM-DB/4_2/UUAACA/
MCSYM-DB/4_2/UUAACA/4_2-UUAACA.mcs
MCSYM-DB/4_2/UUAAGU/
MCSYM-DB/4_2/UUAAGU/4_2-UUAAGU.mcs
MCSYM-DB/4_2/UUAAUA/
MCSYM-DB/4_2/UUAAUA/4_2-UUAAUA.mcs
MCSYM-DB/4_2/UUAAUA/ds-4_2-UUAAUA_x.pdb.gz
MCSYM-DB/4_2/UUAAUG/
MCSYM-DB/4_2/UUAAUG/4_2-UUAAUG.mcs
MCSYM-DB/4_2/UUAAUG/ds-4_2-UUAAUG_x.pdb.gz
MCSYM-DB/4_2/UUAAUU/
MCSYM-DB/4_2/UUAAUU/4_2-UUAAUU.mcs
MCSYM-DB/4_2/UUACAA/
MCSYM-DB/4_2/UUACAA/4_2-UUACAA.mcs
MCSYM-DB/4_2/UUACAC/
MCSYM-DB/4_2/UUACAC/4_2-UUACAC.mcs
MCSYM-DB/4_2/UUACAU/
MCSYM-DB/4_2/UUACAU/4_2-UUACAU.mcs
MCSYM-DB/4_2/UUACCA/
MCSYM-DB/4_2/UUACCA/4_2-UUACCA.mcs
MCSYM-DB/4_2/UUACGA/
MCSYM-DB/4_2/UUACGA/4_2-UUACGA.mcs
MCSYM-DB/4_2/UUACGA/ds-4_2-UUACGA_x.pdb.gz
MCSYM-DB/4_2/UUACGG/
MCSYM-DB/4_2/UUACGG/1L1C_model_1.pdb.gz
MCSYM-DB/4_2/UUACGG/4_2-UUACGG.mcs
MCSYM-DB/4_2/UUACGG/ds-4_2-UUACGG_x.pdb.gz
MCSYM-DB/4_2/UUACGU/
MCSYM-DB/4_2/UUACGU/4_2-UUACGU.mcs
MCSYM-DB/4_2/UUACUU/
MCSYM-DB/4_2/UUACUU/4_2-UUACUU.mcs
MCSYM-DB/4_2/UUAGAU/
MCSYM-DB/4_2/UUAGAU/4_2-UUAGAU.mcs
MCSYM-DB/4_2/UUAGCA/
MCSYM-DB/4_2/UUAGCA/4_2-UUAGCA.mcs
MCSYM-DB/4_2/UUAGCA/ds-4_2-UUAGCA_x.pdb.gz
MCSYM-DB/4_2/UUAGCC/
MCSYM-DB/4_2/UUAGCC/4_2-UUAGCC.mcs
MCSYM-DB/4_2/UUAGCC/ds-4_2-UUAGCC_x.pdb.gz
MCSYM-DB/4_2/UUAGCG/
MCSYM-DB/4_2/UUAGCG/4_2-UUAGCG.mcs
MCSYM-DB/4_2/UUAGCG/ds-4_2-UUAGCG_x.pdb.gz
MCSYM-DB/4_2/UUAGCU/
MCSYM-DB/4_2/UUAGCU/4_2-UUAGCU.mcs
MCSYM-DB/4_2/UUAGGG/
MCSYM-DB/4_2/UUAGGG/4_2-UUAGGG.mcs
MCSYM-DB/4_2/UUAGUA/
MCSYM-DB/4_2/UUAGUA/4_2-UUAGUA.mcs
MCSYM-DB/4_2/UUAGUA/ds-4_2-UUAGUA_x.pdb.gz
MCSYM-DB/4_2/UUAUAA/
MCSYM-DB/4_2/UUAUAA/4_2-UUAUAA.mcs
MCSYM-DB/4_2/UUAUAA/ds-4_2-UUAUAA_x.pdb.gz
MCSYM-DB/4_2/UUAUAG/
MCSYM-DB/4_2/UUAUAG/4_2-UUAUAG.mcs
MCSYM-DB/4_2/UUAUAG/ds-4_2-UUAUAG_x.pdb.gz
MCSYM-DB/4_2/UUAUAU/
MCSYM-DB/4_2/UUAUAU/4_2-UUAUAU.mcs
MCSYM-DB/4_2/UUAUCC/
MCSYM-DB/4_2/UUAUCC/4_2-UUAUCC.mcs
MCSYM-DB/4_2/UUAUCC/ds-4_2-UUAUCC_x.pdb.gz
MCSYM-DB/4_2/UUAUGA/
MCSYM-DB/4_2/UUAUGA/4_2-UUAUGA.mcs
MCSYM-DB/4_2/UUAUGC/
MCSYM-DB/4_2/UUAUGC/4_2-UUAUGC.mcs
MCSYM-DB/4_2/UUAUGC/ds-4_2-UUAUGC_x.pdb.gz
MCSYM-DB/4_2/UUAUGG/
MCSYM-DB/4_2/UUAUGG/4_2-UUAUGG.mcs
MCSYM-DB/4_2/UUAUGG/ds-4_2-UUAUGG_x.pdb.gz
MCSYM-DB/4_2/UUAUUA/
MCSYM-DB/4_2/UUAUUA/4_2-UUAUUA.mcs
MCSYM-DB/4_2/UUAUUG/
MCSYM-DB/4_2/UUAUUG/4_2-UUAUUG.mcs
MCSYM-DB/4_2/UUCAAA/
MCSYM-DB/4_2/UUCAAA/4_2-UUCAAA.mcs
MCSYM-DB/4_2/UUCAAA/ds-4_2-UUCAAA_x.pdb.gz
MCSYM-DB/4_2/UUCAAU/
MCSYM-DB/4_2/UUCAAU/4_2-UUCAAU.mcs
MCSYM-DB/4_2/UUCACA/
MCSYM-DB/4_2/UUCACA/4_2-UUCACA.mcs
MCSYM-DB/4_2/UUCACA/ds-4_2-UUCACA_x.pdb.gz
MCSYM-DB/4_2/UUCACG/
MCSYM-DB/4_2/UUCACG/4_2-UUCACG.mcs
MCSYM-DB/4_2/UUCACG/ds-4_2-UUCACG_x.pdb.gz
MCSYM-DB/4_2/UUCAUA/
MCSYM-DB/4_2/UUCAUA/4_2-UUCAUA.mcs
MCSYM-DB/4_2/UUCAUA/ds-4_2-UUCAUA_x.pdb.gz
MCSYM-DB/4_2/UUCAUC/
MCSYM-DB/4_2/UUCAUC/4_2-UUCAUC.mcs
MCSYM-DB/4_2/UUCAUC/ds-4_2-UUCAUC_x.pdb.gz
MCSYM-DB/4_2/UUCAUG/
MCSYM-DB/4_2/UUCAUG/4_2-UUCAUG.mcs
MCSYM-DB/4_2/UUCAUG/ds-4_2-UUCAUG_x.pdb.gz
MCSYM-DB/4_2/UUCAUU/
MCSYM-DB/4_2/UUCAUU/4_2-UUCAUU.mcs
MCSYM-DB/4_2/UUCAUU/ds-4_2-UUCAUU_x.pdb.gz
MCSYM-DB/4_2/UUCCAG/
MCSYM-DB/4_2/UUCCAG/4_2-UUCCAG.mcs
MCSYM-DB/4_2/UUCCGA/
MCSYM-DB/4_2/UUCCGA/4_2-UUCCGA.mcs
MCSYM-DB/4_2/UUCCGA/ds-4_2-UUCCGA_x.pdb.gz
MCSYM-DB/4_2/UUCCGC/
MCSYM-DB/4_2/UUCCGC/4_2-UUCCGC.mcs
MCSYM-DB/4_2/UUCCGC/ds-4_2-UUCCGC_x.pdb.gz
MCSYM-DB/4_2/UUCCGG/
MCSYM-DB/4_2/UUCCGG/4_2-UUCCGG.mcs
MCSYM-DB/4_2/UUCCGU/
MCSYM-DB/4_2/UUCCGU/4_2-UUCCGU.mcs
MCSYM-DB/4_2/UUCCGU/ds-4_2-UUCCGU_x.pdb.gz
MCSYM-DB/4_2/UUCCUA/
MCSYM-DB/4_2/UUCCUA/4_2-UUCCUA.mcs
MCSYM-DB/4_2/UUCGAA/
MCSYM-DB/4_2/UUCGAA/4_2-UUCGAA.mcs
MCSYM-DB/4_2/UUCGAA/ds-4_2-UUCGAA_x.pdb.gz
MCSYM-DB/4_2/UUCGCA/
MCSYM-DB/4_2/UUCGCA/4_2-UUCGCA.mcs
MCSYM-DB/4_2/UUCGCA/ds-4_2-UUCGCA_x.pdb.gz
MCSYM-DB/4_2/UUCGCC/
MCSYM-DB/4_2/UUCGCC/4_2-UUCGCC.mcs
MCSYM-DB/4_2/UUCGCU/
MCSYM-DB/4_2/UUCGCU/4_2-UUCGCU.mcs
MCSYM-DB/4_2/UUCGCU/ds-4_2-UUCGCU_x.pdb.gz
MCSYM-DB/4_2/UUCGUA/
MCSYM-DB/4_2/UUCGUA/4_2-UUCGUA.mcs
MCSYM-DB/4_2/UUCGUA/ds-4_2-UUCGUA_x.pdb.gz
MCSYM-DB/4_2/UUCGUG/
MCSYM-DB/4_2/UUCGUG/4_2-UUCGUG.mcs
MCSYM-DB/4_2/UUCGUG/ds-4_2-UUCGUG_x.pdb.gz
MCSYM-DB/4_2/UUCGUU/
MCSYM-DB/4_2/UUCGUU/4_2-UUCGUU.mcs
MCSYM-DB/4_2/UUCGUU/ds-4_2-UUCGUU_x.pdb.gz
MCSYM-DB/4_2/UUCUAA/
MCSYM-DB/4_2/UUCUAA/4_2-UUCUAA.mcs
MCSYM-DB/4_2/UUCUAA/ds-4_2-UUCUAA_x.pdb.gz
MCSYM-DB/4_2/UUCUAC/
MCSYM-DB/4_2/UUCUAC/4_2-UUCUAC.mcs
MCSYM-DB/4_2/UUCUAG/
MCSYM-DB/4_2/UUCUAG/4_2-UUCUAG.mcs
MCSYM-DB/4_2/UUCUCA/
MCSYM-DB/4_2/UUCUCA/4_2-UUCUCA.mcs
MCSYM-DB/4_2/UUCUCA/ds-4_2-UUCUCA_x.pdb.gz
MCSYM-DB/4_2/UUCUCU/
MCSYM-DB/4_2/UUCUCU/4_2-UUCUCU.mcs
MCSYM-DB/4_2/UUCUGA/
MCSYM-DB/4_2/UUCUGA/4_2-UUCUGA.mcs
MCSYM-DB/4_2/UUCUGG/
MCSYM-DB/4_2/UUCUGG/4_2-UUCUGG.mcs
MCSYM-DB/4_2/UUCUUA/
MCSYM-DB/4_2/UUCUUA/4_2-UUCUUA.mcs
MCSYM-DB/4_2/UUCUUA/ds-4_2-UUCUUA_x.pdb.gz
MCSYM-DB/4_2/UUCUUG/
MCSYM-DB/4_2/UUCUUG/4_2-UUCUUG.mcs
MCSYM-DB/4_2/UUCUUU/
MCSYM-DB/4_2/UUCUUU/4_2-UUCUUU.mcs
MCSYM-DB/4_2/UUCUUU/ds-4_2-UUCUUU_x.pdb.gz
MCSYM-DB/4_2/UUGAAC/
MCSYM-DB/4_2/UUGAAC/4_2-UUGAAC.mcs
MCSYM-DB/4_2/UUGAAC/ds-4_2-UUGAAC_x.pdb.gz
MCSYM-DB/4_2/UUGAUA/
MCSYM-DB/4_2/UUGAUA/4_2-UUGAUA.mcs
MCSYM-DB/4_2/UUGAUA/ds-4_2-UUGAUA_x.pdb.gz
MCSYM-DB/4_2/UUGAUG/
MCSYM-DB/4_2/UUGAUG/4_2-UUGAUG.mcs
MCSYM-DB/4_2/UUGAUG/ds-4_2-UUGAUG_x.pdb.gz
MCSYM-DB/4_2/UUGAUU/
MCSYM-DB/4_2/UUGAUU/4_2-UUGAUU.mcs
MCSYM-DB/4_2/UUGCCA/
MCSYM-DB/4_2/UUGCCA/4_2-UUGCCA.mcs
MCSYM-DB/4_2/UUGCGA/
MCSYM-DB/4_2/UUGCGA/4_2-UUGCGA.mcs
MCSYM-DB/4_2/UUGCGA/ds-4_2-UUGCGA_x.pdb.gz
MCSYM-DB/4_2/UUGCGC/
MCSYM-DB/4_2/UUGCGC/4_2-UUGCGC.mcs
MCSYM-DB/4_2/UUGCGG/
MCSYM-DB/4_2/UUGCGG/4_2-UUGCGG.mcs
MCSYM-DB/4_2/UUGCGG/ds-4_2-UUGCGG_x.pdb.gz
MCSYM-DB/4_2/UUGCGU/
MCSYM-DB/4_2/UUGCGU/4_2-UUGCGU.mcs
MCSYM-DB/4_2/UUGGAA/
MCSYM-DB/4_2/UUGGAA/4_2-UUGGAA.mcs
MCSYM-DB/4_2/UUGGCA/
MCSYM-DB/4_2/UUGGCA/4_2-UUGGCA.mcs
MCSYM-DB/4_2/UUGGCA/ds-4_2-UUGGCA_x.pdb.gz
MCSYM-DB/4_2/UUGGCG/
MCSYM-DB/4_2/UUGGCG/4_2-UUGGCG.mcs
MCSYM-DB/4_2/UUGGCG/ds-4_2-UUGGCG_x.pdb.gz
MCSYM-DB/4_2/UUGGUA/
MCSYM-DB/4_2/UUGGUA/4_2-UUGGUA.mcs
MCSYM-DB/4_2/UUGGUA/ds-4_2-UUGGUA_x.pdb.gz
MCSYM-DB/4_2/UUGGUU/
MCSYM-DB/4_2/UUGGUU/4_2-UUGGUU.mcs
MCSYM-DB/4_2/UUGUAA/
MCSYM-DB/4_2/UUGUAA/4_2-UUGUAA.mcs
MCSYM-DB/4_2/UUGUAA/ds-4_2-UUGUAA_x.pdb.gz
MCSYM-DB/4_2/UUGUAG/
MCSYM-DB/4_2/UUGUAG/4_2-UUGUAG.mcs
MCSYM-DB/4_2/UUGUAG/ds-4_2-UUGUAG_x.pdb.gz
MCSYM-DB/4_2/UUGUCA/
MCSYM-DB/4_2/UUGUCA/4_2-UUGUCA.mcs
MCSYM-DB/4_2/UUGUCC/
MCSYM-DB/4_2/UUGUCC/4_2-UUGUCC.mcs
MCSYM-DB/4_2/UUGUCC/ds-4_2-UUGUCC_x.pdb.gz
MCSYM-DB/4_2/UUGUGA/
MCSYM-DB/4_2/UUGUGA/4_2-UUGUGA.mcs
MCSYM-DB/4_2/UUGUGA/ds-4_2-UUGUGA_x.pdb.gz
MCSYM-DB/4_2/UUGUGG/
MCSYM-DB/4_2/UUGUGG/4_2-UUGUGG.mcs
MCSYM-DB/4_2/UUGUGG/ds-4_2-UUGUGG_x.pdb.gz
MCSYM-DB/4_2/UUGUUA/
MCSYM-DB/4_2/UUGUUA/4_2-UUGUUA.mcs
MCSYM-DB/4_2/UUGUUA/ds-4_2-UUGUUA_x.pdb.gz
MCSYM-DB/4_2/UUGUUG/
MCSYM-DB/4_2/UUGUUG/4_2-UUGUUG.mcs
MCSYM-DB/4_2/UUGUUU/
MCSYM-DB/4_2/UUGUUU/4_2-UUGUUU.mcs
MCSYM-DB/4_2/UUUAAA/
MCSYM-DB/4_2/UUUAAA/4_2-UUUAAA.mcs
MCSYM-DB/4_2/UUUAAA/ds-4_2-UUUAAA_x.pdb.gz
MCSYM-DB/4_2/UUUAAG/
MCSYM-DB/4_2/UUUAAG/4_2-UUUAAG.mcs
MCSYM-DB/4_2/UUUACA/
MCSYM-DB/4_2/UUUACA/4_2-UUUACA.mcs
MCSYM-DB/4_2/UUUACA/ds-4_2-UUUACA_x.pdb.gz
MCSYM-DB/4_2/UUUAGA/
MCSYM-DB/4_2/UUUAGA/4_2-UUUAGA.mcs
MCSYM-DB/4_2/UUUAGG/
MCSYM-DB/4_2/UUUAGG/4_2-UUUAGG.mcs
MCSYM-DB/4_2/UUUAUA/
MCSYM-DB/4_2/UUUAUA/4_2-UUUAUA.mcs
MCSYM-DB/4_2/UUUAUA/ds-4_2-UUUAUA_x.pdb.gz
MCSYM-DB/4_2/UUUAUG/
MCSYM-DB/4_2/UUUAUG/4_2-UUUAUG.mcs
MCSYM-DB/4_2/UUUAUG/ds-4_2-UUUAUG_x.pdb.gz
MCSYM-DB/4_2/UUUCAA/
MCSYM-DB/4_2/UUUCAA/4_2-UUUCAA.mcs
MCSYM-DB/4_2/UUUCAG/
MCSYM-DB/4_2/UUUCAG/4_2-UUUCAG.mcs
MCSYM-DB/4_2/UUUCCA/
MCSYM-DB/4_2/UUUCCA/4_2-UUUCCA.mcs
MCSYM-DB/4_2/UUUCCA/ds-4_2-UUUCCA_x.pdb.gz
MCSYM-DB/4_2/UUUCGA/
MCSYM-DB/4_2/UUUCGA/4_2-UUUCGA.mcs
MCSYM-DB/4_2/UUUCGA/ds-4_2-UUUCGA_x.pdb.gz
MCSYM-DB/4_2/UUUCGC/
MCSYM-DB/4_2/UUUCGC/4_2-UUUCGC.mcs
MCSYM-DB/4_2/UUUCGC/ds-4_2-UUUCGC_x.pdb.gz
MCSYM-DB/4_2/UUUCGG/
MCSYM-DB/4_2/UUUCGG/4_2-UUUCGG.mcs
MCSYM-DB/4_2/UUUCGG/ds-4_2-UUUCGG_x.pdb.gz
MCSYM-DB/4_2/UUUCGU/
MCSYM-DB/4_2/UUUCGU/4_2-UUUCGU.mcs
MCSYM-DB/4_2/UUUCGU/ds-4_2-UUUCGU_x.pdb.gz
MCSYM-DB/4_2/UUUCUA/
MCSYM-DB/4_2/UUUCUA/4_2-UUUCUA.mcs
MCSYM-DB/4_2/UUUCUC/
MCSYM-DB/4_2/UUUCUC/4_2-UUUCUC.mcs
MCSYM-DB/4_2/UUUGAA/
MCSYM-DB/4_2/UUUGAA/4_2-UUUGAA.mcs
MCSYM-DB/4_2/UUUGCA/
MCSYM-DB/4_2/UUUGCA/4_2-UUUGCA.mcs
MCSYM-DB/4_2/UUUGCA/ds-4_2-UUUGCA_x.pdb.gz
MCSYM-DB/4_2/UUUGCC/
MCSYM-DB/4_2/UUUGCC/4_2-UUUGCC.mcs
MCSYM-DB/4_2/UUUGCG/
MCSYM-DB/4_2/UUUGCG/4_2-UUUGCG.mcs
MCSYM-DB/4_2/UUUGCG/ds-4_2-UUUGCG_x.pdb.gz
MCSYM-DB/4_2/UUUGCU/
MCSYM-DB/4_2/UUUGCU/4_2-UUUGCU.mcs
MCSYM-DB/4_2/UUUGGG/
MCSYM-DB/4_2/UUUGGG/4_2-UUUGGG.mcs
MCSYM-DB/4_2/UUUGUG/
MCSYM-DB/4_2/UUUGUG/4_2-UUUGUG.mcs
MCSYM-DB/4_2/UUUGUG/ds-4_2-UUUGUG_x.pdb.gz
MCSYM-DB/4_2/UUUGUU/
MCSYM-DB/4_2/UUUGUU/4_2-UUUGUU.mcs
MCSYM-DB/4_2/UUUGUU/ds-4_2-UUUGUU_x.pdb.gz
MCSYM-DB/4_2/UUUUAA/
MCSYM-DB/4_2/UUUUAA/4_2-UUUUAA.mcs
MCSYM-DB/4_2/UUUUAA/ds-4_2-UUUUAA_x.pdb.gz
MCSYM-DB/4_2/UUUUAC/
MCSYM-DB/4_2/UUUUAC/4_2-UUUUAC.mcs
MCSYM-DB/4_2/UUUUAC/ds-4_2-UUUUAC_x.pdb.gz
MCSYM-DB/4_2/UUUUAG/
MCSYM-DB/4_2/UUUUAG/4_2-UUUUAG.mcs
MCSYM-DB/4_2/UUUUAG/ds-4_2-UUUUAG_x.pdb.gz
MCSYM-DB/4_2/UUUUAU/
MCSYM-DB/4_2/UUUUAU/4_2-UUUUAU.mcs
MCSYM-DB/4_2/UUUUCA/
MCSYM-DB/4_2/UUUUCA/4_2-UUUUCA.mcs
MCSYM-DB/4_2/UUUUCA/ds-4_2-UUUUCA_x.pdb.gz
MCSYM-DB/4_2/UUUUCG/
MCSYM-DB/4_2/UUUUCG/4_2-UUUUCG.mcs
MCSYM-DB/4_2/UUUUGA/
MCSYM-DB/4_2/UUUUGA/4_2-UUUUGA.mcs
MCSYM-DB/4_2/UUUUGA/ds-4_2-UUUUGA_x.pdb.gz
MCSYM-DB/4_2/UUUUGC/
MCSYM-DB/4_2/UUUUGC/4_2-UUUUGC.mcs
MCSYM-DB/4_2/UUUUGG/
MCSYM-DB/4_2/UUUUGG/4_2-UUUUGG.mcs
MCSYM-DB/4_2/UUUUGU/
MCSYM-DB/4_2/UUUUGU/4_2-UUUUGU.mcs
MCSYM-DB/4_2/UUUUUA/
MCSYM-DB/4_2/UUUUUA/4_2-UUUUUA.mcs
MCSYM-DB/4_2/UUUUUC/
MCSYM-DB/4_2/UUUUUC/4_2-UUUUUC.mcs
MCSYM-DB/4_2/UUUUUC/ds-4_2-UUUUUC_x.pdb.gz
MCSYM-DB/4_2/UUUUUG/
MCSYM-DB/4_2/UUUUUG/4_2-UUUUUG.mcs
MCSYM-DB/4_2/UUUUUG/ds-4_2-UUUUUG_x.pdb.gz
MCSYM-DB/4_2/UUUUUU/
MCSYM-DB/4_2/UUUUUU/4_2-UUUUUU.mcs
MCSYM-DB/4_3/
MCSYM-DB/4_3/AAAGCAG/
MCSYM-DB/4_3/AAAGCAG/4_3-AAAGCAG.mcs
MCSYM-DB/4_3/AAAGCAG/ds-4_3-AAAGCAG_x.pdb.gz
MCSYM-DB/4_3/ACCAAUA/
MCSYM-DB/4_3/ACCAAUA/4_3-ACCAAUA.mcs
MCSYM-DB/4_3/ACCAAUA/ds-4_3-ACCAAUA_x.pdb.gz
MCSYM-DB/4_3/CAACGUG/
MCSYM-DB/4_3/CAACGUG/4_3-CAACGUG.mcs
MCSYM-DB/4_3/CCCUAUG/
MCSYM-DB/4_3/CCCUAUG/4_3-CCCUAUG.mcs
MCSYM-DB/4_3/CCCUAUG/ds-4_3-CCCUAUG_x.pdb.gz
MCSYM-DB/4_3/CUAGCCG/
MCSYM-DB/4_3/CUAGCCG/4_3-CUAGCCG.mcs
MCSYM-DB/4_3/CUAGCCG/ds-4_3-CUAGCCG_x.pdb.gz
MCSYM-DB/4_3/GCCCGAC/
MCSYM-DB/4_3/GCCCGAC/4_3-GCCCGAC.mcs
MCSYM-DB/4_3/GCCCGAC/ds-4_3-GCCCGAC_x.pdb.gz
MCSYM-DB/4_3/UCACGCA/
MCSYM-DB/4_3/UCACGCA/4_3-UCACGCA.mcs
MCSYM-DB/4_3/UCACGCA/ds-4_3-UCACGCA_x.pdb.gz
MCSYM-DB/4_3/UCCGCAG/
MCSYM-DB/4_3/UCCGCAG/4_3-UCCGCAG.mcs
MCSYM-DB/4_3/UCCGCAG/ds-4_3-UCCGCAG_x.pdb.gz
MCSYM-DB/4_3/UUCGCCA/
MCSYM-DB/4_3/UUCGCCA/4_3-UUCGCCA.mcs
MCSYM-DB/4_3/UUCGCCA/4_3-UUCGCCA_x.pdb
MCSYM-DB/4_3/UUCGCCA/ds-4_3-UUCGCCA_x.pdb.gz
MCSYM-DB/4_3/UUCGUUA/
MCSYM-DB/4_3/UUCGUUA/4_3-UUCGUUA.mcs
MCSYM-DB/4_3/UUCGUUA/ds-4_3-UUCGUUA_x.pdb.gz
MCSYM-DB/4_4/
MCSYM-DB/4_4/CCUGCUGG/
MCSYM-DB/4_4/CCUGCUGG/4_4-CCUGCUGG.mcs
MCSYM-DB/4_4/CCUGCUGG/ds-4_4-CCUGCUGG_x.pdb.gz
MCSYM-DB/4_4/GUAGCAUC/
MCSYM-DB/4_4/GUAGCAUC/1HC8_model_1.pdb.gz
MCSYM-DB/4_4/GUAGCAUC/4_4-GUAGCAUC.mcs
MCSYM-DB/4_4/GUAGCAUC/ds-4_4-GUAGCAUC_x.pdb.gz
MCSYM-DB/4_5/
MCSYM-DB/4_5/GGGCGGUAC/
MCSYM-DB/4_5/GGGCGGUAC/4_5-GGGCGGUAC.mcs
MCSYM-DB/4_5/GGGCGGUAC/ds-4_5-GGGCGGUAC_x.pdb.gz
MCSYM-DB/5/
MCSYM-DB/5/AAAAA/
MCSYM-DB/5/AAAAA/5-AAAAA.mcs
MCSYM-DB/5/AAAAA/ss-5-AAAAA_x.pdb.gz
MCSYM-DB/5/AAAAC/
MCSYM-DB/5/AAAAC/5-AAAAC.mcs
MCSYM-DB/5/AAAAC/ss-5-AAAAC_x.pdb.gz
MCSYM-DB/5/AAAAG/
MCSYM-DB/5/AAAAG/5-AAAAG.mcs
MCSYM-DB/5/AAAAG/ss-5-AAAAG_x.pdb.gz
MCSYM-DB/5/AAAAU/
MCSYM-DB/5/AAAAU/5-AAAAU.mcs
MCSYM-DB/5/AAAAU/ss-5-AAAAU_x.pdb.gz
MCSYM-DB/5/AAACA/
MCSYM-DB/5/AAACA/5-AAACA.mcs
MCSYM-DB/5/AAACA/ss-5-AAACA_x.pdb.gz
MCSYM-DB/5/AAACC/
MCSYM-DB/5/AAACC/5-AAACC.mcs
MCSYM-DB/5/AAACC/ss-5-AAACC_x.pdb.gz
MCSYM-DB/5/AAACG/
MCSYM-DB/5/AAACG/5-AAACG.mcs
MCSYM-DB/5/AAACG/ss-5-AAACG_x.pdb.gz
MCSYM-DB/5/AAACU/
MCSYM-DB/5/AAACU/5-AAACU.mcs
MCSYM-DB/5/AAACU/ss-5-AAACU_x.pdb.gz
MCSYM-DB/5/AAAGA/
MCSYM-DB/5/AAAGA/5-AAAGA.mcs
MCSYM-DB/5/AAAGA/ss-5-AAAGA_x.pdb.gz
MCSYM-DB/5/AAAGC/
MCSYM-DB/5/AAAGC/5-AAAGC.mcs
MCSYM-DB/5/AAAGC/ss-5-AAAGC_x.pdb.gz
MCSYM-DB/5/AAAGG/
MCSYM-DB/5/AAAGG/5-AAAGG.mcs
MCSYM-DB/5/AAAGG/ss-5-AAAGG_x.pdb.gz
MCSYM-DB/5/AAAGU/
MCSYM-DB/5/AAAGU/5-AAAGU.mcs
MCSYM-DB/5/AAAGU/ss-5-AAAGU_x.pdb.gz
MCSYM-DB/5/AAAUA/
MCSYM-DB/5/AAAUA/5-AAAUA.mcs
MCSYM-DB/5/AAAUA/ss-5-AAAUA_x.pdb.gz
MCSYM-DB/5/AAAUC/
MCSYM-DB/5/AAAUC/5-AAAUC.mcs
MCSYM-DB/5/AAAUC/ss-5-AAAUC_x.pdb.gz
MCSYM-DB/5/AAAUG/
MCSYM-DB/5/AAAUG/5-AAAUG.mcs
MCSYM-DB/5/AAAUG/ss-5-AAAUG_x.pdb.gz
MCSYM-DB/5/AAAUU/
MCSYM-DB/5/AAAUU/5-AAAUU.mcs
MCSYM-DB/5/AAAUU/ss-5-AAAUU_x.pdb.gz
MCSYM-DB/5/AACAA/
MCSYM-DB/5/AACAA/1B23_model_1.pdb.gz
MCSYM-DB/5/AACAA/1U0B_model_1.pdb.gz
MCSYM-DB/5/AACAA/5-AACAA.mcs
MCSYM-DB/5/AACAA/ss-5-AACAA_x.pdb.gz
MCSYM-DB/5/AACAC/
MCSYM-DB/5/AACAC/5-AACAC.mcs
MCSYM-DB/5/AACAC/ss-5-AACAC_x.pdb.gz
MCSYM-DB/5/AACAG/
MCSYM-DB/5/AACAG/5-AACAG.mcs
MCSYM-DB/5/AACAG/ss-5-AACAG_x.pdb.gz
MCSYM-DB/5/AACAU/
MCSYM-DB/5/AACAU/5-AACAU.mcs
MCSYM-DB/5/AACAU/ss-5-AACAU_x.pdb.gz
MCSYM-DB/5/AACCA/
MCSYM-DB/5/AACCA/5-AACCA.mcs
MCSYM-DB/5/AACCA/ss-5-AACCA_x.pdb.gz
MCSYM-DB/5/AACCC/
MCSYM-DB/5/AACCC/5-AACCC.mcs
MCSYM-DB/5/AACCC/ss-5-AACCC_x.pdb.gz
MCSYM-DB/5/AACCG/
MCSYM-DB/5/AACCG/5-AACCG.mcs
MCSYM-DB/5/AACCG/ss-5-AACCG_x.pdb.gz
MCSYM-DB/5/AACCU/
MCSYM-DB/5/AACCU/5-AACCU.mcs
MCSYM-DB/5/AACCU/ss-5-AACCU_x.pdb.gz
MCSYM-DB/5/AACGA/
MCSYM-DB/5/AACGA/5-AACGA.mcs
MCSYM-DB/5/AACGA/ss-5-AACGA_x.pdb.gz
MCSYM-DB/5/AACGC/
MCSYM-DB/5/AACGC/5-AACGC.mcs
MCSYM-DB/5/AACGC/ss-5-AACGC_x.pdb.gz
MCSYM-DB/5/AACGG/
MCSYM-DB/5/AACGG/5-AACGG.mcs
MCSYM-DB/5/AACGG/ss-5-AACGG_x.pdb.gz
MCSYM-DB/5/AACGU/
MCSYM-DB/5/AACGU/5-AACGU.mcs
MCSYM-DB/5/AACGU/ss-5-AACGU_x.pdb.gz
MCSYM-DB/5/AACUA/
MCSYM-DB/5/AACUA/5-AACUA.mcs
MCSYM-DB/5/AACUA/ss-5-AACUA_x.pdb.gz
MCSYM-DB/5/AACUC/
MCSYM-DB/5/AACUC/5-AACUC.mcs
MCSYM-DB/5/AACUC/ss-5-AACUC_x.pdb.gz
MCSYM-DB/5/AACUG/
MCSYM-DB/5/AACUG/5-AACUG.mcs
MCSYM-DB/5/AACUG/ss-5-AACUG_x.pdb.gz
MCSYM-DB/5/AACUU/
MCSYM-DB/5/AACUU/5-AACUU.mcs
MCSYM-DB/5/AACUU/ss-5-AACUU_x.pdb.gz
MCSYM-DB/5/AAGAA/
MCSYM-DB/5/AAGAA/5-AAGAA.mcs
MCSYM-DB/5/AAGAA/ss-5-AAGAA_x.pdb.gz
MCSYM-DB/5/AAGAC/
MCSYM-DB/5/AAGAC/5-AAGAC.mcs
MCSYM-DB/5/AAGAC/ss-5-AAGAC_x.pdb.gz
MCSYM-DB/5/AAGAG/
MCSYM-DB/5/AAGAG/5-AAGAG.mcs
MCSYM-DB/5/AAGAG/ss-5-AAGAG_x.pdb.gz
MCSYM-DB/5/AAGAU/
MCSYM-DB/5/AAGAU/5-AAGAU.mcs
MCSYM-DB/5/AAGAU/ss-5-AAGAU_x.pdb.gz
MCSYM-DB/5/AAGCA/
MCSYM-DB/5/AAGCA/5-AAGCA.mcs
MCSYM-DB/5/AAGCA/ss-5-AAGCA_x.pdb.gz
MCSYM-DB/5/AAGCC/
MCSYM-DB/5/AAGCC/5-AAGCC.mcs
MCSYM-DB/5/AAGCC/ss-5-AAGCC_x.pdb.gz
MCSYM-DB/5/AAGCG/
MCSYM-DB/5/AAGCG/5-AAGCG.mcs
MCSYM-DB/5/AAGCG/ss-5-AAGCG_x.pdb.gz
MCSYM-DB/5/AAGCU/
MCSYM-DB/5/AAGCU/5-AAGCU.mcs
MCSYM-DB/5/AAGCU/ss-5-AAGCU_x.pdb.gz
MCSYM-DB/5/AAGGA/
MCSYM-DB/5/AAGGA/5-AAGGA.mcs
MCSYM-DB/5/AAGGA/ss-5-AAGGA_x.pdb.gz
MCSYM-DB/5/AAGGC/
MCSYM-DB/5/AAGGC/5-AAGGC.mcs
MCSYM-DB/5/AAGGC/ss-5-AAGGC_x.pdb.gz
MCSYM-DB/5/AAGGG/
MCSYM-DB/5/AAGGG/5-AAGGG.mcs
MCSYM-DB/5/AAGGG/ss-5-AAGGG_x.pdb.gz
MCSYM-DB/5/AAGGU/
MCSYM-DB/5/AAGGU/5-AAGGU.mcs
MCSYM-DB/5/AAGGU/ss-5-AAGGU_x.pdb.gz
MCSYM-DB/5/AAGUA/
MCSYM-DB/5/AAGUA/5-AAGUA.mcs
MCSYM-DB/5/AAGUA/ss-5-AAGUA_x.pdb.gz
MCSYM-DB/5/AAGUG/
MCSYM-DB/5/AAGUG/5-AAGUG.mcs
MCSYM-DB/5/AAGUG/ss-5-AAGUG_x.pdb.gz
MCSYM-DB/5/AAGUU/
MCSYM-DB/5/AAGUU/5-AAGUU.mcs
MCSYM-DB/5/AAGUU/ss-5-AAGUU_x.pdb.gz
MCSYM-DB/5/AAUAA/
MCSYM-DB/5/AAUAA/5-AAUAA.mcs
MCSYM-DB/5/AAUAA/ss-5-AAUAA_x.pdb.gz
MCSYM-DB/5/AAUAC/
MCSYM-DB/5/AAUAC/5-AAUAC.mcs
MCSYM-DB/5/AAUAC/ss-5-AAUAC_x.pdb.gz
MCSYM-DB/5/AAUAG/
MCSYM-DB/5/AAUAG/5-AAUAG.mcs
MCSYM-DB/5/AAUAG/ss-5-AAUAG_x.pdb.gz
MCSYM-DB/5/AAUAU/
MCSYM-DB/5/AAUAU/5-AAUAU.mcs
MCSYM-DB/5/AAUAU/ss-5-AAUAU_x.pdb.gz
MCSYM-DB/5/AAUCA/
MCSYM-DB/5/AAUCA/5-AAUCA.mcs
MCSYM-DB/5/AAUCA/ss-5-AAUCA_x.pdb.gz
MCSYM-DB/5/AAUCC/
MCSYM-DB/5/AAUCC/5-AAUCC.mcs
MCSYM-DB/5/AAUCC/ss-5-AAUCC_x.pdb.gz
MCSYM-DB/5/AAUCG/
MCSYM-DB/5/AAUCG/5-AAUCG.mcs
MCSYM-DB/5/AAUCG/ss-5-AAUCG_x.pdb.gz
MCSYM-DB/5/AAUCU/
MCSYM-DB/5/AAUCU/5-AAUCU.mcs
MCSYM-DB/5/AAUCU/ss-5-AAUCU_x.pdb.gz
MCSYM-DB/5/AAUGA/
MCSYM-DB/5/AAUGA/5-AAUGA.mcs
MCSYM-DB/5/AAUGA/ss-5-AAUGA_x.pdb.gz
MCSYM-DB/5/AAUGC/
MCSYM-DB/5/AAUGC/5-AAUGC.mcs
MCSYM-DB/5/AAUGC/ss-5-AAUGC_x.pdb.gz
MCSYM-DB/5/AAUGG/
MCSYM-DB/5/AAUGG/5-AAUGG.mcs
MCSYM-DB/5/AAUGG/ss-5-AAUGG_x.pdb.gz
MCSYM-DB/5/AAUGU/
MCSYM-DB/5/AAUGU/5-AAUGU.mcs
MCSYM-DB/5/AAUGU/ss-5-AAUGU_x.pdb.gz
MCSYM-DB/5/AAUUA/
MCSYM-DB/5/AAUUA/5-AAUUA.mcs
MCSYM-DB/5/AAUUA/ss-5-AAUUA_x.pdb.gz
MCSYM-DB/5/AAUUC/
MCSYM-DB/5/AAUUC/5-AAUUC.mcs
MCSYM-DB/5/AAUUG/
MCSYM-DB/5/AAUUG/5-AAUUG.mcs
MCSYM-DB/5/AAUUG/ss-5-AAUUG_x.pdb.gz
MCSYM-DB/5/AAUUU/
MCSYM-DB/5/AAUUU/5-AAUUU.mcs
MCSYM-DB/5/AAUUU/ss-5-AAUUU_x.pdb.gz
MCSYM-DB/5/ACAAA/
MCSYM-DB/5/ACAAA/5-ACAAA.mcs
MCSYM-DB/5/ACAAA/ss-5-ACAAA_x.pdb.gz
MCSYM-DB/5/ACAAC/
MCSYM-DB/5/ACAAC/5-ACAAC.mcs
MCSYM-DB/5/ACAAC/ss-5-ACAAC_x.pdb.gz
MCSYM-DB/5/ACAAG/
MCSYM-DB/5/ACAAG/5-ACAAG.mcs
MCSYM-DB/5/ACAAG/ss-5-ACAAG_x.pdb.gz
MCSYM-DB/5/ACAAU/
MCSYM-DB/5/ACAAU/5-ACAAU.mcs
MCSYM-DB/5/ACAAU/ss-5-ACAAU_x.pdb.gz
MCSYM-DB/5/ACACA/
MCSYM-DB/5/ACACA/5-ACACA.mcs
MCSYM-DB/5/ACACA/ss-5-ACACA_x.pdb.gz
MCSYM-DB/5/ACACC/
MCSYM-DB/5/ACACC/5-ACACC.mcs
MCSYM-DB/5/ACACC/ss-5-ACACC_x.pdb.gz
MCSYM-DB/5/ACACG/
MCSYM-DB/5/ACACG/5-ACACG.mcs
MCSYM-DB/5/ACACG/ss-5-ACACG_x.pdb.gz
MCSYM-DB/5/ACACU/
MCSYM-DB/5/ACACU/5-ACACU.mcs
MCSYM-DB/5/ACACU/ss-5-ACACU_x.pdb.gz
MCSYM-DB/5/ACAGA/
MCSYM-DB/5/ACAGA/5-ACAGA.mcs
MCSYM-DB/5/ACAGA/ss-5-ACAGA_x.pdb.gz
MCSYM-DB/5/ACAGC/
MCSYM-DB/5/ACAGC/5-ACAGC.mcs
MCSYM-DB/5/ACAGC/ss-5-ACAGC_x.pdb.gz
MCSYM-DB/5/ACAGG/
MCSYM-DB/5/ACAGG/5-ACAGG.mcs
MCSYM-DB/5/ACAGG/ss-5-ACAGG_x.pdb.gz
MCSYM-DB/5/ACAGU/
MCSYM-DB/5/ACAGU/5-ACAGU.mcs
MCSYM-DB/5/ACAGU/ss-5-ACAGU_x.pdb.gz
MCSYM-DB/5/ACAUA/
MCSYM-DB/5/ACAUA/5-ACAUA.mcs
MCSYM-DB/5/ACAUA/ss-5-ACAUA_x.pdb.gz
MCSYM-DB/5/ACAUC/
MCSYM-DB/5/ACAUC/5-ACAUC.mcs
MCSYM-DB/5/ACAUC/ss-5-ACAUC_x.pdb.gz
MCSYM-DB/5/ACAUG/
MCSYM-DB/5/ACAUG/5-ACAUG.mcs
MCSYM-DB/5/ACAUG/ss-5-ACAUG_x.pdb.gz
MCSYM-DB/5/ACAUU/
MCSYM-DB/5/ACAUU/5-ACAUU.mcs
MCSYM-DB/5/ACAUU/ss-5-ACAUU_x.pdb.gz
MCSYM-DB/5/ACCAA/
MCSYM-DB/5/ACCAA/5-ACCAA.mcs
MCSYM-DB/5/ACCAA/ss-5-ACCAA_x.pdb.gz
MCSYM-DB/5/ACCAC/
MCSYM-DB/5/ACCAC/5-ACCAC.mcs
MCSYM-DB/5/ACCAC/ss-5-ACCAC_x.pdb.gz
MCSYM-DB/5/ACCAG/
MCSYM-DB/5/ACCAG/5-ACCAG.mcs
MCSYM-DB/5/ACCAG/ss-5-ACCAG_x.pdb.gz
MCSYM-DB/5/ACCAU/
MCSYM-DB/5/ACCAU/5-ACCAU.mcs
MCSYM-DB/5/ACCAU/ss-5-ACCAU_x.pdb.gz
MCSYM-DB/5/ACCCA/
MCSYM-DB/5/ACCCA/5-ACCCA.mcs
MCSYM-DB/5/ACCCA/ss-5-ACCCA_x.pdb.gz
MCSYM-DB/5/ACCCC/
MCSYM-DB/5/ACCCC/5-ACCCC.mcs
MCSYM-DB/5/ACCCC/ss-5-ACCCC_x.pdb.gz
MCSYM-DB/5/ACCCG/
MCSYM-DB/5/ACCCG/5-ACCCG.mcs
MCSYM-DB/5/ACCCG/ss-5-ACCCG_x.pdb.gz
MCSYM-DB/5/ACCCU/
MCSYM-DB/5/ACCCU/5-ACCCU.mcs
MCSYM-DB/5/ACCCU/ss-5-ACCCU_x.pdb.gz
MCSYM-DB/5/ACCGA/
MCSYM-DB/5/ACCGA/5-ACCGA.mcs
MCSYM-DB/5/ACCGA/ss-5-ACCGA_x.pdb.gz
MCSYM-DB/5/ACCGC/
MCSYM-DB/5/ACCGC/5-ACCGC.mcs
MCSYM-DB/5/ACCGC/ss-5-ACCGC_x.pdb.gz
MCSYM-DB/5/ACCGG/
MCSYM-DB/5/ACCGG/5-ACCGG.mcs
MCSYM-DB/5/ACCGG/ss-5-ACCGG_x.pdb.gz
MCSYM-DB/5/ACCGU/
MCSYM-DB/5/ACCGU/5-ACCGU.mcs
MCSYM-DB/5/ACCGU/ss-5-ACCGU_x.pdb.gz
MCSYM-DB/5/ACCUA/
MCSYM-DB/5/ACCUA/5-ACCUA.mcs
MCSYM-DB/5/ACCUA/ss-5-ACCUA_x.pdb.gz
MCSYM-DB/5/ACCUC/
MCSYM-DB/5/ACCUC/5-ACCUC.mcs
MCSYM-DB/5/ACCUC/ss-5-ACCUC_x.pdb.gz
MCSYM-DB/5/ACCUG/
MCSYM-DB/5/ACCUG/5-ACCUG.mcs
MCSYM-DB/5/ACCUG/ss-5-ACCUG_x.pdb.gz
MCSYM-DB/5/ACCUU/
MCSYM-DB/5/ACCUU/5-ACCUU.mcs
MCSYM-DB/5/ACCUU/ss-5-ACCUU_x.pdb.gz
MCSYM-DB/5/ACGAA/
MCSYM-DB/5/ACGAA/5-ACGAA.mcs
MCSYM-DB/5/ACGAA/ss-5-ACGAA_x.pdb.gz
MCSYM-DB/5/ACGAG/
MCSYM-DB/5/ACGAG/5-ACGAG.mcs
MCSYM-DB/5/ACGAG/ss-5-ACGAG_x.pdb.gz
MCSYM-DB/5/ACGAU/
MCSYM-DB/5/ACGAU/5-ACGAU.mcs
MCSYM-DB/5/ACGAU/ss-5-ACGAU_x.pdb.gz
MCSYM-DB/5/ACGCA/
MCSYM-DB/5/ACGCA/5-ACGCA.mcs
MCSYM-DB/5/ACGCA/ss-5-ACGCA_x.pdb.gz
MCSYM-DB/5/ACGCC/
MCSYM-DB/5/ACGCC/5-ACGCC.mcs
MCSYM-DB/5/ACGCC/ss-5-ACGCC_x.pdb.gz
MCSYM-DB/5/ACGCU/
MCSYM-DB/5/ACGCU/5-ACGCU.mcs
MCSYM-DB/5/ACGCU/ss-5-ACGCU_x.pdb.gz
MCSYM-DB/5/ACGGA/
MCSYM-DB/5/ACGGA/5-ACGGA.mcs
MCSYM-DB/5/ACGGA/ss-5-ACGGA_x.pdb.gz
MCSYM-DB/5/ACGGC/
MCSYM-DB/5/ACGGC/5-ACGGC.mcs
MCSYM-DB/5/ACGGC/ss-5-ACGGC_x.pdb.gz
MCSYM-DB/5/ACGGG/
MCSYM-DB/5/ACGGG/5-ACGGG.mcs
MCSYM-DB/5/ACGGG/ss-5-ACGGG_x.pdb.gz
MCSYM-DB/5/ACGGU/
MCSYM-DB/5/ACGGU/5-ACGGU.mcs
MCSYM-DB/5/ACGGU/ss-5-ACGGU_x.pdb.gz
MCSYM-DB/5/ACGUG/
MCSYM-DB/5/ACGUG/5-ACGUG.mcs
MCSYM-DB/5/ACGUG/ss-5-ACGUG_x.pdb.gz
MCSYM-DB/5/ACGUU/
MCSYM-DB/5/ACGUU/5-ACGUU.mcs
MCSYM-DB/5/ACGUU/ss-5-ACGUU_x.pdb.gz
MCSYM-DB/5/ACUAA/
MCSYM-DB/5/ACUAA/5-ACUAA.mcs
MCSYM-DB/5/ACUAA/ss-5-ACUAA_x.pdb.gz
MCSYM-DB/5/ACUAC/
MCSYM-DB/5/ACUAC/5-ACUAC.mcs
MCSYM-DB/5/ACUAC/ss-5-ACUAC_x.pdb.gz
MCSYM-DB/5/ACUAG/
MCSYM-DB/5/ACUAG/5-ACUAG.mcs
MCSYM-DB/5/ACUAG/ss-5-ACUAG_x.pdb.gz
MCSYM-DB/5/ACUAU/
MCSYM-DB/5/ACUAU/5-ACUAU.mcs
MCSYM-DB/5/ACUAU/5-ACUAU.pdb.gz
MCSYM-DB/5/ACUAU/ss-5-ACUAU_x.pdb.gz
MCSYM-DB/5/ACUCA/
MCSYM-DB/5/ACUCA/5-ACUCA.mcs
MCSYM-DB/5/ACUCA/ss-5-ACUCA_x.pdb.gz
MCSYM-DB/5/ACUCC/
MCSYM-DB/5/ACUCC/5-ACUCC.mcs
MCSYM-DB/5/ACUCC/ss-5-ACUCC_x.pdb.gz
MCSYM-DB/5/ACUCG/
MCSYM-DB/5/ACUCG/5-ACUCG.mcs
MCSYM-DB/5/ACUCG/ss-5-ACUCG_x.pdb.gz
MCSYM-DB/5/ACUCU/
MCSYM-DB/5/ACUCU/5-ACUCU.mcs
MCSYM-DB/5/ACUCU/ss-5-ACUCU_x.pdb.gz
MCSYM-DB/5/ACUGA/
MCSYM-DB/5/ACUGA/5-ACUGA.mcs
MCSYM-DB/5/ACUGA/ss-5-ACUGA_x.pdb.gz
MCSYM-DB/5/ACUGC/
MCSYM-DB/5/ACUGC/5-ACUGC.mcs
MCSYM-DB/5/ACUGC/ss-5-ACUGC_x.pdb.gz
MCSYM-DB/5/ACUGG/
MCSYM-DB/5/ACUGG/5-ACUGG.mcs
MCSYM-DB/5/ACUGG/ss-5-ACUGG_x.pdb.gz
MCSYM-DB/5/ACUGU/
MCSYM-DB/5/ACUGU/5-ACUGU.mcs
MCSYM-DB/5/ACUGU/ss-5-ACUGU_x.pdb.gz
MCSYM-DB/5/ACUUA/
MCSYM-DB/5/ACUUA/5-ACUUA.mcs
MCSYM-DB/5/ACUUC/
MCSYM-DB/5/ACUUC/5-ACUUC.mcs
MCSYM-DB/5/ACUUC/ss-5-ACUUC_x.pdb.gz
MCSYM-DB/5/ACUUG/
MCSYM-DB/5/ACUUG/5-ACUUG.mcs
MCSYM-DB/5/ACUUG/ss-5-ACUUG_x.pdb.gz
MCSYM-DB/5/ACUUU/
MCSYM-DB/5/ACUUU/5-ACUUU.mcs
MCSYM-DB/5/ACUUU/5-ACUUU.pdb.gz
MCSYM-DB/5/ACUUU/ss-5-ACUUU_x.pdb.gz
MCSYM-DB/5/AGAAA/
MCSYM-DB/5/AGAAA/5-AGAAA.mcs
MCSYM-DB/5/AGAAA/ss-5-AGAAA_x.pdb.gz
MCSYM-DB/5/AGAAC/
MCSYM-DB/5/AGAAC/5-AGAAC.mcs
MCSYM-DB/5/AGAAC/ss-5-AGAAC_x.pdb.gz
MCSYM-DB/5/AGAAG/
MCSYM-DB/5/AGAAG/5-AGAAG.mcs
MCSYM-DB/5/AGAAG/ss-5-AGAAG_x.pdb.gz
MCSYM-DB/5/AGAAU/
MCSYM-DB/5/AGAAU/5-AGAAU.mcs
MCSYM-DB/5/AGAAU/ss-5-AGAAU_x.pdb.gz
MCSYM-DB/5/AGACA/
MCSYM-DB/5/AGACA/5-AGACA.mcs
MCSYM-DB/5/AGACA/ss-5-AGACA_x.pdb.gz
MCSYM-DB/5/AGACC/
MCSYM-DB/5/AGACC/5-AGACC.mcs
MCSYM-DB/5/AGACC/ss-5-AGACC_x.pdb.gz
MCSYM-DB/5/AGACG/
MCSYM-DB/5/AGACG/5-AGACG.mcs
MCSYM-DB/5/AGACG/ss-5-AGACG_x.pdb.gz
MCSYM-DB/5/AGACU/
MCSYM-DB/5/AGACU/5-AGACU.mcs
MCSYM-DB/5/AGACU/ss-5-AGACU_x.pdb.gz
MCSYM-DB/5/AGAGA/
MCSYM-DB/5/AGAGA/5-AGAGA.mcs
MCSYM-DB/5/AGAGA/ss-5-AGAGA_x.pdb.gz
MCSYM-DB/5/AGAGC/
MCSYM-DB/5/AGAGC/5-AGAGC.mcs
MCSYM-DB/5/AGAGC/ss-5-AGAGC_x.pdb.gz
MCSYM-DB/5/AGAGG/
MCSYM-DB/5/AGAGG/5-AGAGG.mcs
MCSYM-DB/5/AGAGG/ss-5-AGAGG_x.pdb.gz
MCSYM-DB/5/AGAGU/
MCSYM-DB/5/AGAGU/5-AGAGU.mcs
MCSYM-DB/5/AGAGU/ss-5-AGAGU_x.pdb.gz
MCSYM-DB/5/AGAUA/
MCSYM-DB/5/AGAUA/5-AGAUA.mcs
MCSYM-DB/5/AGAUA/ss-5-AGAUA_x.pdb.gz
MCSYM-DB/5/AGAUC/
MCSYM-DB/5/AGAUC/5-AGAUC.mcs
MCSYM-DB/5/AGAUC/ss-5-AGAUC_x.pdb.gz
MCSYM-DB/5/AGAUG/
MCSYM-DB/5/AGAUG/5-AGAUG.mcs
MCSYM-DB/5/AGAUG/ss-5-AGAUG_x.pdb.gz
MCSYM-DB/5/AGAUU/
MCSYM-DB/5/AGAUU/5-AGAUU.mcs
MCSYM-DB/5/AGAUU/ss-5-AGAUU_x.pdb.gz
MCSYM-DB/5/AGCAA/
MCSYM-DB/5/AGCAA/5-AGCAA.mcs
MCSYM-DB/5/AGCAA/ss-5-AGCAA_x.pdb.gz
MCSYM-DB/5/AGCAC/
MCSYM-DB/5/AGCAC/5-AGCAC.mcs
MCSYM-DB/5/AGCAC/ss-5-AGCAC_x.pdb.gz
MCSYM-DB/5/AGCAG/
MCSYM-DB/5/AGCAG/5-AGCAG.mcs
MCSYM-DB/5/AGCAG/ss-5-AGCAG_x.pdb.gz
MCSYM-DB/5/AGCAU/
MCSYM-DB/5/AGCAU/5-AGCAU.mcs
MCSYM-DB/5/AGCAU/ss-5-AGCAU_x.pdb.gz
MCSYM-DB/5/AGCCA/
MCSYM-DB/5/AGCCA/5-AGCCA.mcs
MCSYM-DB/5/AGCCA/ss-5-AGCCA_x.pdb.gz
MCSYM-DB/5/AGCCC/
MCSYM-DB/5/AGCCC/5-AGCCC.mcs
MCSYM-DB/5/AGCCC/ss-5-AGCCC_x.pdb.gz
MCSYM-DB/5/AGCCG/
MCSYM-DB/5/AGCCG/5-AGCCG.mcs
MCSYM-DB/5/AGCCG/ss-5-AGCCG_x.pdb.gz
MCSYM-DB/5/AGCCU/
MCSYM-DB/5/AGCCU/5-AGCCU.mcs
MCSYM-DB/5/AGCCU/ss-5-AGCCU_x.pdb.gz
MCSYM-DB/5/AGCGA/
MCSYM-DB/5/AGCGA/5-AGCGA.mcs
MCSYM-DB/5/AGCGA/ss-5-AGCGA_x.pdb.gz
MCSYM-DB/5/AGCGC/
MCSYM-DB/5/AGCGC/5-AGCGC.mcs
MCSYM-DB/5/AGCGC/ss-5-AGCGC_x.pdb.gz
MCSYM-DB/5/AGCGG/
MCSYM-DB/5/AGCGG/5-AGCGG.mcs
MCSYM-DB/5/AGCGG/ss-5-AGCGG_x.pdb.gz
MCSYM-DB/5/AGCGU/
MCSYM-DB/5/AGCGU/5-AGCGU.mcs
MCSYM-DB/5/AGCGU/ss-5-AGCGU_x.pdb.gz
MCSYM-DB/5/AGCUA/
MCSYM-DB/5/AGCUA/5-AGCUA.mcs
MCSYM-DB/5/AGCUA/ss-5-AGCUA_x.pdb.gz
MCSYM-DB/5/AGCUC/
MCSYM-DB/5/AGCUC/5-AGCUC.mcs
MCSYM-DB/5/AGCUC/ss-5-AGCUC_x.pdb.gz
MCSYM-DB/5/AGCUG/
MCSYM-DB/5/AGCUG/5-AGCUG.mcs
MCSYM-DB/5/AGCUG/ss-5-AGCUG_x.pdb.gz
MCSYM-DB/5/AGCUU/
MCSYM-DB/5/AGCUU/5-AGCUU.mcs
MCSYM-DB/5/AGCUU/ss-5-AGCUU_x.pdb.gz
MCSYM-DB/5/AGGAA/
MCSYM-DB/5/AGGAA/5-AGGAA.mcs
MCSYM-DB/5/AGGAA/ss-5-AGGAA_x.pdb.gz
MCSYM-DB/5/AGGAC/
MCSYM-DB/5/AGGAC/5-AGGAC.mcs
MCSYM-DB/5/AGGAC/ss-5-AGGAC_x.pdb.gz
MCSYM-DB/5/AGGAG/
MCSYM-DB/5/AGGAG/5-AGGAG.mcs
MCSYM-DB/5/AGGAG/ss-5-AGGAG_x.pdb.gz
MCSYM-DB/5/AGGAU/
MCSYM-DB/5/AGGAU/5-AGGAU.mcs
MCSYM-DB/5/AGGAU/ss-5-AGGAU_x.pdb.gz
MCSYM-DB/5/AGGCA/
MCSYM-DB/5/AGGCA/5-AGGCA.mcs
MCSYM-DB/5/AGGCA/ss-5-AGGCA_x.pdb.gz
MCSYM-DB/5/AGGCC/
MCSYM-DB/5/AGGCC/5-AGGCC.mcs
MCSYM-DB/5/AGGCC/ss-5-AGGCC_x.pdb.gz
MCSYM-DB/5/AGGCG/
MCSYM-DB/5/AGGCG/5-AGGCG.mcs
MCSYM-DB/5/AGGCG/ss-5-AGGCG_x.pdb.gz
MCSYM-DB/5/AGGCU/
MCSYM-DB/5/AGGCU/5-AGGCU.mcs
MCSYM-DB/5/AGGCU/ss-5-AGGCU_x.pdb.gz
MCSYM-DB/5/AGGGA/
MCSYM-DB/5/AGGGA/5-AGGGA.mcs
MCSYM-DB/5/AGGGC/
MCSYM-DB/5/AGGGC/5-AGGGC.mcs
MCSYM-DB/5/AGGGC/ss-5-AGGGC_x.pdb.gz
MCSYM-DB/5/AGGGG/
MCSYM-DB/5/AGGGG/5-AGGGG.mcs
MCSYM-DB/5/AGGGG/ss-5-AGGGG_x.pdb.gz
MCSYM-DB/5/AU/
MCSYM-DB/5/AU/5-AU.mcs
MCSYM-DB/5/AU/ss-5-AU_x.pdb.gz
MCSYM-DB/5/AGGGU/
MCSYM-DB/5/AGGGU/5-AGGGU.mcs
MCSYM-DB/5/AGGGU/ss-5-AGGGU_x.pdb.gz
MCSYM-DB/5/AGGUA/
MCSYM-DB/5/AGGUA/5-AGGUA.mcs
MCSYM-DB/5/AGGUA/ss-5-AGGUA_x.pdb.gz
MCSYM-DB/5/AGGUC/
MCSYM-DB/5/AGGUC/5-AGGUC.mcs
MCSYM-DB/5/AGGUG/
MCSYM-DB/5/AGGUG/5-AGGUG.mcs
MCSYM-DB/5/AGGUG/ss-5-AGGUG_x.pdb.gz
MCSYM-DB/5/AGGUU/
MCSYM-DB/5/AGGUU/5-AGGUU.mcs
MCSYM-DB/5/AGGUU/ss-5-AGGUU_x.pdb.gz
MCSYM-DB/5/AGUAA/
MCSYM-DB/5/AGUAA/5-AGUAA.mcs
MCSYM-DB/5/AGUAA/ss-5-AGUAA_x.pdb.gz
MCSYM-DB/5/AGUAC/
MCSYM-DB/5/AGUAC/5-AGUAC.mcs
MCSYM-DB/5/AGUAC/ss-5-AGUAC_x.pdb.gz
MCSYM-DB/5/AGUAG/
MCSYM-DB/5/AGUAG/5-AGUAG.mcs
MCSYM-DB/5/AGUAG/ss-5-AGUAG_x.pdb.gz
MCSYM-DB/5/AGUAU/
MCSYM-DB/5/AGUAU/1VQ7_model_1.pdb.gz
MCSYM-DB/5/AGUAU/5-AGUAU.mcs
MCSYM-DB/5/AGUAU/ss-5-AGUAU_x.pdb.gz
MCSYM-DB/5/AGUCA/
MCSYM-DB/5/AGUCA/5-AGUCA.mcs
MCSYM-DB/5/AGUCA/ss-5-AGUCA_x.pdb.gz
MCSYM-DB/5/AGUCC/
MCSYM-DB/5/AGUCC/5-AGUCC.mcs
MCSYM-DB/5/AGUCC/ss-5-AGUCC_x.pdb.gz
MCSYM-DB/5/AGUCG/
MCSYM-DB/5/AGUCG/5-AGUCG.mcs
MCSYM-DB/5/AGUCG/ss-5-AGUCG_x.pdb.gz
MCSYM-DB/5/AGUCU/
MCSYM-DB/5/AGUCU/5-AGUCU.mcs
MCSYM-DB/5/AGUCU/ss-5-AGUCU_x.pdb.gz
MCSYM-DB/5/AGUGA/
MCSYM-DB/5/AGUGA/5-AGUGA.mcs
MCSYM-DB/5/AGUGA/ss-5-AGUGA_x.pdb.gz
MCSYM-DB/5/AGUGC/
MCSYM-DB/5/AGUGC/5-AGUGC.mcs
MCSYM-DB/5/AGUGC/ss-5-AGUGC_x.pdb.gz
MCSYM-DB/5/AGUGG/
MCSYM-DB/5/AGUGG/5-AGUGG.mcs
MCSYM-DB/5/AGUGG/ss-5-AGUGG_x.pdb.gz
MCSYM-DB/5/AGUGU/
MCSYM-DB/5/AGUGU/5-AGUGU.mcs
MCSYM-DB/5/AGUGU/ss-5-AGUGU_x.pdb.gz
MCSYM-DB/5/AGUUC/
MCSYM-DB/5/AGUUC/5-AGUUC.mcs
MCSYM-DB/5/AGUUG/
MCSYM-DB/5/AGUUG/5-AGUUG.mcs
MCSYM-DB/5/AGUUG/ss-5-AGUUG_x.pdb.gz
MCSYM-DB/5/AGUUU/
MCSYM-DB/5/AGUUU/5-AGUUU.mcs
MCSYM-DB/5/AGUUU/ss-5-AGUUU_x.pdb.gz
MCSYM-DB/5/AUAAA/
MCSYM-DB/5/AUAAA/5-AUAAA.mcs
MCSYM-DB/5/AUAAA/ss-5-AUAAA_x.pdb.gz
MCSYM-DB/5/AUAAC/
MCSYM-DB/5/AUAAC/5-AUAAC.mcs
MCSYM-DB/5/AUAAC/ss-5-AUAAC_x.pdb.gz
MCSYM-DB/5/AUAAG/
MCSYM-DB/5/AUAAG/5-AUAAG.mcs
MCSYM-DB/5/AUAAG/ss-5-AUAAG_x.pdb.gz
MCSYM-DB/5/AUAAU/
MCSYM-DB/5/AUAAU/5-AUAAU.mcs
MCSYM-DB/5/AUAAU/ss-5-AUAAU_x.pdb.gz
MCSYM-DB/5/AUACA/
MCSYM-DB/5/AUACA/5-AUACA.mcs
MCSYM-DB/5/AUACA/ss-5-AUACA_x.pdb.gz
MCSYM-DB/5/AUACC/
MCSYM-DB/5/AUACC/5-AUACC.mcs
MCSYM-DB/5/AUACC/ss-5-AUACC_x.pdb.gz
MCSYM-DB/5/AUACU/
MCSYM-DB/5/AUACU/5-AUACU.mcs
MCSYM-DB/5/AUACU/ss-5-AUACU_x.pdb.gz
MCSYM-DB/5/AUAGA/
MCSYM-DB/5/AUAGA/5-AUAGA.mcs
MCSYM-DB/5/AUAGA/ss-5-AUAGA_x.pdb.gz
MCSYM-DB/5/AUAGC/
MCSYM-DB/5/AUAGC/5-AUAGC.mcs
MCSYM-DB/5/AUAGC/ss-5-AUAGC_x.pdb.gz
MCSYM-DB/5/AUAGG/
MCSYM-DB/5/AUAGG/5-AUAGG.mcs
MCSYM-DB/5/AUAGG/ss-5-AUAGG_x.pdb.gz
MCSYM-DB/5/AUAGU/
MCSYM-DB/5/AUAGU/5-AUAGU.mcs
MCSYM-DB/5/AUAGU/ss-5-AUAGU_x.pdb.gz
MCSYM-DB/5/AUAUA/
MCSYM-DB/5/AUAUA/5-AUAUA.mcs
MCSYM-DB/5/AUAUA/5-AUAUA.pdb.gz
MCSYM-DB/5/AUAUA/ss-5-AUAUA_x.pdb.gz
MCSYM-DB/5/AUAUC/
MCSYM-DB/5/AUAUC/5-AUAUC.mcs
MCSYM-DB/5/AUAUC/ss-5-AUAUC_x.pdb.gz
MCSYM-DB/5/AUAUG/
MCSYM-DB/5/AUAUG/5-AUAUG.mcs
MCSYM-DB/5/AUAUG/ss-5-AUAUG_x.pdb
MCSYM-DB/5/AUAUG/ss-5-AUAUG_x.pdb.gz
MCSYM-DB/5/AUAUU/
MCSYM-DB/5/AUAUU/5-AUAUU.mcs
MCSYM-DB/5/AUAUU/5-AUAUU.pdb.gz
MCSYM-DB/5/AUAUU/ss-5-AUAUU_x.pdb.gz
MCSYM-DB/5/AUCAA/
MCSYM-DB/5/AUCAA/5-AUCAA.mcs
MCSYM-DB/5/AUCAA/ss-5-AUCAA_x.pdb.gz
MCSYM-DB/5/AUCAC/
MCSYM-DB/5/AUCAC/5-AUCAC.mcs
MCSYM-DB/5/AUCAC/ss-5-AUCAC_x.pdb.gz
MCSYM-DB/5/AUCAG/
MCSYM-DB/5/AUCAG/5-AUCAG.mcs
MCSYM-DB/5/AUCAG/ss-5-AUCAG_x.pdb.gz
MCSYM-DB/5/AUCAU/
MCSYM-DB/5/AUCAU/5-AUCAU.mcs
MCSYM-DB/5/AUCAU/ss-5-AUCAU_x.pdb.gz
MCSYM-DB/5/AUCCA/
MCSYM-DB/5/AUCCA/5-AUCCA.mcs
MCSYM-DB/5/AUCCA/ss-5-AUCCA_x.pdb.gz
MCSYM-DB/5/AUCCC/
MCSYM-DB/5/AUCCC/5-AUCCC.mcs
MCSYM-DB/5/AUCCC/ss-5-AUCCC_x.pdb.gz
MCSYM-DB/5/AUCCG/
MCSYM-DB/5/AUCCG/5-AUCCG.mcs
MCSYM-DB/5/AUCCG/ss-5-AUCCG_x.pdb.gz
MCSYM-DB/5/AUCCU/
MCSYM-DB/5/AUCCU/5-AUCCU.mcs
MCSYM-DB/5/AUCCU/ss-5-AUCCU_x.pdb.gz
MCSYM-DB/5/AUCGA/
MCSYM-DB/5/AUCGA/5-AUCGA.mcs
MCSYM-DB/5/AUCGA/ss-5-AUCGA_x.pdb.gz
MCSYM-DB/5/AUCGC/
MCSYM-DB/5/AUCGC/5-AUCGC.mcs
MCSYM-DB/5/AUCGC/ss-5-AUCGC_x.pdb.gz
MCSYM-DB/5/AUCGG/
MCSYM-DB/5/AUCGG/5-AUCGG.mcs
MCSYM-DB/5/AUCGG/ss-5-AUCGG_x.pdb.gz
MCSYM-DB/5/AUCGU/
MCSYM-DB/5/AUCGU/5-AUCGU.mcs
MCSYM-DB/5/AUCGU/ss-5-AUCGU_x.pdb.gz
MCSYM-DB/5/AUCUA/
MCSYM-DB/5/AUCUA/5-AUCUA.mcs
MCSYM-DB/5/AUCUA/ss-5-AUCUA_x.pdb.gz
MCSYM-DB/5/AUCUC/
MCSYM-DB/5/AUCUC/5-AUCUC.mcs
MCSYM-DB/5/AUCUC/ss-5-AUCUC_x.pdb.gz
MCSYM-DB/5/AUCUG/
MCSYM-DB/5/AUCUG/5-AUCUG.mcs
MCSYM-DB/5/AUCUG/ss-5-AUCUG_x.pdb.gz
MCSYM-DB/5/AUCUU/
MCSYM-DB/5/AUCUU/5-AUCUU.mcs
MCSYM-DB/5/AUCUU/ss-5-AUCUU_x.pdb.gz
MCSYM-DB/5/AUGAA/
MCSYM-DB/5/AUGAA/5-AUGAA.mcs
MCSYM-DB/5/AUGAA/ss-5-AUGAA_x.pdb.gz
MCSYM-DB/5/AUGAC/
MCSYM-DB/5/AUGAC/5-AUGAC.mcs
MCSYM-DB/5/AUGAC/ss-5-AUGAC_x.pdb.gz
MCSYM-DB/5/AUGAG/
MCSYM-DB/5/AUGAG/5-AUGAG.mcs
MCSYM-DB/5/AUGAG/ss-5-AUGAG_x.pdb.gz
MCSYM-DB/5/AUGAU/
MCSYM-DB/5/AUGAU/5-AUGAU.mcs
MCSYM-DB/5/AUGAU/ss-5-AUGAU_x.pdb.gz
MCSYM-DB/5/AUGCA/
MCSYM-DB/5/AUGCA/5-AUGCA.mcs
MCSYM-DB/5/AUGCA/ss-5-AUGCA_x.pdb.gz
MCSYM-DB/5/AUGCC/
MCSYM-DB/5/AUGCC/5-AUGCC.mcs
MCSYM-DB/5/AUGCC/5-AUGCC.pdb.gz
MCSYM-DB/5/AUGCC/ss-5-AUGCC_x.pdb
MCSYM-DB/5/AUGCC/ss-5-AUGCC_x.pdb.gz
MCSYM-DB/5/AUGCG/
MCSYM-DB/5/AUGCG/5-AUGCG.mcs
MCSYM-DB/5/AUGCG/ss-5-AUGCG_x.pdb.gz
MCSYM-DB/5/AUGCU/
MCSYM-DB/5/AUGCU/5-AUGCU.mcs
MCSYM-DB/5/AUGCU/ss-5-AUGCU_x.pdb.gz
MCSYM-DB/5/AUGGA/
MCSYM-DB/5/AUGGA/5-AUGGA.mcs
MCSYM-DB/5/AUGGA/ss-5-AUGGA_x.pdb.gz
MCSYM-DB/5/AUGGC/
MCSYM-DB/5/AUGGC/5-AUGGC.mcs
MCSYM-DB/5/AUGGC/ss-5-AUGGC_x.pdb.gz
MCSYM-DB/5/AUGGG/
MCSYM-DB/5/AUGGG/5-AUGGG.mcs
MCSYM-DB/5/AUGGG/ss-5-AUGGG_x.pdb.gz
MCSYM-DB/5/AUGGU/
MCSYM-DB/5/AUGGU/5-AUGGU.mcs
MCSYM-DB/5/AUGGU/ss-5-AUGGU_x.pdb.gz
MCSYM-DB/5/AUGUA/
MCSYM-DB/5/AUGUA/5-AUGUA.mcs
MCSYM-DB/5/AUGUA/ss-5-AUGUA_x.pdb.gz
MCSYM-DB/5/AUGUC/
MCSYM-DB/5/AUGUC/5-AUGUC.mcs
MCSYM-DB/5/AUGUC/ss-5-AUGUC_x.pdb.gz
MCSYM-DB/5/AUGUG/
MCSYM-DB/5/AUGUG/5-AUGUG.mcs
MCSYM-DB/5/AUGUG/ss-5-AUGUG_x.pdb.gz
MCSYM-DB/5/AUGUU/
MCSYM-DB/5/AUGUU/5-AUGUU.mcs
MCSYM-DB/5/AUGUU/ss-5-AUGUU_x.pdb.gz
MCSYM-DB/5/AUUAA/
MCSYM-DB/5/AUUAA/5-AUUAA.mcs
MCSYM-DB/5/AUUAA/ss-5-AUUAA_x.pdb.gz
MCSYM-DB/5/AUUAC/
MCSYM-DB/5/AUUAC/5-AUUAC.mcs
MCSYM-DB/5/AUUAC/ss-5-AUUAC_x.pdb.gz
MCSYM-DB/5/AUUAG/
MCSYM-DB/5/AUUAG/5-AUUAG.mcs
MCSYM-DB/5/AUUAG/ss-5-AUUAG_x.pdb.gz
MCSYM-DB/5/AUUAU/
MCSYM-DB/5/AUUAU/5-AUUAU.mcs
MCSYM-DB/5/AUUAU/ss-5-AUUAU_x.pdb.gz
MCSYM-DB/5/AUUCA/
MCSYM-DB/5/AUUCA/5-AUUCA.mcs
MCSYM-DB/5/AUUCA/ss-5-AUUCA_x.pdb.gz
MCSYM-DB/5/AUUCC/
MCSYM-DB/5/AUUCC/5-AUUCC.mcs
MCSYM-DB/5/AUUCC/ss-5-AUUCC_x.pdb.gz
MCSYM-DB/5/AUUCG/
MCSYM-DB/5/AUUCG/5-AUUCG.mcs
MCSYM-DB/5/AUUCG/ss-5-AUUCG_x.pdb.gz
MCSYM-DB/5/AUUCU/
MCSYM-DB/5/AUUCU/5-AUUCU.mcs
MCSYM-DB/5/AUUCU/ss-5-AUUCU_x.pdb.gz
MCSYM-DB/5/AUUGA/
MCSYM-DB/5/AUUGA/5-AUUGA.mcs
MCSYM-DB/5/AUUGA/ss-5-AUUGA_x.pdb.gz
MCSYM-DB/5/AUUGC/
MCSYM-DB/5/AUUGC/5-AUUGC.mcs
MCSYM-DB/5/AUUGC/ss-5-AUUGC_x.pdb.gz
MCSYM-DB/5/AUUGG/
MCSYM-DB/5/AUUGG/5-AUUGG.mcs
MCSYM-DB/5/AUUGG/ss-5-AUUGG_x.pdb.gz
MCSYM-DB/5/AUUGU/
MCSYM-DB/5/AUUGU/5-AUUGU.mcs
MCSYM-DB/5/AUUGU/ss-5-AUUGU_x.pdb.gz
MCSYM-DB/5/AUUUA/
MCSYM-DB/5/AUUUA/5-AUUUA.mcs
MCSYM-DB/5/AUUUA/ss-5-AUUUA_x.pdb.gz
MCSYM-DB/5/AUUUC/
MCSYM-DB/5/AUUUC/5-AUUUC.mcs
MCSYM-DB/5/AUUUC/ss-5-AUUUC_x.pdb.gz
MCSYM-DB/5/AUUUG/
MCSYM-DB/5/AUUUG/5-AUUUG.mcs
MCSYM-DB/5/AUUUG/ss-5-AUUUG_x.pdb.gz
MCSYM-DB/5/AUUUU/
MCSYM-DB/5/AUUUU/5-AUUUU.mcs
MCSYM-DB/5/AUUUU/ss-5-AUUUU_x.pdb.gz
MCSYM-DB/5/CAAAA/
MCSYM-DB/5/CAAAA/5-CAAAA.mcs
MCSYM-DB/5/CAAAA/ss-5-CAAAA_x.pdb.gz
MCSYM-DB/5/CAAAC/
MCSYM-DB/5/CAAAC/5-CAAAC.mcs
MCSYM-DB/5/CAAAC/ss-5-CAAAC_x.pdb.gz
MCSYM-DB/5/CAAAG/
MCSYM-DB/5/CAAAG/5-CAAAG.mcs
MCSYM-DB/5/CAAAG/ss-5-CAAAG_x.pdb.gz
MCSYM-DB/5/CAAAU/
MCSYM-DB/5/CAAAU/5-CAAAU.mcs
MCSYM-DB/5/CAAAU/ss-5-CAAAU_x.pdb.gz
MCSYM-DB/5/CAACA/
MCSYM-DB/5/CAACA/5-CAACA.mcs
MCSYM-DB/5/CAACA/ss-5-CAACA_x.pdb.gz
MCSYM-DB/5/CAACC/
MCSYM-DB/5/CAACC/5-CAACC.mcs
MCSYM-DB/5/CAACC/ss-5-CAACC_x.pdb.gz
MCSYM-DB/5/CAACG/
MCSYM-DB/5/CAACG/5-CAACG.mcs
MCSYM-DB/5/CAACG/ss-5-CAACG_x.pdb.gz
MCSYM-DB/5/CAACU/
MCSYM-DB/5/CAACU/5-CAACU.mcs
MCSYM-DB/5/CAACU/ss-5-CAACU_x.pdb.gz
MCSYM-DB/5/CAAGA/
MCSYM-DB/5/CAAGA/5-CAAGA.mcs
MCSYM-DB/5/CAAGA/ss-5-CAAGA_x.pdb.gz
MCSYM-DB/5/CAAGC/
MCSYM-DB/5/CAAGC/5-CAAGC.mcs
MCSYM-DB/5/CAAGC/ss-5-CAAGC_x.pdb.gz
MCSYM-DB/5/CAAGG/
MCSYM-DB/5/CAAGG/5-CAAGG.mcs
MCSYM-DB/5/CAAGG/ss-5-CAAGG_x.pdb.gz
MCSYM-DB/5/CAAUA/
MCSYM-DB/5/CAAUA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/CAAUA/5-CAAUA.mcs
MCSYM-DB/5/CAAUA/ss-5-CAAUA_x.pdb.gz
MCSYM-DB/5/CAAUC/
MCSYM-DB/5/CAAUC/5-CAAUC.mcs
MCSYM-DB/5/CAAUC/ss-5-CAAUC_x.pdb.gz
MCSYM-DB/5/CAAUG/
MCSYM-DB/5/CAAUG/5-CAAUG.mcs
MCSYM-DB/5/CAAUG/ss-5-CAAUG_x.pdb.gz
MCSYM-DB/5/CAAUU/
MCSYM-DB/5/CAAUU/5-CAAUU.mcs
MCSYM-DB/5/CACAA/
MCSYM-DB/5/CACAA/5-CACAA.mcs
MCSYM-DB/5/CACAA/ss-5-CACAA_x.pdb.gz
MCSYM-DB/5/CACAC/
MCSYM-DB/5/CACAC/5-CACAC.mcs
MCSYM-DB/5/CACAC/ss-5-CACAC_x.pdb.gz
MCSYM-DB/5/CACAG/
MCSYM-DB/5/CACAG/5-CACAG.mcs
MCSYM-DB/5/CACAG/ss-5-CACAG_x.pdb.gz
MCSYM-DB/5/CACAU/
MCSYM-DB/5/CACAU/5-CACAU.mcs
MCSYM-DB/5/CACAU/ss-5-CACAU_x.pdb.gz
MCSYM-DB/5/CACCA/
MCSYM-DB/5/CACCA/5-CACCA.mcs
MCSYM-DB/5/CACCA/ss-5-CACCA_x.pdb.gz
MCSYM-DB/5/CACCC/
MCSYM-DB/5/CACCC/5-CACCC.mcs
MCSYM-DB/5/CACCC/ss-5-CACCC_x.pdb.gz
MCSYM-DB/5/CACCG/
MCSYM-DB/5/CACCG/1L2X_model_1.pdb.gz
MCSYM-DB/5/CACCG/2A43_model_1.pdb.gz
MCSYM-DB/5/CACCG/5-CACCG.mcs
MCSYM-DB/5/CACCG/ss-5-CACCG_x.pdb.gz
MCSYM-DB/5/CACCU/
MCSYM-DB/5/CACCU/5-CACCU.mcs
MCSYM-DB/5/CACCU/ss-5-CACCU_x.pdb.gz
MCSYM-DB/5/CACGA/
MCSYM-DB/5/CACGA/5-CACGA.mcs
MCSYM-DB/5/CACGG/
MCSYM-DB/5/CACGG/5-CACGG.mcs
MCSYM-DB/5/CACGG/ss-5-CACGG_x.pdb.gz
MCSYM-DB/5/CACGU/
MCSYM-DB/5/CACGU/5-CACGU.mcs
MCSYM-DB/5/CACGU/ss-5-CACGU_x.pdb.gz
MCSYM-DB/5/CACUA/
MCSYM-DB/5/CACUA/5-CACUA.mcs
MCSYM-DB/5/CACUA/ss-5-CACUA_x.pdb.gz
MCSYM-DB/5/CACUC/
MCSYM-DB/5/CACUC/5-CACUC.mcs
MCSYM-DB/5/CACUC/ss-5-CACUC_x.pdb.gz
MCSYM-DB/5/CACUG/
MCSYM-DB/5/CACUG/5-CACUG.mcs
MCSYM-DB/5/CACUG/ss-5-CACUG_x.pdb.gz
MCSYM-DB/5/CACUU/
MCSYM-DB/5/CACUU/5-CACUU.mcs
MCSYM-DB/5/CACUU/ss-5-CACUU_x.pdb.gz
MCSYM-DB/5/CAGAA/
MCSYM-DB/5/CAGAA/5-CAGAA.mcs
MCSYM-DB/5/CAGAA/ss-5-CAGAA_x.pdb.gz
MCSYM-DB/5/CAGAC/
MCSYM-DB/5/CAGAC/5-CAGAC.mcs
MCSYM-DB/5/CAGAC/ss-5-CAGAC_x.pdb.gz
MCSYM-DB/5/CAGAG/
MCSYM-DB/5/CAGAG/5-CAGAG.mcs
MCSYM-DB/5/CAGAG/ss-5-CAGAG_x.pdb.gz
MCSYM-DB/5/CAGAU/
MCSYM-DB/5/CAGAU/5-CAGAU.mcs
MCSYM-DB/5/CAGAU/ss-5-CAGAU_x.pdb.gz
MCSYM-DB/5/CAGCA/
MCSYM-DB/5/CAGCA/5-CAGCA.mcs
MCSYM-DB/5/CAGCA/ss-5-CAGCA_x.pdb.gz
MCSYM-DB/5/CAGCC/
MCSYM-DB/5/CAGCC/5-CAGCC.mcs
MCSYM-DB/5/CAGCC/ss-5-CAGCC_x.pdb.gz
MCSYM-DB/5/CAGCG/
MCSYM-DB/5/CAGCG/5-CAGCG.mcs
MCSYM-DB/5/CAGCG/ss-5-CAGCG_x.pdb.gz
MCSYM-DB/5/CAGCU/
MCSYM-DB/5/CAGCU/5-CAGCU.mcs
MCSYM-DB/5/CAGCU/ss-5-CAGCU_x.pdb.gz
MCSYM-DB/5/CAGGA/
MCSYM-DB/5/CAGGA/5-CAGGA.mcs
MCSYM-DB/5/CAGGA/ss-5-CAGGA_x.pdb.gz
MCSYM-DB/5/CAGGC/
MCSYM-DB/5/CAGGC/5-CAGGC.mcs
MCSYM-DB/5/CAGGC/ss-5-CAGGC_x.pdb.gz
MCSYM-DB/5/CAGGG/
MCSYM-DB/5/CAGGG/5-CAGGG.mcs
MCSYM-DB/5/CAGGG/ss-5-CAGGG_x.pdb.gz
MCSYM-DB/5/CAGGU/
MCSYM-DB/5/CAGGU/5-CAGGU.mcs
MCSYM-DB/5/CAGGU/ss-5-CAGGU_x.pdb.gz
MCSYM-DB/5/CAGUA/
MCSYM-DB/5/CAGUA/5-CAGUA.mcs
MCSYM-DB/5/CAGUA/ss-5-CAGUA_x.pdb.gz
MCSYM-DB/5/CAGUC/
MCSYM-DB/5/CAGUC/5-CAGUC.mcs
MCSYM-DB/5/CAGUC/ss-5-CAGUC_x.pdb.gz
MCSYM-DB/5/CAGUG/
MCSYM-DB/5/CAGUG/1NBR_model_1.pdb.gz
MCSYM-DB/5/CAGUG/5-CAGUG.mcs
MCSYM-DB/5/CAGUG/5-CAGUG.pdb.gz
MCSYM-DB/5/CAGUG/ss-5-CAGUG_x.pdb.gz
MCSYM-DB/5/CAGUU/
MCSYM-DB/5/CAGUU/5-CAGUU.mcs
MCSYM-DB/5/CAUAA/
MCSYM-DB/5/CAUAA/5-CAUAA.mcs
MCSYM-DB/5/CAUAA/ss-5-CAUAA_x.pdb.gz
MCSYM-DB/5/CAUAC/
MCSYM-DB/5/CAUAC/5-CAUAC.mcs
MCSYM-DB/5/CAUAC/ss-5-CAUAC_x.pdb.gz
MCSYM-DB/5/CAUAG/
MCSYM-DB/5/CAUAG/5-CAUAG.mcs
MCSYM-DB/5/CAUAG/ss-5-CAUAG_x.pdb.gz
MCSYM-DB/5/CAUAU/
MCSYM-DB/5/CAUAU/5-CAUAU.mcs
MCSYM-DB/5/CAUAU/ss-5-CAUAU_x.pdb.gz
MCSYM-DB/5/CAUCA/
MCSYM-DB/5/CAUCA/5-CAUCA.mcs
MCSYM-DB/5/CAUCA/ss-5-CAUCA_x.pdb.gz
MCSYM-DB/5/CAUCC/
MCSYM-DB/5/CAUCC/5-CAUCC.mcs
MCSYM-DB/5/CAUCC/ss-5-CAUCC_x.pdb.gz
MCSYM-DB/5/CAUCG/
MCSYM-DB/5/CAUCG/5-CAUCG.mcs
MCSYM-DB/5/CAUCG/ss-5-CAUCG_x.pdb
MCSYM-DB/5/CAUCG/ss-5-CAUCG_x.pdb.gz
MCSYM-DB/5/CAUCU/
MCSYM-DB/5/CAUCU/5-CAUCU.mcs
MCSYM-DB/5/CAUCU/ss-5-CAUCU_x.pdb.gz
MCSYM-DB/5/CAUGA/
MCSYM-DB/5/CAUGA/5-CAUGA.mcs
MCSYM-DB/5/CAUGA/ss-5-CAUGA_x.pdb.gz
MCSYM-DB/5/CAUGC/
MCSYM-DB/5/CAUGC/5-CAUGC.mcs
MCSYM-DB/5/CAUGC/ss-5-CAUGC_x.pdb.gz
MCSYM-DB/5/CAUGG/
MCSYM-DB/5/CAUGG/1JZC_model_1.pdb.gz
MCSYM-DB/5/CAUGG/5-CAUGG.mcs
MCSYM-DB/5/CAUGG/ss-5-CAUGG_x.pdb.gz
MCSYM-DB/5/CAUGU/
MCSYM-DB/5/CAUGU/5-CAUGU.mcs
MCSYM-DB/5/CAUGU/ss-5-CAUGU_x.pdb.gz
MCSYM-DB/5/CAUUA/
MCSYM-DB/5/CAUUA/5-CAUUA.mcs
MCSYM-DB/5/CAUUA/ss-5-CAUUA_x.pdb.gz
MCSYM-DB/5/CAUUC/
MCSYM-DB/5/CAUUC/5-CAUUC.mcs
MCSYM-DB/5/CAUUC/ss-5-CAUUC_x.pdb.gz
MCSYM-DB/5/CAUUG/
MCSYM-DB/5/CAUUG/5-CAUUG.mcs
MCSYM-DB/5/CAUUG/ss-5-CAUUG_x.pdb.gz
MCSYM-DB/5/CAUUU/
MCSYM-DB/5/CAUUU/5-CAUUU.mcs
MCSYM-DB/5/CCAAA/
MCSYM-DB/5/CCAAA/5-CCAAA.mcs
MCSYM-DB/5/CCAAA/ss-5-CCAAA_x.pdb.gz
MCSYM-DB/5/CCAAC/
MCSYM-DB/5/CCAAC/5-CCAAC.mcs
MCSYM-DB/5/CCAAC/ss-5-CCAAC_x.pdb.gz
MCSYM-DB/5/CCAAG/
MCSYM-DB/5/CCAAG/5-CCAAG.mcs
MCSYM-DB/5/CCAAG/ss-5-CCAAG_x.pdb.gz
MCSYM-DB/5/CCAAU/
MCSYM-DB/5/CCAAU/5-CCAAU.mcs
MCSYM-DB/5/CCAAU/ss-5-CCAAU_x.pdb.gz
MCSYM-DB/5/CCACA/
MCSYM-DB/5/CCACA/5-CCACA.mcs
MCSYM-DB/5/CCACA/ss-5-CCACA_x.pdb.gz
MCSYM-DB/5/CCACC/
MCSYM-DB/5/CCACC/5-CCACC.mcs
MCSYM-DB/5/CCACC/ss-5-CCACC_x.pdb.gz
MCSYM-DB/5/CCACG/
MCSYM-DB/5/CCACG/5-CCACG.mcs
MCSYM-DB/5/CCACG/ss-5-CCACG_x.pdb.gz
MCSYM-DB/5/CCACU/
MCSYM-DB/5/CCACU/5-CCACU.mcs
MCSYM-DB/5/CCACU/ss-5-CCACU_x.pdb.gz
MCSYM-DB/5/CCAGA/
MCSYM-DB/5/CCAGA/5-CCAGA.mcs
MCSYM-DB/5/CCAGA/ss-5-CCAGA_x.pdb.gz
MCSYM-DB/5/CCAGC/
MCSYM-DB/5/CCAGC/5-CCAGC.mcs
MCSYM-DB/5/CCAGC/ss-5-CCAGC_x.pdb.gz
MCSYM-DB/5/CCAGG/
MCSYM-DB/5/CCAGG/5-CCAGG.mcs
MCSYM-DB/5/CCAGG/ss-5-CCAGG_x.pdb.gz
MCSYM-DB/5/CCAGU/
MCSYM-DB/5/CCAGU/5-CCAGU.mcs
MCSYM-DB/5/CCAGU/ss-5-CCAGU_x.pdb.gz
MCSYM-DB/5/CCAUA/
MCSYM-DB/5/CCAUA/5-CCAUA.mcs
MCSYM-DB/5/CCAUA/ss-5-CCAUA_x.pdb.gz
MCSYM-DB/5/CCAUC/
MCSYM-DB/5/CCAUC/5-CCAUC.mcs
MCSYM-DB/5/CCAUC/ss-5-CCAUC_x.pdb.gz
MCSYM-DB/5/CCAUG/
MCSYM-DB/5/CCAUG/1VQ7_model_1.pdb.gz
MCSYM-DB/5/CCAUG/5-CCAUG.mcs
MCSYM-DB/5/CCAUG/ss-5-CCAUG_x.pdb.gz
MCSYM-DB/5/CCAUU/
MCSYM-DB/5/CCAUU/5-CCAUU.mcs
MCSYM-DB/5/CCAUU/ss-5-CCAUU_x.pdb.gz
MCSYM-DB/5/CCCAA/
MCSYM-DB/5/CCCAA/5-CCCAA.mcs
MCSYM-DB/5/CCCAA/ss-5-CCCAA_x.pdb.gz
MCSYM-DB/5/CCCAC/
MCSYM-DB/5/CCCAC/5-CCCAC.mcs
MCSYM-DB/5/CCCAC/ss-5-CCCAC_x.pdb.gz
MCSYM-DB/5/CCCAG/
MCSYM-DB/5/CCCAG/5-CCCAG.mcs
MCSYM-DB/5/CCCAG/ss-5-CCCAG_x.pdb.gz
MCSYM-DB/5/CCCAU/
MCSYM-DB/5/CCCAU/5-CCCAU.mcs
MCSYM-DB/5/CCCAU/ss-5-CCCAU_x.pdb.gz
MCSYM-DB/5/CCCCA/
MCSYM-DB/5/CCCCA/5-CCCCA.mcs
MCSYM-DB/5/CCCCA/ss-5-CCCCA_x.pdb.gz
MCSYM-DB/5/CCCCC/
MCSYM-DB/5/CCCCC/5-CCCCC.mcs
MCSYM-DB/5/CCCCC/ss-5-CCCCC_x.pdb.gz
MCSYM-DB/5/CCCCG/
MCSYM-DB/5/CCCCG/5-CCCCG.mcs
MCSYM-DB/5/CCCCG/ss-5-CCCCG_x.pdb.gz
MCSYM-DB/5/CCCCU/
MCSYM-DB/5/CCCCU/5-CCCCU.mcs
MCSYM-DB/5/CCCCU/ss-5-CCCCU_x.pdb.gz
MCSYM-DB/5/CCCGA/
MCSYM-DB/5/CCCGA/5-CCCGA.mcs
MCSYM-DB/5/CCCGA/ss-5-CCCGA_x.pdb.gz
MCSYM-DB/5/CCCGC/
MCSYM-DB/5/CCCGC/5-CCCGC.mcs
MCSYM-DB/5/CCCGC/ss-5-CCCGC_x.pdb.gz
MCSYM-DB/5/CCCGG/
MCSYM-DB/5/CCCGG/1XMQ_model_1.pdb.gz
MCSYM-DB/5/CCCGG/5-CCCGG.mcs
MCSYM-DB/5/CCCGG/ss-5-CCCGG_x.pdb.gz
MCSYM-DB/5/CCCGU/
MCSYM-DB/5/CCCGU/5-CCCGU.mcs
MCSYM-DB/5/CCCGU/ss-5-CCCGU_x.pdb.gz
MCSYM-DB/5/CCCUA/
MCSYM-DB/5/CCCUA/5-CCCUA.mcs
MCSYM-DB/5/CCCUA/ss-5-CCCUA_x.pdb.gz
MCSYM-DB/5/CCCUC/
MCSYM-DB/5/CCCUC/5-CCCUC.mcs
MCSYM-DB/5/CCCUC/ss-5-CCCUC_x.pdb.gz
MCSYM-DB/5/CCCUG/
MCSYM-DB/5/CCCUG/5-CCCUG.mcs
MCSYM-DB/5/CCCUG/5-CCCUG.pdb.gz
MCSYM-DB/5/CCCUG/ss-5-CCCUG_x.pdb.gz
MCSYM-DB/5/CCCUU/
MCSYM-DB/5/CCCUU/5-CCCUU.mcs
MCSYM-DB/5/CCCUU/ss-5-CCCUU_x.pdb.gz
MCSYM-DB/5/CCGAA/
MCSYM-DB/5/CCGAA/5-CCGAA.mcs
MCSYM-DB/5/CCGAA/ss-5-CCGAA_x.pdb.gz
MCSYM-DB/5/CCGAC/
MCSYM-DB/5/CCGAC/5-CCGAC.mcs
MCSYM-DB/5/CCGAC/ss-5-CCGAC_x.pdb.gz
MCSYM-DB/5/CCGAG/
MCSYM-DB/5/CCGAG/5-CCGAG.mcs
MCSYM-DB/5/CCGAG/ss-5-CCGAG_x.pdb.gz
MCSYM-DB/5/CCGAU/
MCSYM-DB/5/CCGAU/5-CCGAU.mcs
MCSYM-DB/5/CCGAU/ss-5-CCGAU_x.pdb.gz
MCSYM-DB/5/CCGCC/
MCSYM-DB/5/CCGCC/5-CCGCC.mcs
MCSYM-DB/5/CCGCC/ss-5-CCGCC_x.pdb.gz
MCSYM-DB/5/CCGCG/
MCSYM-DB/5/CCGCG/5-CCGCG.mcs
MCSYM-DB/5/CCGCG/ss-5-CCGCG_x.pdb.gz
MCSYM-DB/5/CCGCU/
MCSYM-DB/5/CCGCU/5-CCGCU.mcs
MCSYM-DB/5/CCGCU/ss-5-CCGCU_x.pdb.gz
MCSYM-DB/5/CCGGA/
MCSYM-DB/5/CCGGA/5-CCGGA.mcs
MCSYM-DB/5/CCGGA/ss-5-CCGGA_x.pdb.gz
MCSYM-DB/5/CCGGC/
MCSYM-DB/5/CCGGC/5-CCGGC.mcs
MCSYM-DB/5/CCGGC/ss-5-CCGGC_x.pdb.gz
MCSYM-DB/5/CCGGG/
MCSYM-DB/5/CCGGG/5-CCGGG.mcs
MCSYM-DB/5/CCGGG/ss-5-CCGGG_x.pdb.gz
MCSYM-DB/5/CCGGU/
MCSYM-DB/5/CCGGU/5-CCGGU.mcs
MCSYM-DB/5/CCGGU/ss-5-CCGGU_x.pdb.gz
MCSYM-DB/5/CCGUA/
MCSYM-DB/5/CCGUA/5-CCGUA.mcs
MCSYM-DB/5/CCGUA/ss-5-CCGUA_x.pdb.gz
MCSYM-DB/5/CCGUC/
MCSYM-DB/5/CCGUC/5-CCGUC.mcs
MCSYM-DB/5/CCGUC/ss-5-CCGUC_x.pdb.gz
MCSYM-DB/5/CCGUG/
MCSYM-DB/5/CCGUG/5-CCGUG.mcs
MCSYM-DB/5/CCGUG/ss-5-CCGUG_x.pdb.gz
MCSYM-DB/5/CCGUU/
MCSYM-DB/5/CCGUU/5-CCGUU.mcs
MCSYM-DB/5/CCGUU/ss-5-CCGUU_x.pdb.gz
MCSYM-DB/5/CCUAA/
MCSYM-DB/5/CCUAA/5-CCUAA.mcs
MCSYM-DB/5/CCUAA/ss-5-CCUAA_x.pdb.gz
MCSYM-DB/5/CCUAC/
MCSYM-DB/5/CCUAC/5-CCUAC.mcs
MCSYM-DB/5/CCUAC/ss-5-CCUAC_x.pdb.gz
MCSYM-DB/5/CCUAG/
MCSYM-DB/5/CCUAG/5-CCUAG.mcs
MCSYM-DB/5/CCUAG/ss-5-CCUAG_x.pdb.gz
MCSYM-DB/5/CCUAU/
MCSYM-DB/5/CCUAU/5-CCUAU.mcs
MCSYM-DB/5/CCUAU/ss-5-CCUAU_x.pdb.gz
MCSYM-DB/5/CCUCA/
MCSYM-DB/5/CCUCA/5-CCUCA.mcs
MCSYM-DB/5/CCUCA/ss-5-CCUCA_x.pdb.gz
MCSYM-DB/5/CCUCC/
MCSYM-DB/5/CCUCC/5-CCUCC.mcs
MCSYM-DB/5/CCUCC/ss-5-CCUCC_x.pdb.gz
MCSYM-DB/5/CCUCG/
MCSYM-DB/5/CCUCG/5-CCUCG.mcs
MCSYM-DB/5/CCUCG/ss-5-CCUCG_x.pdb.gz
MCSYM-DB/5/CCUCU/
MCSYM-DB/5/CCUCU/5-CCUCU.mcs
MCSYM-DB/5/CCUCU/ss-5-CCUCU_x.pdb.gz
MCSYM-DB/5/CCUGA/
MCSYM-DB/5/CCUGA/5-CCUGA.mcs
MCSYM-DB/5/CCUGA/ss-5-CCUGA_x.pdb.gz
MCSYM-DB/5/CCUGC/
MCSYM-DB/5/CCUGC/5-CCUGC.mcs
MCSYM-DB/5/CCUGC/ss-5-CCUGC_x.pdb.gz
MCSYM-DB/5/CCUGG/
MCSYM-DB/5/CCUGG/5-CCUGG.mcs
MCSYM-DB/5/CCUGG/ss-5-CCUGG_x.pdb.gz
MCSYM-DB/5/CCUGU/
MCSYM-DB/5/CCUGU/5-CCUGU.mcs
MCSYM-DB/5/CCUGU/ss-5-CCUGU_x.pdb.gz
MCSYM-DB/5/CCUUA/
MCSYM-DB/5/CCUUA/5-CCUUA.mcs
MCSYM-DB/5/CCUUA/ss-5-CCUUA_x.pdb.gz
MCSYM-DB/5/CCUUC/
MCSYM-DB/5/CCUUC/5-CCUUC.mcs
MCSYM-DB/5/CCUUC/ss-5-CCUUC_x.pdb.gz
MCSYM-DB/5/CCUUG/
MCSYM-DB/5/CCUUG/5-CCUUG.mcs
MCSYM-DB/5/CCUUG/ss-5-CCUUG_x.pdb.gz
MCSYM-DB/5/CCUUU/
MCSYM-DB/5/CCUUU/5-CCUUU.mcs
MCSYM-DB/5/CCUUU/ss-5-CCUUU_x.pdb.gz
MCSYM-DB/5/CGAAA/
MCSYM-DB/5/CGAAA/5-CGAAA.mcs
MCSYM-DB/5/CGAAA/ss-5-CGAAA_x.pdb.gz
MCSYM-DB/5/CGAAC/
MCSYM-DB/5/CGAAC/5-CGAAC.mcs
MCSYM-DB/5/CGAAC/ss-5-CGAAC_x.pdb.gz
MCSYM-DB/5/CGAAG/
MCSYM-DB/5/CGAAG/5-CGAAG.mcs
MCSYM-DB/5/CGAAG/ss-5-CGAAG_x.pdb.gz
MCSYM-DB/5/CGACA/
MCSYM-DB/5/CGACA/5-CGACA.mcs
MCSYM-DB/5/CGACA/ss-5-CGACA_x.pdb.gz
MCSYM-DB/5/CGACC/
MCSYM-DB/5/CGACC/5-CGACC.mcs
MCSYM-DB/5/CGACC/ss-5-CGACC_x.pdb.gz
MCSYM-DB/5/CGACG/
MCSYM-DB/5/CGACG/5-CGACG.mcs
MCSYM-DB/5/CGACG/ss-5-CGACG_x.pdb.gz
MCSYM-DB/5/CGACU/
MCSYM-DB/5/CGACU/5-CGACU.mcs
MCSYM-DB/5/CGACU/ss-5-CGACU_x.pdb.gz
MCSYM-DB/5/CGAGA/
MCSYM-DB/5/CGAGA/5-CGAGA.mcs
MCSYM-DB/5/CGAGA/ss-5-CGAGA_x.pdb.gz
MCSYM-DB/5/CGAGC/
MCSYM-DB/5/CGAGC/5-CGAGC.mcs
MCSYM-DB/5/CGAGC/ss-5-CGAGC_x.pdb.gz
MCSYM-DB/5/CGAGG/
MCSYM-DB/5/CGAGG/5-CGAGG.mcs
MCSYM-DB/5/CGAGG/ss-5-CGAGG_x.pdb.gz
MCSYM-DB/5/CGAGU/
MCSYM-DB/5/CGAGU/5-CGAGU.mcs
MCSYM-DB/5/CGAUA/
MCSYM-DB/5/CGAUA/5-CGAUA.mcs
MCSYM-DB/5/CGAUA/ss-5-CGAUA_x.pdb.gz
MCSYM-DB/5/CGAUC/
MCSYM-DB/5/CGAUC/5-CGAUC.mcs
MCSYM-DB/5/CGAUC/ss-5-CGAUC_x.pdb.gz
MCSYM-DB/5/CGAUG/
MCSYM-DB/5/CGAUG/5-CGAUG.mcs
MCSYM-DB/5/CGAUG/ss-5-CGAUG_x.pdb.gz
MCSYM-DB/5/CGCAA/
MCSYM-DB/5/CGCAA/5-CGCAA.mcs
MCSYM-DB/5/CGCAA/ss-5-CGCAA_x.pdb.gz
MCSYM-DB/5/CGCAC/
MCSYM-DB/5/CGCAC/5-CGCAC.mcs
MCSYM-DB/5/CGCAC/ss-5-CGCAC_x.pdb.gz
MCSYM-DB/5/CGCAG/
MCSYM-DB/5/CGCAG/5-CGCAG.mcs
MCSYM-DB/5/CGCAG/ss-5-CGCAG_x.pdb.gz
MCSYM-DB/5/CGCAU/
MCSYM-DB/5/CGCAU/5-CGCAU.mcs
MCSYM-DB/5/CGCAU/ss-5-CGCAU_x.pdb.gz
MCSYM-DB/5/CGCCA/
MCSYM-DB/5/CGCCA/5-CGCCA.mcs
MCSYM-DB/5/CGCCA/ss-5-CGCCA_x.pdb.gz
MCSYM-DB/5/CGCCC/
MCSYM-DB/5/CGCCC/5-CGCCC.mcs
MCSYM-DB/5/CGCCC/ss-5-CGCCC_x.pdb.gz
MCSYM-DB/5/CGCCG/
MCSYM-DB/5/CGCCG/5-CGCCG.mcs
MCSYM-DB/5/CGCCG/ss-5-CGCCG_x.pdb.gz
MCSYM-DB/5/CGCCU/
MCSYM-DB/5/CGCCU/5-CGCCU.mcs
MCSYM-DB/5/CGCGA/
MCSYM-DB/5/CGCGA/5-CGCGA.mcs
MCSYM-DB/5/CGCGA/ss-5-CGCGA_x.pdb.gz
MCSYM-DB/5/CGCGC/
MCSYM-DB/5/CGCGC/5-CGCGC.mcs
MCSYM-DB/5/CGCGC/ss-5-CGCGC_x.pdb.gz
MCSYM-DB/5/CGCGG/
MCSYM-DB/5/CGCGG/5-CGCGG.mcs
MCSYM-DB/5/CGCGG/ss-5-CGCGG_x.pdb.gz
MCSYM-DB/5/CGCGU/
MCSYM-DB/5/CGCGU/5-CGCGU.mcs
MCSYM-DB/5/CGCGU/ss-5-CGCGU_x.pdb.gz
MCSYM-DB/5/CGCUA/
MCSYM-DB/5/CGCUA/5-CGCUA.mcs
MCSYM-DB/5/CGCUA/ss-5-CGCUA_x.pdb.gz
MCSYM-DB/5/CGCUC/
MCSYM-DB/5/CGCUC/5-CGCUC.mcs
MCSYM-DB/5/CGCUC/ss-5-CGCUC_x.pdb.gz
MCSYM-DB/5/CGCUG/
MCSYM-DB/5/CGCUG/5-CGCUG.mcs
MCSYM-DB/5/CGCUG/ss-5-CGCUG_x.pdb.gz
MCSYM-DB/5/CGGAA/
MCSYM-DB/5/CGGAA/5-CGGAA.mcs
MCSYM-DB/5/CGGAA/ss-5-CGGAA_x.pdb.gz
MCSYM-DB/5/CGGAC/
MCSYM-DB/5/CGGAC/5-CGGAC.mcs
MCSYM-DB/5/CGGAC/ss-5-CGGAC_x.pdb.gz
MCSYM-DB/5/CGGAG/
MCSYM-DB/5/CGGAG/5-CGGAG.mcs
MCSYM-DB/5/CGGAG/ss-5-CGGAG_x.pdb.gz
MCSYM-DB/5/CGGAU/
MCSYM-DB/5/CGGAU/5-CGGAU.mcs
MCSYM-DB/5/CGGAU/ss-5-CGGAU_x.pdb.gz
MCSYM-DB/5/CGGCA/
MCSYM-DB/5/CGGCA/5-CGGCA.mcs
MCSYM-DB/5/CGGCA/ss-5-CGGCA_x.pdb.gz
MCSYM-DB/5/CGGCC/
MCSYM-DB/5/CGGCC/5-CGGCC.mcs
MCSYM-DB/5/CGGCC/ss-5-CGGCC_x.pdb.gz
MCSYM-DB/5/CGGCG/
MCSYM-DB/5/CGGCG/5-CGGCG.mcs
MCSYM-DB/5/CGGCG/ss-5-CGGCG_x.pdb.gz
MCSYM-DB/5/CGGCU/
MCSYM-DB/5/CGGCU/5-CGGCU.mcs
MCSYM-DB/5/CGGCU/ss-5-CGGCU_x.pdb.gz
MCSYM-DB/5/CGGGA/
MCSYM-DB/5/CGGGA/5-CGGGA.mcs
MCSYM-DB/5/CGGGA/ss-5-CGGGA_x.pdb.gz
MCSYM-DB/5/CGGGC/
MCSYM-DB/5/CGGGC/5-CGGGC.mcs
MCSYM-DB/5/CGGGC/ss-5-CGGGC_x.pdb.gz
MCSYM-DB/5/CGGGG/
MCSYM-DB/5/CGGGG/5-CGGGG.mcs
MCSYM-DB/5/CGGGG/ss-5-CGGGG_x.pdb.gz
MCSYM-DB/5/CGGGU/
MCSYM-DB/5/CGGGU/5-CGGGU.mcs
MCSYM-DB/5/CGGUA/
MCSYM-DB/5/CGGUA/5-CGGUA.mcs
MCSYM-DB/5/CGGUA/ss-5-CGGUA_x.pdb.gz
MCSYM-DB/5/CGGUC/
MCSYM-DB/5/CGGUC/5-CGGUC.mcs
MCSYM-DB/5/CGGUC/ss-5-CGGUC_x.pdb.gz
MCSYM-DB/5/CGGUG/
MCSYM-DB/5/CGGUG/5-CGGUG.mcs
MCSYM-DB/5/CGGUG/ss-5-CGGUG_x.pdb.gz
MCSYM-DB/5/CGUAA/
MCSYM-DB/5/CGUAA/5-CGUAA.mcs
MCSYM-DB/5/CGUAC/
MCSYM-DB/5/CGUAC/5-CGUAC.mcs
MCSYM-DB/5/CGUAC/ss-5-CGUAC_x.pdb.gz
MCSYM-DB/5/CGUAG/
MCSYM-DB/5/CGUAG/5-CGUAG.mcs
MCSYM-DB/5/CGUAG/ss-5-CGUAG_x.pdb.gz
MCSYM-DB/5/CGUCA/
MCSYM-DB/5/CGUCA/5-CGUCA.mcs
MCSYM-DB/5/CGUCA/ss-5-CGUCA_x.pdb.gz
MCSYM-DB/5/CGUCC/
MCSYM-DB/5/CGUCC/5-CGUCC.mcs
MCSYM-DB/5/CGUCC/ss-5-CGUCC_x.pdb.gz
MCSYM-DB/5/CGUCG/
MCSYM-DB/5/CGUCG/5-CGUCG.mcs
MCSYM-DB/5/CGUCG/ss-5-CGUCG_x.pdb.gz
MCSYM-DB/5/CGUCU/
MCSYM-DB/5/CGUCU/5-CGUCU.mcs
MCSYM-DB/5/CGUCU/ss-5-CGUCU_x.pdb.gz
MCSYM-DB/5/CGUGA/
MCSYM-DB/5/CGUGA/5-CGUGA.mcs
MCSYM-DB/5/CGUGA/ss-5-CGUGA_x.pdb.gz
MCSYM-DB/5/CGUGC/
MCSYM-DB/5/CGUGC/5-CGUGC.mcs
MCSYM-DB/5/CGUGC/ss-5-CGUGC_x.pdb.gz
MCSYM-DB/5/CGUGG/
MCSYM-DB/5/CGUGG/5-CGUGG.mcs
MCSYM-DB/5/CGUGG/ss-5-CGUGG_x.pdb.gz
MCSYM-DB/5/CGUGU/
MCSYM-DB/5/CGUGU/5-CGUGU.mcs
MCSYM-DB/5/CGUGU/ss-5-CGUGU_x.pdb.gz
MCSYM-DB/5/CGUUC/
MCSYM-DB/5/CGUUC/5-CGUUC.mcs
MCSYM-DB/5/CGUUC/ss-5-CGUUC_x.pdb.gz
MCSYM-DB/5/CGUUG/
MCSYM-DB/5/CGUUG/5-CGUUG.mcs
MCSYM-DB/5/CGUUG/ss-5-CGUUG_x.pdb.gz
MCSYM-DB/5/CGUUU/
MCSYM-DB/5/CGUUU/5-CGUUU.mcs
MCSYM-DB/5/CGUUU/ss-5-CGUUU_x.pdb.gz
MCSYM-DB/5/CUAAA/
MCSYM-DB/5/CUAAA/5-CUAAA.mcs
MCSYM-DB/5/CUAAA/ss-5-CUAAA_x.pdb.gz
MCSYM-DB/5/CUAAC/
MCSYM-DB/5/CUAAC/5-CUAAC.mcs
MCSYM-DB/5/CUAAC/ss-5-CUAAC_x.pdb.gz
MCSYM-DB/5/CUAAG/
MCSYM-DB/5/CUAAG/1VQ7_model_1.pdb.gz
MCSYM-DB/5/CUAAG/2BS0_model_1.pdb.gz
MCSYM-DB/5/CUAAG/2BS1_model_1.pdb.gz
MCSYM-DB/5/CUAAG/5-CUAAG.mcs
MCSYM-DB/5/CUAAG/ss-5-CUAAG_x.pdb.gz
MCSYM-DB/5/CUAAU/
MCSYM-DB/5/CUAAU/5-CUAAU.mcs
MCSYM-DB/5/CUAAU/ss-5-CUAAU_x.pdb.gz
MCSYM-DB/5/CUACA/
MCSYM-DB/5/CUACA/5-CUACA.mcs
MCSYM-DB/5/CUACA/ss-5-CUACA_x.pdb.gz
MCSYM-DB/5/CUACC/
MCSYM-DB/5/CUACC/5-CUACC.mcs
MCSYM-DB/5/CUACC/ss-5-CUACC_x.pdb.gz
MCSYM-DB/5/CUACG/
MCSYM-DB/5/CUACG/5-CUACG.mcs
MCSYM-DB/5/CUACG/ss-5-CUACG_x.pdb.gz
MCSYM-DB/5/CUACU/
MCSYM-DB/5/CUACU/5-CUACU.mcs
MCSYM-DB/5/CUACU/ss-5-CUACU_x.pdb.gz
MCSYM-DB/5/CUAGA/
MCSYM-DB/5/CUAGA/5-CUAGA.mcs
MCSYM-DB/5/CUAGA/ss-5-CUAGA_x.pdb.gz
MCSYM-DB/5/CUAGC/
MCSYM-DB/5/CUAGC/5-CUAGC.mcs
MCSYM-DB/5/CUAGC/ss-5-CUAGC_x.pdb.gz
MCSYM-DB/5/CUAGG/
MCSYM-DB/5/CUAGG/5-CUAGG.mcs
MCSYM-DB/5/CUAGG/ss-5-CUAGG_x.pdb.gz
MCSYM-DB/5/CUAGU/
MCSYM-DB/5/CUAGU/5-CUAGU.mcs
MCSYM-DB/5/CUAGU/ss-5-CUAGU_x.pdb.gz
MCSYM-DB/5/CUAUA/
MCSYM-DB/5/CUAUA/5-CUAUA.mcs
MCSYM-DB/5/CUAUA/ss-5-CUAUA_x.pdb.gz
MCSYM-DB/5/CUAUC/
MCSYM-DB/5/CUAUC/5-CUAUC.mcs
MCSYM-DB/5/CUAUC/ss-5-CUAUC_x.pdb.gz
MCSYM-DB/5/CUAUG/
MCSYM-DB/5/CUAUG/1IK1_model_1.pdb.gz
MCSYM-DB/5/CUAUG/5-CUAUG.mcs
MCSYM-DB/5/CUAUG/ss-5-CUAUG_x.pdb.gz
MCSYM-DB/5/CUAUU/
MCSYM-DB/5/CUAUU/5-CUAUU.mcs
MCSYM-DB/5/CUAUU/ss-5-CUAUU_x.pdb.gz
MCSYM-DB/5/CUCAA/
MCSYM-DB/5/CUCAA/1K5I_model_1.pdb.gz
MCSYM-DB/5/CUCAA/1XMQ_model_1.pdb.gz
MCSYM-DB/5/CUCAA/5-CUCAA.mcs
MCSYM-DB/5/CUCAA/ss-5-CUCAA_x.pdb.gz
MCSYM-DB/5/CUCAC/
MCSYM-DB/5/CUCAC/5-CUCAC.mcs
MCSYM-DB/5/CUCAC/ss-5-CUCAC_x.pdb.gz
MCSYM-DB/5/CUCAG/
MCSYM-DB/5/CUCAG/5-CUCAG.mcs
MCSYM-DB/5/CUCAG/ss-5-CUCAG_x.pdb.gz
MCSYM-DB/5/CUCAU/
MCSYM-DB/5/CUCAU/5-CUCAU.mcs
MCSYM-DB/5/CUCAU/ss-5-CUCAU_x.pdb.gz
MCSYM-DB/5/CUCCA/
MCSYM-DB/5/CUCCA/5-CUCCA.mcs
MCSYM-DB/5/CUCCA/ss-5-CUCCA_x.pdb.gz
MCSYM-DB/5/CUCCC/
MCSYM-DB/5/CUCCC/5-CUCCC.mcs
MCSYM-DB/5/CUCCC/ss-5-CUCCC_x.pdb.gz
MCSYM-DB/5/CUCCG/
MCSYM-DB/5/CUCCG/5-CUCCG.mcs
MCSYM-DB/5/CUCCG/ss-5-CUCCG_x.pdb.gz
MCSYM-DB/5/CUCCU/
MCSYM-DB/5/CUCCU/5-CUCCU.mcs
MCSYM-DB/5/CUCCU/ss-5-CUCCU_x.pdb.gz
MCSYM-DB/5/CUCGA/
MCSYM-DB/5/CUCGA/5-CUCGA.mcs
MCSYM-DB/5/CUCGA/ss-5-CUCGA_x.pdb.gz
MCSYM-DB/5/CUCGC/
MCSYM-DB/5/CUCGC/5-CUCGC.mcs
MCSYM-DB/5/CUCGC/ss-5-CUCGC_x.pdb.gz
MCSYM-DB/5/CUCGG/
MCSYM-DB/5/CUCGG/5-CUCGG.mcs
MCSYM-DB/5/CUCGG/ss-5-CUCGG_x.pdb.gz
MCSYM-DB/5/CUCGU/
MCSYM-DB/5/CUCGU/5-CUCGU.mcs
MCSYM-DB/5/CUCGU/ss-5-CUCGU_x.pdb.gz
MCSYM-DB/5/CUCUA/
MCSYM-DB/5/CUCUA/5-CUCUA.mcs
MCSYM-DB/5/CUCUA/ss-5-CUCUA_x.pdb.gz
MCSYM-DB/5/CUCUC/
MCSYM-DB/5/CUCUC/5-CUCUC.mcs
MCSYM-DB/5/CUCUC/ss-5-CUCUC_x.pdb.gz
MCSYM-DB/5/CUCUG/
MCSYM-DB/5/CUCUG/5-CUCUG.mcs
MCSYM-DB/5/CUCUG/ss-5-CUCUG_x.pdb.gz
MCSYM-DB/5/CUCUU/
MCSYM-DB/5/CUCUU/5-CUCUU.mcs
MCSYM-DB/5/CUCUU/ss-5-CUCUU_x.pdb.gz
MCSYM-DB/5/CUGAA/
MCSYM-DB/5/CUGAA/5-CUGAA.mcs
MCSYM-DB/5/CUGAA/ss-5-CUGAA_x.pdb.gz
MCSYM-DB/5/CUGAC/
MCSYM-DB/5/CUGAC/5-CUGAC.mcs
MCSYM-DB/5/CUGAC/ss-5-CUGAC_x.pdb.gz
MCSYM-DB/5/CUGAG/
MCSYM-DB/5/CUGAG/5-CUGAG.mcs
MCSYM-DB/5/CUGAG/ss-5-CUGAG_x.pdb.gz
MCSYM-DB/5/CUGAU/
MCSYM-DB/5/CUGAU/5-CUGAU.mcs
MCSYM-DB/5/CUGAU/ss-5-CUGAU_x.pdb.gz
MCSYM-DB/5/CUGCA/
MCSYM-DB/5/CUGCA/5-CUGCA.mcs
MCSYM-DB/5/CUGCA/ss-5-CUGCA_x.pdb.gz
MCSYM-DB/5/CUGCC/
MCSYM-DB/5/CUGCC/5-CUGCC.mcs
MCSYM-DB/5/CUGCC/ss-5-CUGCC_x.pdb.gz
MCSYM-DB/5/CUGCG/
MCSYM-DB/5/CUGCG/5-CUGCG.mcs
MCSYM-DB/5/CUGCG/ss-5-CUGCG_x.pdb.gz
MCSYM-DB/5/CUGCU/
MCSYM-DB/5/CUGCU/5-CUGCU.mcs
MCSYM-DB/5/CUGCU/ss-5-CUGCU_x.pdb.gz
MCSYM-DB/5/CUGGA/
MCSYM-DB/5/CUGGA/5-CUGGA.mcs
MCSYM-DB/5/CUGGA/ss-5-CUGGA_x.pdb.gz
MCSYM-DB/5/CUGGC/
MCSYM-DB/5/CUGGC/5-CUGGC.mcs
MCSYM-DB/5/CUGGC/ss-5-CUGGC_x.pdb.gz
MCSYM-DB/5/CUGGG/
MCSYM-DB/5/CUGGG/5-CUGGG.mcs
MCSYM-DB/5/CUGGG/5-CUGGG.pdb.gz
MCSYM-DB/5/CUGGG/ss-5-CUGGG_x.pdb
MCSYM-DB/5/CUGGG/ss-5-CUGGG_x.pdb.gz
MCSYM-DB/5/CUGGU/
MCSYM-DB/5/CUGGU/5-CUGGU.mcs
MCSYM-DB/5/CUGGU/ss-5-CUGGU_x.pdb.gz
MCSYM-DB/5/CUGUA/
MCSYM-DB/5/CUGUA/5-CUGUA.mcs
MCSYM-DB/5/CUGUA/ss-5-CUGUA_x.pdb.gz
MCSYM-DB/5/CUGUC/
MCSYM-DB/5/CUGUC/5-CUGUC.mcs
MCSYM-DB/5/CUGUC/ss-5-CUGUC_x.pdb.gz
MCSYM-DB/5/CUGUG/
MCSYM-DB/5/CUGUG/5-CUGUG.mcs
MCSYM-DB/5/CUGUG/ss-5-CUGUG_x.pdb.gz
MCSYM-DB/5/CUGUU/
MCSYM-DB/5/CUGUU/5-CUGUU.mcs
MCSYM-DB/5/CUGUU/ss-5-CUGUU_x.pdb.gz
MCSYM-DB/5/CUUAA/
MCSYM-DB/5/CUUAA/5-CUUAA.mcs
MCSYM-DB/5/CUUAA/ss-5-CUUAA_x.pdb.gz
MCSYM-DB/5/CUUAG/
MCSYM-DB/5/CUUAG/1I4B_model_1.pdb.gz
MCSYM-DB/5/CUUAG/5-CUUAG.mcs
MCSYM-DB/5/CUUAG/ss-5-CUUAG_x.pdb.gz
MCSYM-DB/5/CUUAU/
MCSYM-DB/5/CUUAU/5-CUUAU.mcs
MCSYM-DB/5/CUUAU/ss-5-CUUAU_x.pdb.gz
MCSYM-DB/5/CUUCA/
MCSYM-DB/5/CUUCA/5-CUUCA.mcs
MCSYM-DB/5/CUUCA/ss-5-CUUCA_x.pdb.gz
MCSYM-DB/5/CUUCC/
MCSYM-DB/5/CUUCC/5-CUUCC.mcs
MCSYM-DB/5/CUUCC/ss-5-CUUCC_x.pdb.gz
MCSYM-DB/5/CUUCG/
MCSYM-DB/5/CUUCG/5-CUUCG.mcs
MCSYM-DB/5/CUUCG/ss-5-CUUCG_x.pdb.gz
MCSYM-DB/5/CUUCU/
MCSYM-DB/5/CUUCU/5-CUUCU.mcs
MCSYM-DB/5/CUUCU/ss-5-CUUCU_x.pdb.gz
MCSYM-DB/5/CUUGC/
MCSYM-DB/5/CUUGC/5-CUUGC.mcs
MCSYM-DB/5/CUUGC/ss-5-CUUGC_x.pdb.gz
MCSYM-DB/5/CUUGG/
MCSYM-DB/5/CUUGG/5-CUUGG.mcs
MCSYM-DB/5/CUUGG/ss-5-CUUGG_x.pdb.gz
MCSYM-DB/5/CUUGU/
MCSYM-DB/5/CUUGU/5-CUUGU.mcs
MCSYM-DB/5/CUUGU/ss-5-CUUGU_x.pdb.gz
MCSYM-DB/5/CUUUA/
MCSYM-DB/5/CUUUA/5-CUUUA.mcs
MCSYM-DB/5/CUUUA/ss-5-CUUUA_x.pdb.gz
MCSYM-DB/5/CUUUC/
MCSYM-DB/5/CUUUC/5-CUUUC.mcs
MCSYM-DB/5/CUUUC/ss-5-CUUUC_x.pdb.gz
MCSYM-DB/5/CUUUG/
MCSYM-DB/5/CUUUG/1XMQ_model_1.pdb.gz
MCSYM-DB/5/CUUUG/5-CUUUG.mcs
MCSYM-DB/5/CUUUG/ss-5-CUUUG_x.pdb.gz
MCSYM-DB/5/CUUUU/
MCSYM-DB/5/CUUUU/5-CUUUU.mcs
MCSYM-DB/5/CUUUU/ss-5-CUUUU_x.pdb.gz
MCSYM-DB/5/GAAAA/
MCSYM-DB/5/GAAAA/5-GAAAA.mcs
MCSYM-DB/5/GAAAA/ss-5-GAAAA_x.pdb.gz
MCSYM-DB/5/GAAAC/
MCSYM-DB/5/GAAAC/5-GAAAC.mcs
MCSYM-DB/5/GAAAC/ss-5-GAAAC_x.pdb.gz
MCSYM-DB/5/GAAAG/
MCSYM-DB/5/GAAAG/5-GAAAG.mcs
MCSYM-DB/5/GAAAG/ss-5-GAAAG_x.pdb.gz
MCSYM-DB/5/GAAAU/
MCSYM-DB/5/GAAAU/5-GAAAU.mcs
MCSYM-DB/5/GAAAU/ss-5-GAAAU_x.pdb.gz
MCSYM-DB/5/GAACA/
MCSYM-DB/5/GAACA/5-GAACA.mcs
MCSYM-DB/5/GAACA/ss-5-GAACA_x.pdb.gz
MCSYM-DB/5/GAACC/
MCSYM-DB/5/GAACC/5-GAACC.mcs
MCSYM-DB/5/GAACC/ss-5-GAACC_x.pdb.gz
MCSYM-DB/5/GAACG/
MCSYM-DB/5/GAACG/5-GAACG.mcs
MCSYM-DB/5/GAACG/ss-5-GAACG_x.pdb.gz
MCSYM-DB/5/GAACU/
MCSYM-DB/5/GAACU/5-GAACU.mcs
MCSYM-DB/5/GAACU/ss-5-GAACU_x.pdb.gz
MCSYM-DB/5/GAAGA/
MCSYM-DB/5/GAAGA/5-GAAGA.mcs
MCSYM-DB/5/GAAGA/ss-5-GAAGA_x.pdb.gz
MCSYM-DB/5/GAAGC/
MCSYM-DB/5/GAAGC/5-GAAGC.mcs
MCSYM-DB/5/GAAGC/ss-5-GAAGC_x.pdb.gz
MCSYM-DB/5/GAAGG/
MCSYM-DB/5/GAAGG/5-GAAGG.mcs
MCSYM-DB/5/GAAGG/ss-5-GAAGG_x.pdb.gz
MCSYM-DB/5/GAAGU/
MCSYM-DB/5/GAAGU/5-GAAGU.mcs
MCSYM-DB/5/GAAGU/ss-5-GAAGU_x.pdb.gz
MCSYM-DB/5/GAAUA/
MCSYM-DB/5/GAAUA/5-GAAUA.mcs
MCSYM-DB/5/GAAUA/ss-5-GAAUA_x.pdb.gz
MCSYM-DB/5/GAAUC/
MCSYM-DB/5/GAAUC/5-GAAUC.mcs
MCSYM-DB/5/GAAUC/ss-5-GAAUC_x.pdb.gz
MCSYM-DB/5/GAAUG/
MCSYM-DB/5/GAAUG/5-GAAUG.mcs
MCSYM-DB/5/GAAUG/ss-5-GAAUG_x.pdb.gz
MCSYM-DB/5/GAAUU/
MCSYM-DB/5/GAAUU/5-GAAUU.mcs
MCSYM-DB/5/GAAUU/ss-5-GAAUU_x.pdb.gz
MCSYM-DB/5/GACAA/
MCSYM-DB/5/GACAA/1A4T_model_1.pdb.gz
MCSYM-DB/5/GACAA/5-GACAA.mcs
MCSYM-DB/5/GACAA/ss-5-GACAA_x.pdb.gz
MCSYM-DB/5/GACAC/
MCSYM-DB/5/GACAC/5-GACAC.mcs
MCSYM-DB/5/GACAC/ss-5-GACAC_x.pdb.gz
MCSYM-DB/5/GACAG/
MCSYM-DB/5/GACAG/5-GACAG.mcs
MCSYM-DB/5/GACAG/ss-5-GACAG_x.pdb.gz
MCSYM-DB/5/GACAU/
MCSYM-DB/5/GACAU/5-GACAU.mcs
MCSYM-DB/5/GACAU/ss-5-GACAU_x.pdb.gz
MCSYM-DB/5/GACCA/
MCSYM-DB/5/GACCA/5-GACCA.mcs
MCSYM-DB/5/GACCA/ss-5-GACCA_x.pdb.gz
MCSYM-DB/5/GACCC/
MCSYM-DB/5/GACCC/5-GACCC.mcs
MCSYM-DB/5/GACCC/ss-5-GACCC_x.pdb.gz
MCSYM-DB/5/GACCG/
MCSYM-DB/5/GACCG/5-GACCG.mcs
MCSYM-DB/5/GACCU/
MCSYM-DB/5/GACCU/5-GACCU.mcs
MCSYM-DB/5/GACCU/ss-5-GACCU_x.pdb.gz
MCSYM-DB/5/GACGA/
MCSYM-DB/5/GACGA/5-GACGA.mcs
MCSYM-DB/5/GACGA/ss-5-GACGA_x.pdb.gz
MCSYM-DB/5/GACGC/
MCSYM-DB/5/GACGC/5-GACGC.mcs
MCSYM-DB/5/GACGC/ss-5-GACGC_x.pdb.gz
MCSYM-DB/5/GACGG/
MCSYM-DB/5/GACGG/5-GACGG.mcs
MCSYM-DB/5/GACGG/ss-5-GACGG_x.pdb.gz
MCSYM-DB/5/GACGU/
MCSYM-DB/5/GACGU/5-GACGU.mcs
MCSYM-DB/5/GACGU/ss-5-GACGU_x.pdb.gz
MCSYM-DB/5/GACUA/
MCSYM-DB/5/GACUA/5-GACUA.mcs
MCSYM-DB/5/GACUA/ss-5-GACUA_x.pdb.gz
MCSYM-DB/5/GACUC/
MCSYM-DB/5/GACUC/5-GACUC.mcs
MCSYM-DB/5/GACUC/ss-5-GACUC_x.pdb.gz
MCSYM-DB/5/GACUG/
MCSYM-DB/5/GACUG/5-GACUG.mcs
MCSYM-DB/5/GACUG/ss-5-GACUG_x.pdb.gz
MCSYM-DB/5/GACUU/
MCSYM-DB/5/GACUU/5-GACUU.mcs
MCSYM-DB/5/GACUU/ss-5-GACUU_x.pdb.gz
MCSYM-DB/5/GAGAA/
MCSYM-DB/5/GAGAA/5-GAGAA.mcs
MCSYM-DB/5/GAGAA/ss-5-GAGAA_x.pdb.gz
MCSYM-DB/5/GAGAC/
MCSYM-DB/5/GAGAC/5-GAGAC.mcs
MCSYM-DB/5/GAGAC/ss-5-GAGAC_x.pdb.gz
MCSYM-DB/5/GAGAG/
MCSYM-DB/5/GAGAG/5-GAGAG.mcs
MCSYM-DB/5/GAGAG/ss-5-GAGAG_x.pdb.gz
MCSYM-DB/5/GAGAU/
MCSYM-DB/5/GAGAU/5-GAGAU.mcs
MCSYM-DB/5/GAGAU/ss-5-GAGAU_x.pdb.gz
MCSYM-DB/5/GAGCA/
MCSYM-DB/5/GAGCA/5-GAGCA.mcs
MCSYM-DB/5/GAGCA/ss-5-GAGCA_x.pdb.gz
MCSYM-DB/5/GAGCC/
MCSYM-DB/5/GAGCC/5-GAGCC.mcs
MCSYM-DB/5/GAGCC/ss-5-GAGCC_x.pdb.gz
MCSYM-DB/5/GAGCG/
MCSYM-DB/5/GAGCG/5-GAGCG.mcs
MCSYM-DB/5/GAGCG/ss-5-GAGCG_x.pdb.gz
MCSYM-DB/5/GAGCU/
MCSYM-DB/5/GAGCU/5-GAGCU.mcs
MCSYM-DB/5/GAGCU/ss-5-GAGCU_x.pdb.gz
MCSYM-DB/5/GAGGA/
MCSYM-DB/5/GAGGA/5-GAGGA.mcs
MCSYM-DB/5/GAGGA/ss-5-GAGGA_x.pdb.gz
MCSYM-DB/5/GAGGC/
MCSYM-DB/5/GAGGC/5-GAGGC.mcs
MCSYM-DB/5/GAGGC/ss-5-GAGGC_x.pdb.gz
MCSYM-DB/5/GAGGG/
MCSYM-DB/5/GAGGG/5-GAGGG.mcs
MCSYM-DB/5/GAGGG/ss-5-GAGGG_x.pdb.gz
MCSYM-DB/5/GAGGU/
MCSYM-DB/5/GAGGU/5-GAGGU.mcs
MCSYM-DB/5/GAGGU/ss-5-GAGGU_x.pdb
MCSYM-DB/5/GAGGU/ss-5-GAGGU_x.pdb.gz
MCSYM-DB/5/GAGUA/
MCSYM-DB/5/GAGUA/5-GAGUA.mcs
MCSYM-DB/5/GAGUA/ss-5-GAGUA_x.pdb.gz
MCSYM-DB/5/GAGUC/
MCSYM-DB/5/GAGUC/5-GAGUC.mcs
MCSYM-DB/5/GAGUC/ss-5-GAGUC_x.pdb.gz
MCSYM-DB/5/GAGUG/
MCSYM-DB/5/GAGUG/5-GAGUG.mcs
MCSYM-DB/5/GAGUU/
MCSYM-DB/5/GAGUU/5-GAGUU.mcs
MCSYM-DB/5/GAGUU/ss-5-GAGUU_x.pdb.gz
MCSYM-DB/5/GAUAA/
MCSYM-DB/5/GAUAA/5-GAUAA.mcs
MCSYM-DB/5/GAUAA/ss-5-GAUAA_x.pdb.gz
MCSYM-DB/5/GAUAC/
MCSYM-DB/5/GAUAC/1VQ7_model_1.pdb.gz
MCSYM-DB/5/GAUAC/5-GAUAC.mcs
MCSYM-DB/5/GAUAC/ss-5-GAUAC_x.pdb.gz
MCSYM-DB/5/GAUAU/
MCSYM-DB/5/GAUAU/5-GAUAU.mcs
MCSYM-DB/5/GAUAU/ss-5-GAUAU_x.pdb.gz
MCSYM-DB/5/GAUCA/
MCSYM-DB/5/GAUCA/5-GAUCA.mcs
MCSYM-DB/5/GAUCA/ss-5-GAUCA_x.pdb.gz
MCSYM-DB/5/GAUCC/
MCSYM-DB/5/GAUCC/5-GAUCC.mcs
MCSYM-DB/5/GAUCC/ss-5-GAUCC_x.pdb.gz
MCSYM-DB/5/GAUCG/
MCSYM-DB/5/GAUCG/5-GAUCG.mcs
MCSYM-DB/5/GAUCU/
MCSYM-DB/5/GAUCU/5-GAUCU.mcs
MCSYM-DB/5/GAUCU/ss-5-GAUCU_x.pdb.gz
MCSYM-DB/5/GAUGA/
MCSYM-DB/5/GAUGA/5-GAUGA.mcs
MCSYM-DB/5/GAUGA/ss-5-GAUGA_x.pdb.gz
MCSYM-DB/5/GAUGC/
MCSYM-DB/5/GAUGC/5-GAUGC.mcs
MCSYM-DB/5/GAUGC/ss-5-GAUGC_x.pdb.gz
MCSYM-DB/5/GAUGG/
MCSYM-DB/5/GAUGG/5-GAUGG.mcs
MCSYM-DB/5/GAUGG/ss-5-GAUGG_x.pdb.gz
MCSYM-DB/5/GAUGU/
MCSYM-DB/5/GAUGU/5-GAUGU.mcs
MCSYM-DB/5/GAUGU/ss-5-GAUGU_x.pdb.gz
MCSYM-DB/5/GAUUA/
MCSYM-DB/5/GAUUA/5-GAUUA.mcs
MCSYM-DB/5/GAUUA/ss-5-GAUUA_x.pdb.gz
MCSYM-DB/5/GAUUC/
MCSYM-DB/5/GAUUC/5-GAUUC.mcs
MCSYM-DB/5/GAUUC/ss-5-GAUUC_x.pdb.gz
MCSYM-DB/5/GAUUG/
MCSYM-DB/5/GAUUG/5-GAUUG.mcs
MCSYM-DB/5/GAUUU/
MCSYM-DB/5/GAUUU/5-GAUUU.mcs
MCSYM-DB/5/GAUUU/ss-5-GAUUU_x.pdb.gz
MCSYM-DB/5/GCAAA/
MCSYM-DB/5/GCAAA/5-GCAAA.mcs
MCSYM-DB/5/GCAAA/ss-5-GCAAA_x.pdb.gz
MCSYM-DB/5/GCAAC/
MCSYM-DB/5/GCAAC/5-GCAAC.mcs
MCSYM-DB/5/GCAAC/ss-5-GCAAC_x.pdb.gz
MCSYM-DB/5/GCAAU/
MCSYM-DB/5/GCAAU/5-GCAAU.mcs
MCSYM-DB/5/GCAAU/ss-5-GCAAU_x.pdb.gz
MCSYM-DB/5/GCACA/
MCSYM-DB/5/GCACA/5-GCACA.mcs
MCSYM-DB/5/GCACA/ss-5-GCACA_x.pdb.gz
MCSYM-DB/5/GCACC/
MCSYM-DB/5/GCACC/5-GCACC.mcs
MCSYM-DB/5/GCACC/ss-5-GCACC_x.pdb.gz
MCSYM-DB/5/GCACG/
MCSYM-DB/5/GCACG/5-GCACG.mcs
MCSYM-DB/5/GCACG/ss-5-GCACG_x.pdb.gz
MCSYM-DB/5/GCACU/
MCSYM-DB/5/GCACU/5-GCACU.mcs
MCSYM-DB/5/GCACU/ss-5-GCACU_x.pdb.gz
MCSYM-DB/5/GCAGA/
MCSYM-DB/5/GCAGA/5-GCAGA.mcs
MCSYM-DB/5/GCAGA/ss-5-GCAGA_x.pdb.gz
MCSYM-DB/5/GCAGC/
MCSYM-DB/5/GCAGC/5-GCAGC.mcs
MCSYM-DB/5/GCAGC/ss-5-GCAGC_x.pdb.gz
MCSYM-DB/5/GCAGG/
MCSYM-DB/5/GCAGG/5-GCAGG.mcs
MCSYM-DB/5/GCAGG/ss-5-GCAGG_x.pdb.gz
MCSYM-DB/5/GCAGU/
MCSYM-DB/5/GCAGU/5-GCAGU.mcs
MCSYM-DB/5/GCAGU/ss-5-GCAGU_x.pdb.gz
MCSYM-DB/5/GCAUA/
MCSYM-DB/5/GCAUA/5-GCAUA.mcs
MCSYM-DB/5/GCAUA/ss-5-GCAUA_x.pdb.gz
MCSYM-DB/5/GCAUC/
MCSYM-DB/5/GCAUC/5-GCAUC.mcs
MCSYM-DB/5/GCAUC/ss-5-GCAUC_x.pdb.gz
MCSYM-DB/5/GCAUG/
MCSYM-DB/5/GCAUG/5-GCAUG.mcs
MCSYM-DB/5/GCAUG/ss-5-GCAUG_x.pdb.gz
MCSYM-DB/5/GCAUU/
MCSYM-DB/5/GCAUU/5-GCAUU.mcs
MCSYM-DB/5/GCAUU/ss-5-GCAUU_x.pdb.gz
MCSYM-DB/5/GCCAA/
MCSYM-DB/5/GCCAA/5-GCCAA.mcs
MCSYM-DB/5/GCCAA/ss-5-GCCAA_x.pdb.gz
MCSYM-DB/5/GCCAC/
MCSYM-DB/5/GCCAC/5-GCCAC.mcs
MCSYM-DB/5/GCCAC/ss-5-GCCAC_x.pdb.gz
MCSYM-DB/5/GCCAG/
MCSYM-DB/5/GCCAG/5-GCCAG.mcs
MCSYM-DB/5/GCCAU/
MCSYM-DB/5/GCCAU/5-GCCAU.mcs
MCSYM-DB/5/GCCAU/ss-5-GCCAU_x.pdb.gz
MCSYM-DB/5/GCCCA/
MCSYM-DB/5/GCCCA/5-GCCCA.mcs
MCSYM-DB/5/GCCCA/ss-5-GCCCA_x.pdb.gz
MCSYM-DB/5/GCCCC/
MCSYM-DB/5/GCCCC/5-GCCCC.mcs
MCSYM-DB/5/GCCCC/ss-5-GCCCC_x.pdb.gz
MCSYM-DB/5/GCCCG/
MCSYM-DB/5/GCCCG/5-GCCCG.mcs
MCSYM-DB/5/GCCCG/ss-5-GCCCG_x.pdb.gz
MCSYM-DB/5/GCCCU/
MCSYM-DB/5/GCCCU/5-GCCCU.mcs
MCSYM-DB/5/GCCCU/ss-5-GCCCU_x.pdb.gz
MCSYM-DB/5/GCCGA/
MCSYM-DB/5/GCCGA/5-GCCGA.mcs
MCSYM-DB/5/GCCGA/ss-5-GCCGA_x.pdb.gz
MCSYM-DB/5/GCCGC/
MCSYM-DB/5/GCCGC/5-GCCGC.mcs
MCSYM-DB/5/GCCGC/ss-5-GCCGC_x.pdb.gz
MCSYM-DB/5/GCCGG/
MCSYM-DB/5/GCCGG/5-GCCGG.mcs
MCSYM-DB/5/GCCGG/ss-5-GCCGG_x.pdb.gz
MCSYM-DB/5/GCCGU/
MCSYM-DB/5/GCCGU/5-GCCGU.mcs
MCSYM-DB/5/GCCGU/ss-5-GCCGU_x.pdb.gz
MCSYM-DB/5/GCCUA/
MCSYM-DB/5/GCCUA/5-GCCUA.mcs
MCSYM-DB/5/GCCUA/ss-5-GCCUA_x.pdb.gz
MCSYM-DB/5/GCCUC/
MCSYM-DB/5/GCCUC/5-GCCUC.mcs
MCSYM-DB/5/GCCUC/ss-5-GCCUC_x.pdb.gz
MCSYM-DB/5/GCCUG/
MCSYM-DB/5/GCCUG/5-GCCUG.mcs
MCSYM-DB/5/GCCUG/ss-5-GCCUG_x.pdb.gz
MCSYM-DB/5/GCCUU/
MCSYM-DB/5/GCCUU/5-GCCUU.mcs
MCSYM-DB/5/GCCUU/ss-5-GCCUU_x.pdb.gz
MCSYM-DB/5/GCGAA/
MCSYM-DB/5/GCGAA/5-GCGAA.mcs
MCSYM-DB/5/GCGAA/ss-5-GCGAA_x.pdb.gz
MCSYM-DB/5/GCGAC/
MCSYM-DB/5/GCGAC/5-GCGAC.mcs
MCSYM-DB/5/GCGAC/ss-5-GCGAC_x.pdb.gz
MCSYM-DB/5/GCGAG/
MCSYM-DB/5/GCGAG/5-GCGAG.mcs
MCSYM-DB/5/GCGAG/ss-5-GCGAG_x.pdb.gz
MCSYM-DB/5/GCGAU/
MCSYM-DB/5/GCGAU/5-GCGAU.mcs
MCSYM-DB/5/GCGAU/ss-5-GCGAU_x.pdb.gz
MCSYM-DB/5/GCGCA/
MCSYM-DB/5/GCGCA/5-GCGCA.mcs
MCSYM-DB/5/GCGCA/ss-5-GCGCA_x.pdb.gz
MCSYM-DB/5/GCGCC/
MCSYM-DB/5/GCGCC/5-GCGCC.mcs
MCSYM-DB/5/GCGCC/ss-5-GCGCC_x.pdb.gz
MCSYM-DB/5/GCGCG/
MCSYM-DB/5/GCGCG/5-GCGCG.mcs
MCSYM-DB/5/GCGCG/ss-5-GCGCG_x.pdb.gz
MCSYM-DB/5/GCGCU/
MCSYM-DB/5/GCGCU/5-GCGCU.mcs
MCSYM-DB/5/GCGCU/ss-5-GCGCU_x.pdb.gz
MCSYM-DB/5/GCGGA/
MCSYM-DB/5/GCGGA/5-GCGGA.mcs
MCSYM-DB/5/GCGGA/ss-5-GCGGA_x.pdb.gz
MCSYM-DB/5/GCGGC/
MCSYM-DB/5/GCGGC/5-GCGGC.mcs
MCSYM-DB/5/GCGGC/ss-5-GCGGC_x.pdb.gz
MCSYM-DB/5/GCGGG/
MCSYM-DB/5/GCGGG/5-GCGGG.mcs
MCSYM-DB/5/GCGGG/ss-5-GCGGG_x.pdb.gz
MCSYM-DB/5/GCGGU/
MCSYM-DB/5/GCGGU/5-GCGGU.mcs
MCSYM-DB/5/GCGGU/ss-5-GCGGU_x.pdb.gz
MCSYM-DB/5/GCGUA/
MCSYM-DB/5/GCGUA/5-GCGUA.mcs
MCSYM-DB/5/GCGUA/ss-5-GCGUA_x.pdb.gz
MCSYM-DB/5/GCGUC/
MCSYM-DB/5/GCGUC/5-GCGUC.mcs
MCSYM-DB/5/GCGUC/ss-5-GCGUC_x.pdb.gz
MCSYM-DB/5/GCGUU/
MCSYM-DB/5/GCGUU/5-GCGUU.mcs
MCSYM-DB/5/GCGUU/ss-5-GCGUU_x.pdb.gz
MCSYM-DB/5/GCUAA/
MCSYM-DB/5/GCUAA/5-GCUAA.mcs
MCSYM-DB/5/GCUAA/ss-5-GCUAA_x.pdb.gz
MCSYM-DB/5/GCUAC/
MCSYM-DB/5/GCUAC/5-GCUAC.mcs
MCSYM-DB/5/GCUAC/ss-5-GCUAC_x.pdb.gz
MCSYM-DB/5/GCUAG/
MCSYM-DB/5/GCUAG/5-GCUAG.mcs
MCSYM-DB/5/GCUAU/
MCSYM-DB/5/GCUAU/5-GCUAU.mcs
MCSYM-DB/5/GCUAU/ss-5-GCUAU_x.pdb.gz
MCSYM-DB/5/GCUCA/
MCSYM-DB/5/GCUCA/5-GCUCA.mcs
MCSYM-DB/5/GCUCA/ss-5-GCUCA_x.pdb.gz
MCSYM-DB/5/GCUCC/
MCSYM-DB/5/GCUCC/5-GCUCC.mcs
MCSYM-DB/5/GCUCC/ss-5-GCUCC_x.pdb.gz
MCSYM-DB/5/GCUCG/
MCSYM-DB/5/GCUCG/5-GCUCG.mcs
MCSYM-DB/5/GCUCG/ss-5-GCUCG_x.pdb.gz
MCSYM-DB/5/GCUCU/
MCSYM-DB/5/GCUCU/5-GCUCU.mcs
MCSYM-DB/5/GCUCU/ss-5-GCUCU_x.pdb.gz
MCSYM-DB/5/GCUGA/
MCSYM-DB/5/GCUGA/5-GCUGA.mcs
MCSYM-DB/5/GCUGA/ss-5-GCUGA_x.pdb.gz
MCSYM-DB/5/GCUGC/
MCSYM-DB/5/GCUGC/5-GCUGC.mcs
MCSYM-DB/5/GCUGC/ss-5-GCUGC_x.pdb.gz
MCSYM-DB/5/GCUGG/
MCSYM-DB/5/GCUGG/5-GCUGG.mcs
MCSYM-DB/5/GCUGG/ss-5-GCUGG_x.pdb.gz
MCSYM-DB/5/GCUGU/
MCSYM-DB/5/GCUGU/5-GCUGU.mcs
MCSYM-DB/5/GCUGU/ss-5-GCUGU_x.pdb.gz
MCSYM-DB/5/GCUUA/
MCSYM-DB/5/GCUUA/5-GCUUA.mcs
MCSYM-DB/5/GCUUA/ss-5-GCUUA_x.pdb.gz
MCSYM-DB/5/GCUUC/
MCSYM-DB/5/GCUUC/5-GCUUC.mcs
MCSYM-DB/5/GCUUC/ss-5-GCUUC_x.pdb.gz
MCSYM-DB/5/GCUUU/
MCSYM-DB/5/GCUUU/5-GCUUU.mcs
MCSYM-DB/5/GCUUU/ss-5-GCUUU_x.pdb.gz
MCSYM-DB/5/GGAAA/
MCSYM-DB/5/GGAAA/5-GGAAA.mcs
MCSYM-DB/5/GGAAA/ss-5-GGAAA_x.pdb
MCSYM-DB/5/GGAAA/ss-5-GGAAA_x.pdb.gz
MCSYM-DB/5/GGAAC/
MCSYM-DB/5/GGAAC/5-GGAAC.mcs
MCSYM-DB/5/GGAAC/ss-5-GGAAC_x.pdb.gz
MCSYM-DB/5/GGAAG/
MCSYM-DB/5/GGAAG/5-GGAAG.mcs
MCSYM-DB/5/GGAAG/ss-5-GGAAG_x.pdb.gz
MCSYM-DB/5/GGAAU/
MCSYM-DB/5/GGAAU/5-GGAAU.mcs
MCSYM-DB/5/GGAAU/ss-5-GGAAU_x.pdb.gz
MCSYM-DB/5/GGACA/
MCSYM-DB/5/GGACA/5-GGACA.mcs
MCSYM-DB/5/GGACA/ss-5-GGACA_x.pdb.gz
MCSYM-DB/5/GGACC/
MCSYM-DB/5/GGACC/5-GGACC.mcs
MCSYM-DB/5/GGACC/ss-5-GGACC_x.pdb.gz
MCSYM-DB/5/GGACG/
MCSYM-DB/5/GGACG/5-GGACG.mcs
MCSYM-DB/5/GGACG/ss-5-GGACG_x.pdb.gz
MCSYM-DB/5/GGACU/
MCSYM-DB/5/GGACU/5-GGACU.mcs
MCSYM-DB/5/GGACU/ss-5-GGACU_x.pdb.gz
MCSYM-DB/5/GGAGA/
MCSYM-DB/5/GGAGA/5-GGAGA.mcs
MCSYM-DB/5/GGAGA/ss-5-GGAGA_x.pdb.gz
MCSYM-DB/5/GGAGC/
MCSYM-DB/5/GGAGC/1KOC_model_1.pdb.gz
MCSYM-DB/5/GGAGC/5-GGAGC.mcs
MCSYM-DB/5/GGAGC/ss-5-GGAGC_x.pdb.gz
MCSYM-DB/5/GGAGG/
MCSYM-DB/5/GGAGG/5-GGAGG.mcs
MCSYM-DB/5/GGAGG/ss-5-GGAGG_x.pdb.gz
MCSYM-DB/5/GGAGU/
MCSYM-DB/5/GGAGU/5-GGAGU.mcs
MCSYM-DB/5/GGAGU/ss-5-GGAGU_x.pdb.gz
MCSYM-DB/5/GGAUA/
MCSYM-DB/5/GGAUA/1WKS_model_1.pdb.gz
MCSYM-DB/5/GGAUA/5-GGAUA.mcs
MCSYM-DB/5/GGAUA/5-GGAUA.pdb.gz
MCSYM-DB/5/GGAUA/ss-5-GGAUA_x.pdb.gz
MCSYM-DB/5/GGAUC/
MCSYM-DB/5/GGAUC/5-GGAUC.mcs
MCSYM-DB/5/GGAUC/ss-5-GGAUC_x.pdb.gz
MCSYM-DB/5/GGAUG/
MCSYM-DB/5/GGAUG/5-GGAUG.mcs
MCSYM-DB/5/GGAUU/
MCSYM-DB/5/GGAUU/5-GGAUU.mcs
MCSYM-DB/5/GGAUU/ss-5-GGAUU_x.pdb.gz
MCSYM-DB/5/GGCAA/
MCSYM-DB/5/GGCAA/5-GGCAA.mcs
MCSYM-DB/5/GGCAA/ss-5-GGCAA_x.pdb.gz
MCSYM-DB/5/GGCAC/
MCSYM-DB/5/GGCAC/5-GGCAC.mcs
MCSYM-DB/5/GGCAC/ss-5-GGCAC_x.pdb.gz
MCSYM-DB/5/GGCAG/
MCSYM-DB/5/GGCAG/5-GGCAG.mcs
MCSYM-DB/5/GGCAG/ss-5-GGCAG_x.pdb.gz
MCSYM-DB/5/GGCAU/
MCSYM-DB/5/GGCAU/5-GGCAU.mcs
MCSYM-DB/5/GGCAU/ss-5-GGCAU_x.pdb.gz
MCSYM-DB/5/GGCCA/
MCSYM-DB/5/GGCCA/5-GGCCA.mcs
MCSYM-DB/5/GGCCA/ss-5-GGCCA_x.pdb.gz
MCSYM-DB/5/GGCCC/
MCSYM-DB/5/GGCCC/5-GGCCC.mcs
MCSYM-DB/5/GGCCC/ss-5-GGCCC_x.pdb.gz
MCSYM-DB/5/GGCCG/
MCSYM-DB/5/GGCCG/5-GGCCG.mcs
MCSYM-DB/5/GGCCG/ss-5-GGCCG_x.pdb.gz
MCSYM-DB/5/GGCCU/
MCSYM-DB/5/GGCCU/5-GGCCU.mcs
MCSYM-DB/5/GGCCU/ss-5-GGCCU_x.pdb.gz
MCSYM-DB/5/GGCGA/
MCSYM-DB/5/GGCGA/5-GGCGA.mcs
MCSYM-DB/5/GGCGA/ss-5-GGCGA_x.pdb.gz
MCSYM-DB/5/GGCGC/
MCSYM-DB/5/GGCGC/5-GGCGC.mcs
MCSYM-DB/5/GGCGC/ss-5-GGCGC_x.pdb.gz
MCSYM-DB/5/GGCGG/
MCSYM-DB/5/GGCGG/5-GGCGG.mcs
MCSYM-DB/5/GGCGG/ss-5-GGCGG_x.pdb.gz
MCSYM-DB/5/GGCGU/
MCSYM-DB/5/GGCGU/5-GGCGU.mcs
MCSYM-DB/5/GGCGU/ss-5-GGCGU_x.pdb.gz
MCSYM-DB/5/GGCUA/
MCSYM-DB/5/GGCUA/5-GGCUA.mcs
MCSYM-DB/5/GGCUA/ss-5-GGCUA_x.pdb.gz
MCSYM-DB/5/GGCUC/
MCSYM-DB/5/GGCUC/5-GGCUC.mcs
MCSYM-DB/5/GGCUC/ss-5-GGCUC_x.pdb.gz
MCSYM-DB/5/GGCUG/
MCSYM-DB/5/GGCUG/5-GGCUG.mcs
MCSYM-DB/5/GGCUG/ss-5-GGCUG_x.pdb.gz
MCSYM-DB/5/GGCUU/
MCSYM-DB/5/GGCUU/5-GGCUU.mcs
MCSYM-DB/5/GGCUU/ss-5-GGCUU_x.pdb.gz
MCSYM-DB/5/GGGAA/
MCSYM-DB/5/GGGAA/5-GGGAA.mcs
MCSYM-DB/5/GGGAA/ss-5-GGGAA_x.pdb.gz
MCSYM-DB/5/GGGAC/
MCSYM-DB/5/GGGAC/5-GGGAC.mcs
MCSYM-DB/5/GGGAC/ss-5-GGGAC_x.pdb.gz
MCSYM-DB/5/GGGAG/
MCSYM-DB/5/GGGAG/5-GGGAG.mcs
MCSYM-DB/5/GGGAG/ss-5-GGGAG_x.pdb.gz
MCSYM-DB/5/GGGAU/
MCSYM-DB/5/GGGAU/5-GGGAU.mcs
MCSYM-DB/5/GGGAU/ss-5-GGGAU_x.pdb.gz
MCSYM-DB/5/GGGCA/
MCSYM-DB/5/GGGCA/5-GGGCA.mcs
MCSYM-DB/5/GGGCA/ss-5-GGGCA_x.pdb.gz
MCSYM-DB/5/GGGCC/
MCSYM-DB/5/GGGCC/5-GGGCC.mcs
MCSYM-DB/5/GGGCC/ss-5-GGGCC_x.pdb.gz
MCSYM-DB/5/GGGCG/
MCSYM-DB/5/GGGCG/5-GGGCG.mcs
MCSYM-DB/5/GGGCG/ss-5-GGGCG_x.pdb.gz
MCSYM-DB/5/GGGCU/
MCSYM-DB/5/GGGCU/5-GGGCU.mcs
MCSYM-DB/5/GGGCU/ss-5-GGGCU_x.pdb.gz
MCSYM-DB/5/GGGGA/
MCSYM-DB/5/GGGGA/5-GGGGA.mcs
MCSYM-DB/5/GGGGA/ss-5-GGGGA_x.pdb.gz
MCSYM-DB/5/GGGGC/
MCSYM-DB/5/GGGGC/1VOP_model_1.pdb.gz
MCSYM-DB/5/GGGGC/5-GGGGC.mcs
MCSYM-DB/5/GGGGC/ss-5-GGGGC_x.pdb.gz
MCSYM-DB/5/GGGGG/
MCSYM-DB/5/GGGGG/5-GGGGG.mcs
MCSYM-DB/5/GGGGG/ss-5-GGGGG_x.pdb.gz
MCSYM-DB/5/GGGGU/
MCSYM-DB/5/GGGGU/5-GGGGU.mcs
MCSYM-DB/5/GGGGU/ss-5-GGGGU_x.pdb.gz
MCSYM-DB/5/GGGUA/
MCSYM-DB/5/GGGUA/5-GGGUA.mcs
MCSYM-DB/5/GGGUA/ss-5-GGGUA_x.pdb.gz
MCSYM-DB/5/GGGUC/
MCSYM-DB/5/GGGUC/5-GGGUC.mcs
MCSYM-DB/5/GGGUC/ss-5-GGGUC_x.pdb.gz
MCSYM-DB/5/GGGUG/
MCSYM-DB/5/GGGUG/5-GGGUG.mcs
MCSYM-DB/5/GGGUG/ss-5-GGGUG_x.pdb.gz
MCSYM-DB/5/GGGUU/
MCSYM-DB/5/GGGUU/5-GGGUU.mcs
MCSYM-DB/5/GGGUU/ss-5-GGGUU_x.pdb.gz
MCSYM-DB/5/GGUAA/
MCSYM-DB/5/GGUAA/5-GGUAA.mcs
MCSYM-DB/5/GGUAA/ss-5-GGUAA_x.pdb.gz
MCSYM-DB/5/GGUAC/
MCSYM-DB/5/GGUAC/5-GGUAC.mcs
MCSYM-DB/5/GGUAC/ss-5-GGUAC_x.pdb.gz
MCSYM-DB/5/GGUAU/
MCSYM-DB/5/GGUAU/5-GGUAU.mcs
MCSYM-DB/5/GGUAU/ss-5-GGUAU_x.pdb.gz
MCSYM-DB/5/GGUCA/
MCSYM-DB/5/GGUCA/5-GGUCA.mcs
MCSYM-DB/5/GGUCA/ss-5-GGUCA_x.pdb.gz
MCSYM-DB/5/GGUCC/
MCSYM-DB/5/GGUCC/5-GGUCC.mcs
MCSYM-DB/5/GGUCC/ss-5-GGUCC_x.pdb.gz
MCSYM-DB/5/GGUCG/
MCSYM-DB/5/GGUCG/5-GGUCG.mcs
MCSYM-DB/5/GGUCG/ss-5-GGUCG_x.pdb.gz
MCSYM-DB/5/GGUCU/
MCSYM-DB/5/GGUCU/5-GGUCU.mcs
MCSYM-DB/5/GGUCU/ss-5-GGUCU_x.pdb.gz
MCSYM-DB/5/GGUGA/
MCSYM-DB/5/GGUGA/5-GGUGA.mcs
MCSYM-DB/5/GGUGA/ss-5-GGUGA_x.pdb.gz
MCSYM-DB/5/GGUGC/
MCSYM-DB/5/GGUGC/5-GGUGC.mcs
MCSYM-DB/5/GGUGC/ss-5-GGUGC_x.pdb.gz
MCSYM-DB/5/GGUGG/
MCSYM-DB/5/GGUGG/5-GGUGG.mcs
MCSYM-DB/5/GGUGG/ss-5-GGUGG_x.pdb.gz
MCSYM-DB/5/GGUGU/
MCSYM-DB/5/GGUGU/5-GGUGU.mcs
MCSYM-DB/5/GGUGU/ss-5-GGUGU_x.pdb.gz
MCSYM-DB/5/GGUUA/
MCSYM-DB/5/GGUUA/5-GGUUA.mcs
MCSYM-DB/5/GGUUA/ss-5-GGUUA_x.pdb.gz
MCSYM-DB/5/GGUUC/
MCSYM-DB/5/GGUUC/5-GGUUC.mcs
MCSYM-DB/5/GGUUC/ss-5-GGUUC_x.pdb.gz
MCSYM-DB/5/GGUUG/
MCSYM-DB/5/GGUUG/5-GGUUG.mcs
MCSYM-DB/5/GGUUU/
MCSYM-DB/5/GGUUU/5-GGUUU.mcs
MCSYM-DB/5/GGUUU/ss-5-GGUUU_x.pdb.gz
MCSYM-DB/5/GUAAA/
MCSYM-DB/5/GUAAA/5-GUAAA.mcs
MCSYM-DB/5/GUAAA/ss-5-GUAAA_x.pdb.gz
MCSYM-DB/5/GUAAC/
MCSYM-DB/5/GUAAC/5-GUAAC.mcs
MCSYM-DB/5/GUAAC/ss-5-GUAAC_x.pdb.gz
MCSYM-DB/5/GUAAG/
MCSYM-DB/5/GUAAG/5-GUAAG.mcs
MCSYM-DB/5/GUAAG/ss-5-GUAAG_x.pdb.gz
MCSYM-DB/5/GUAAU/
MCSYM-DB/5/GUAAU/5-GUAAU.mcs
MCSYM-DB/5/GUAAU/ss-5-GUAAU_x.pdb.gz
MCSYM-DB/5/GUACA/
MCSYM-DB/5/GUACA/5-GUACA.mcs
MCSYM-DB/5/GUACA/ss-5-GUACA_x.pdb.gz
MCSYM-DB/5/GUACC/
MCSYM-DB/5/GUACC/5-GUACC.mcs
MCSYM-DB/5/GUACC/ss-5-GUACC_x.pdb.gz
MCSYM-DB/5/GUACU/
MCSYM-DB/5/GUACU/5-GUACU.mcs
MCSYM-DB/5/GUACU/ss-5-GUACU_x.pdb.gz
MCSYM-DB/5/GUAGA/
MCSYM-DB/5/GUAGA/5-GUAGA.mcs
MCSYM-DB/5/GUAGA/ss-5-GUAGA_x.pdb.gz
MCSYM-DB/5/GUAGC/
MCSYM-DB/5/GUAGC/5-GUAGC.mcs
MCSYM-DB/5/GUAGC/ss-5-GUAGC_x.pdb.gz
MCSYM-DB/5/GUAGU/
MCSYM-DB/5/GUAGU/5-GUAGU.mcs
MCSYM-DB/5/GUAGU/ss-5-GUAGU_x.pdb.gz
MCSYM-DB/5/GUAUA/
MCSYM-DB/5/GUAUA/5-GUAUA.mcs
MCSYM-DB/5/GUAUA/ss-5-GUAUA_x.pdb.gz
MCSYM-DB/5/GUAUC/
MCSYM-DB/5/GUAUC/5-GUAUC.mcs
MCSYM-DB/5/GUAUC/ss-5-GUAUC_x.pdb.gz
MCSYM-DB/5/GUAUU/
MCSYM-DB/5/GUAUU/5-GUAUU.mcs
MCSYM-DB/5/GUAUU/ss-5-GUAUU_x.pdb.gz
MCSYM-DB/5/GUCAA/
MCSYM-DB/5/GUCAA/5-GUCAA.mcs
MCSYM-DB/5/GUCAA/ss-5-GUCAA_x.pdb.gz
MCSYM-DB/5/GUCAC/
MCSYM-DB/5/GUCAC/5-GUCAC.mcs
MCSYM-DB/5/GUCAC/ss-5-GUCAC_x.pdb.gz
MCSYM-DB/5/GUCAG/
MCSYM-DB/5/GUCAG/5-GUCAG.mcs
MCSYM-DB/5/GUCAG/ss-5-GUCAG_x.pdb.gz
MCSYM-DB/5/GUCAU/
MCSYM-DB/5/GUCAU/5-GUCAU.mcs
MCSYM-DB/5/GUCAU/ss-5-GUCAU_x.pdb.gz
MCSYM-DB/5/GUCCA/
MCSYM-DB/5/GUCCA/5-GUCCA.mcs
MCSYM-DB/5/GUCCA/ss-5-GUCCA_x.pdb.gz
MCSYM-DB/5/GUCCC/
MCSYM-DB/5/GUCCC/1VQ7_model_1.pdb.gz
MCSYM-DB/5/GUCCC/5-GUCCC.mcs
MCSYM-DB/5/GUCCC/ss-5-GUCCC_x.pdb.gz
MCSYM-DB/5/GUCCG/
MCSYM-DB/5/GUCCG/5-GUCCG.mcs
MCSYM-DB/5/GUCCG/ss-5-GUCCG_x.pdb.gz
MCSYM-DB/5/GUCCU/
MCSYM-DB/5/GUCCU/5-GUCCU.mcs
MCSYM-DB/5/GUCCU/ss-5-GUCCU_x.pdb.gz
MCSYM-DB/5/GUCGA/
MCSYM-DB/5/GUCGA/5-GUCGA.mcs
MCSYM-DB/5/GUCGA/ss-5-GUCGA_x.pdb.gz
MCSYM-DB/5/GUCGC/
MCSYM-DB/5/GUCGC/5-GUCGC.mcs
MCSYM-DB/5/GUCGC/ss-5-GUCGC_x.pdb.gz
MCSYM-DB/5/GUCGG/
MCSYM-DB/5/GUCGG/5-GUCGG.mcs
MCSYM-DB/5/GUCGU/
MCSYM-DB/5/GUCGU/5-GUCGU.mcs
MCSYM-DB/5/GUCGU/ss-5-GUCGU_x.pdb.gz
MCSYM-DB/5/GUCUA/
MCSYM-DB/5/GUCUA/5-GUCUA.mcs
MCSYM-DB/5/GUCUA/ss-5-GUCUA_x.pdb.gz
MCSYM-DB/5/GUCUC/
MCSYM-DB/5/GUCUC/1A51_model_1.pdb.gz
MCSYM-DB/5/GUCUC/1XMQ_model_1.pdb.gz
MCSYM-DB/5/GUCUC/5-GUCUC.mcs
MCSYM-DB/5/GUCUC/ss-5-GUCUC_x.pdb.gz
MCSYM-DB/5/GUCUG/
MCSYM-DB/5/GUCUG/5-GUCUG.mcs
MCSYM-DB/5/GUCUU/
MCSYM-DB/5/GUCUU/5-GUCUU.mcs
MCSYM-DB/5/GUCUU/ss-5-GUCUU_x.pdb.gz
MCSYM-DB/5/GUGAA/
MCSYM-DB/5/GUGAA/5-GUGAA.mcs
MCSYM-DB/5/GUGAA/ss-5-GUGAA_x.pdb.gz
MCSYM-DB/5/GUGAC/
MCSYM-DB/5/GUGAC/5-GUGAC.mcs
MCSYM-DB/5/GUGAC/ss-5-GUGAC_x.pdb.gz
MCSYM-DB/5/GUGAG/
MCSYM-DB/5/GUGAG/5-GUGAG.mcs
MCSYM-DB/5/GUGAU/
MCSYM-DB/5/GUGAU/5-GUGAU.mcs
MCSYM-DB/5/GUGAU/ss-5-GUGAU_x.pdb.gz
MCSYM-DB/5/GUGCA/
MCSYM-DB/5/GUGCA/5-GUGCA.mcs
MCSYM-DB/5/GUGCA/ss-5-GUGCA_x.pdb.gz
MCSYM-DB/5/GUGCC/
MCSYM-DB/5/GUGCC/5-GUGCC.mcs
MCSYM-DB/5/GUGCC/ss-5-GUGCC_x.pdb.gz
MCSYM-DB/5/GUGCU/
MCSYM-DB/5/GUGCU/5-GUGCU.mcs
MCSYM-DB/5/GUGCU/ss-5-GUGCU_x.pdb.gz
MCSYM-DB/5/GUGGA/
MCSYM-DB/5/GUGGA/5-GUGGA.mcs
MCSYM-DB/5/GUGGA/ss-5-GUGGA_x.pdb.gz
MCSYM-DB/5/GUGGC/
MCSYM-DB/5/GUGGC/5-GUGGC.mcs
MCSYM-DB/5/GUGGC/ss-5-GUGGC_x.pdb.gz
MCSYM-DB/5/GUGGG/
MCSYM-DB/5/GUGGG/5-GUGGG.mcs
MCSYM-DB/5/GUGGG/ss-5-GUGGG_x.pdb.gz
MCSYM-DB/5/GUGGU/
MCSYM-DB/5/GUGGU/5-GUGGU.mcs
MCSYM-DB/5/GUGGU/ss-5-GUGGU_x.pdb.gz
MCSYM-DB/5/GUGUA/
MCSYM-DB/5/GUGUA/5-GUGUA.mcs
MCSYM-DB/5/GUGUA/ss-5-GUGUA_x.pdb.gz
MCSYM-DB/5/GUGUC/
MCSYM-DB/5/GUGUC/5-GUGUC.mcs
MCSYM-DB/5/GUGUC/ss-5-GUGUC_x.pdb.gz
MCSYM-DB/5/GUGUG/
MCSYM-DB/5/GUGUG/5-GUGUG.mcs
MCSYM-DB/5/GUGUG/ss-5-GUGUG_x.pdb.gz
MCSYM-DB/5/GUGUU/
MCSYM-DB/5/GUGUU/5-GUGUU.mcs
MCSYM-DB/5/GUGUU/ss-5-GUGUU_x.pdb.gz
MCSYM-DB/5/GUUAA/
MCSYM-DB/5/GUUAA/5-GUUAA.mcs
MCSYM-DB/5/GUUAA/ss-5-GUUAA_x.pdb.gz
MCSYM-DB/5/GUUAC/
MCSYM-DB/5/GUUAC/5-GUUAC.mcs
MCSYM-DB/5/GUUAC/ss-5-GUUAC_x.pdb.gz
MCSYM-DB/5/GUUAG/
MCSYM-DB/5/GUUAG/5-GUUAG.mcs
MCSYM-DB/5/GUUAU/
MCSYM-DB/5/GUUAU/5-GUUAU.mcs
MCSYM-DB/5/GUUAU/ss-5-GUUAU_x.pdb.gz
MCSYM-DB/5/GUUCA/
MCSYM-DB/5/GUUCA/5-GUUCA.mcs
MCSYM-DB/5/GUUCA/ss-5-GUUCA_x.pdb.gz
MCSYM-DB/5/GUUCC/
MCSYM-DB/5/GUUCC/5-GUUCC.mcs
MCSYM-DB/5/GUUCC/ss-5-GUUCC_x.pdb.gz
MCSYM-DB/5/GUUCG/
MCSYM-DB/5/GUUCG/5-GUUCG.mcs
MCSYM-DB/5/GUUCG/ss-5-GUUCG_x.pdb.gz
MCSYM-DB/5/GUUCU/
MCSYM-DB/5/GUUCU/5-GUUCU.mcs
MCSYM-DB/5/GUUCU/ss-5-GUUCU_x.pdb.gz
MCSYM-DB/5/GUUGA/
MCSYM-DB/5/GUUGA/5-GUUGA.mcs
MCSYM-DB/5/GUUGA/ss-5-GUUGA_x.pdb.gz
MCSYM-DB/5/GUUGC/
MCSYM-DB/5/GUUGC/5-GUUGC.mcs
MCSYM-DB/5/GUUGC/ss-5-GUUGC_x.pdb.gz
MCSYM-DB/5/GUUGG/
MCSYM-DB/5/GUUGG/5-GUUGG.mcs
MCSYM-DB/5/GUUGU/
MCSYM-DB/5/GUUGU/5-GUUGU.mcs
MCSYM-DB/5/GUUGU/ss-5-GUUGU_x.pdb.gz
MCSYM-DB/5/GUUUA/
MCSYM-DB/5/GUUUA/5-GUUUA.mcs
MCSYM-DB/5/GUUUA/ss-5-GUUUA_x.pdb.gz
MCSYM-DB/5/GUUUC/
MCSYM-DB/5/GUUUC/5-GUUUC.mcs
MCSYM-DB/5/GUUUC/ss-5-GUUUC_x.pdb.gz
MCSYM-DB/5/GUUUG/
MCSYM-DB/5/GUUUG/5-GUUUG.mcs
MCSYM-DB/5/GUUUU/
MCSYM-DB/5/GUUUU/5-GUUUU.mcs
MCSYM-DB/5/GUUUU/ss-5-GUUUU_x.pdb.gz
MCSYM-DB/5/UAAAA/
MCSYM-DB/5/UAAAA/5-UAAAA.mcs
MCSYM-DB/5/UAAAA/ss-5-UAAAA_x.pdb
MCSYM-DB/5/UAAAA/ss-5-UAAAA_x.pdb.gz
MCSYM-DB/5/UAAAC/
MCSYM-DB/5/UAAAC/5-UAAAC.mcs
MCSYM-DB/5/UAAAC/ss-5-UAAAC_x.pdb.gz
MCSYM-DB/5/UAAAG/
MCSYM-DB/5/UAAAG/5-UAAAG.mcs
MCSYM-DB/5/UAAAG/ss-5-UAAAG_x.pdb.gz
MCSYM-DB/5/UAAAU/
MCSYM-DB/5/UAAAU/5-UAAAU.mcs
MCSYM-DB/5/UAAAU/ss-5-UAAAU_x.pdb.gz
MCSYM-DB/5/UAACA/
MCSYM-DB/5/UAACA/5-UAACA.mcs
MCSYM-DB/5/UAACA/ss-5-UAACA_x.pdb.gz
MCSYM-DB/5/UAACC/
MCSYM-DB/5/UAACC/5-UAACC.mcs
MCSYM-DB/5/UAACC/ss-5-UAACC_x.pdb.gz
MCSYM-DB/5/UAACG/
MCSYM-DB/5/UAACG/5-UAACG.mcs
MCSYM-DB/5/UAACG/ss-5-UAACG_x.pdb.gz
MCSYM-DB/5/UAACU/
MCSYM-DB/5/UAACU/5-UAACU.mcs
MCSYM-DB/5/UAACU/ss-5-UAACU_x.pdb.gz
MCSYM-DB/5/UAAGA/
MCSYM-DB/5/UAAGA/5-UAAGA.mcs
MCSYM-DB/5/UAAGA/ss-5-UAAGA_x.pdb.gz
MCSYM-DB/5/UAAGC/
MCSYM-DB/5/UAAGC/5-UAAGC.mcs
MCSYM-DB/5/UAAGC/ss-5-UAAGC_x.pdb.gz
MCSYM-DB/5/UAAGG/
MCSYM-DB/5/UAAGG/5-UAAGG.mcs
MCSYM-DB/5/UAAGG/ss-5-UAAGG_x.pdb.gz
MCSYM-DB/5/UAAGU/
MCSYM-DB/5/UAAGU/5-UAAGU.mcs
MCSYM-DB/5/UAAGU/ss-5-UAAGU_x.pdb.gz
MCSYM-DB/5/UAAUA/
MCSYM-DB/5/UAAUA/5-UAAUA.mcs
MCSYM-DB/5/UAAUA/ss-5-UAAUA_x.pdb.gz
MCSYM-DB/5/UAAUC/
MCSYM-DB/5/UAAUC/5-UAAUC.mcs
MCSYM-DB/5/UAAUC/ss-5-UAAUC_x.pdb.gz
MCSYM-DB/5/UAAUG/
MCSYM-DB/5/UAAUG/5-UAAUG.mcs
MCSYM-DB/5/UAAUG/ss-5-UAAUG_x.pdb.gz
MCSYM-DB/5/UAAUU/
MCSYM-DB/5/UAAUU/5-UAAUU.mcs
MCSYM-DB/5/UAAUU/ss-5-UAAUU_x.pdb.gz
MCSYM-DB/5/UACAA/
MCSYM-DB/5/UACAA/5-UACAA.mcs
MCSYM-DB/5/UACAA/ss-5-UACAA_x.pdb.gz
MCSYM-DB/5/UACAC/
MCSYM-DB/5/UACAC/5-UACAC.mcs
MCSYM-DB/5/UACAC/ss-5-UACAC_x.pdb.gz
MCSYM-DB/5/UACAG/
MCSYM-DB/5/UACAG/5-UACAG.mcs
MCSYM-DB/5/UACAG/ss-5-UACAG_x.pdb.gz
MCSYM-DB/5/UACAU/
MCSYM-DB/5/UACAU/5-UACAU.mcs
MCSYM-DB/5/UACAU/ss-5-UACAU_x.pdb.gz
MCSYM-DB/5/UACCA/
MCSYM-DB/5/UACCA/5-UACCA.mcs
MCSYM-DB/5/UACCA/ss-5-UACCA_x.pdb.gz
MCSYM-DB/5/UACCC/
MCSYM-DB/5/UACCC/5-UACCC.mcs
MCSYM-DB/5/UACCC/ss-5-UACCC_x.pdb.gz
MCSYM-DB/5/UACCG/
MCSYM-DB/5/UACCG/5-UACCG.mcs
MCSYM-DB/5/UACCG/ss-5-UACCG_x.pdb.gz
MCSYM-DB/5/UACCU/
MCSYM-DB/5/UACCU/5-UACCU.mcs
MCSYM-DB/5/UACCU/ss-5-UACCU_x.pdb.gz
MCSYM-DB/5/UACGA/
MCSYM-DB/5/UACGA/5-UACGA.mcs
MCSYM-DB/5/UACGA/ss-5-UACGA_x.pdb.gz
MCSYM-DB/5/UACGC/
MCSYM-DB/5/UACGC/5-UACGC.mcs
MCSYM-DB/5/UACGC/ss-5-UACGC_x.pdb.gz
MCSYM-DB/5/UACGG/
MCSYM-DB/5/UACGG/5-UACGG.mcs
MCSYM-DB/5/UACGG/ss-5-UACGG_x.pdb.gz
MCSYM-DB/5/UACGU/
MCSYM-DB/5/UACGU/5-UACGU.mcs
MCSYM-DB/5/UACGU/ss-5-UACGU_x.pdb.gz
MCSYM-DB/5/UACUA/
MCSYM-DB/5/UACUA/5-UACUA.mcs
MCSYM-DB/5/UACUA/ss-5-UACUA_x.pdb.gz
MCSYM-DB/5/UACUC/
MCSYM-DB/5/UACUC/5-UACUC.mcs
MCSYM-DB/5/UACUC/ss-5-UACUC_x.pdb.gz
MCSYM-DB/5/UACUG/
MCSYM-DB/5/UACUG/5-UACUG.mcs
MCSYM-DB/5/UACUG/ss-5-UACUG_x.pdb.gz
MCSYM-DB/5/UACUU/
MCSYM-DB/5/UACUU/5-UACUU.mcs
MCSYM-DB/5/UACUU/ss-5-UACUU_x.pdb.gz
MCSYM-DB/5/UAGAA/
MCSYM-DB/5/UAGAA/5-UAGAA.mcs
MCSYM-DB/5/UAGAA/ss-5-UAGAA_x.pdb.gz
MCSYM-DB/5/UAGAC/
MCSYM-DB/5/UAGAC/5-UAGAC.mcs
MCSYM-DB/5/UAGAC/ss-5-UAGAC_x.pdb.gz
MCSYM-DB/5/UAGAG/
MCSYM-DB/5/UAGAG/5-UAGAG.mcs
MCSYM-DB/5/UAGAG/ss-5-UAGAG_x.pdb.gz
MCSYM-DB/5/UAGAU/
MCSYM-DB/5/UAGAU/5-UAGAU.mcs
MCSYM-DB/5/UAGCA/
MCSYM-DB/5/UAGCA/5-UAGCA.mcs
MCSYM-DB/5/UAGCA/ss-5-UAGCA_x.pdb.gz
MCSYM-DB/5/UAGCC/
MCSYM-DB/5/UAGCC/5-UAGCC.mcs
MCSYM-DB/5/UAGCC/ss-5-UAGCC_x.pdb.gz
MCSYM-DB/5/UAGCG/
MCSYM-DB/5/UAGCG/5-UAGCG.mcs
MCSYM-DB/5/UAGCG/ss-5-UAGCG_x.pdb.gz
MCSYM-DB/5/UAGCU/
MCSYM-DB/5/UAGCU/5-UAGCU.mcs
MCSYM-DB/5/UAGCU/ss-5-UAGCU_x.pdb.gz
MCSYM-DB/5/UAGGA/
MCSYM-DB/5/UAGGA/5-UAGGA.mcs
MCSYM-DB/5/UAGGA/ss-5-UAGGA_x.pdb.gz
MCSYM-DB/5/UAGGC/
MCSYM-DB/5/UAGGC/5-UAGGC.mcs
MCSYM-DB/5/UAGGC/ss-5-UAGGC_x.pdb.gz
MCSYM-DB/5/UAGGG/
MCSYM-DB/5/UAGGG/5-UAGGG.mcs
MCSYM-DB/5/UAGGG/ss-5-UAGGG_x.pdb.gz
MCSYM-DB/5/UAGUA/
MCSYM-DB/5/UAGUA/5-UAGUA.mcs
MCSYM-DB/5/UAGUA/ss-5-UAGUA_x.pdb.gz
MCSYM-DB/5/UAGUC/
MCSYM-DB/5/UAGUC/5-UAGUC.mcs
MCSYM-DB/5/UAGUC/ss-5-UAGUC_x.pdb.gz
MCSYM-DB/5/UAGUG/
MCSYM-DB/5/UAGUG/5-UAGUG.mcs
MCSYM-DB/5/UAGUG/ss-5-UAGUG_x.pdb.gz
MCSYM-DB/5/UAGUU/
MCSYM-DB/5/UAGUU/5-UAGUU.mcs
MCSYM-DB/5/UAUAA/
MCSYM-DB/5/UAUAA/5-UAUAA.mcs
MCSYM-DB/5/UAUAA/ss-5-UAUAA_x.pdb.gz
MCSYM-DB/5/UAUAC/
MCSYM-DB/5/UAUAC/5-UAUAC.mcs
MCSYM-DB/5/UAUAC/ss-5-UAUAC_x.pdb.gz
MCSYM-DB/5/UAUAG/
MCSYM-DB/5/UAUAG/5-UAUAG.mcs
MCSYM-DB/5/UAUAG/5-UAUAG.pdb.gz
MCSYM-DB/5/UAUAG/ss-5-UAUAG_x.pdb.gz
MCSYM-DB/5/UAUAU/
MCSYM-DB/5/UAUAU/5-UAUAU.mcs
MCSYM-DB/5/UAUAU/ss-5-UAUAU_x.pdb.gz
MCSYM-DB/5/UAUCA/
MCSYM-DB/5/UAUCA/5-UAUCA.mcs
MCSYM-DB/5/UAUCA/ss-5-UAUCA_x.pdb.gz
MCSYM-DB/5/UAUCC/
MCSYM-DB/5/UAUCC/5-UAUCC.mcs
MCSYM-DB/5/UAUCC/ss-5-UAUCC_x.pdb.gz
MCSYM-DB/5/UAUCG/
MCSYM-DB/5/UAUCG/5-UAUCG.mcs
MCSYM-DB/5/UAUCG/ss-5-UAUCG_x.pdb.gz
MCSYM-DB/5/UAUCU/
MCSYM-DB/5/UAUCU/5-UAUCU.mcs
MCSYM-DB/5/UAUCU/ss-5-UAUCU_x.pdb.gz
MCSYM-DB/5/UAUGA/
MCSYM-DB/5/UAUGA/5-UAUGA.mcs
MCSYM-DB/5/UAUGA/ss-5-UAUGA_x.pdb.gz
MCSYM-DB/5/UAUGC/
MCSYM-DB/5/UAUGC/5-UAUGC.mcs
MCSYM-DB/5/UAUGC/ss-5-UAUGC_x.pdb.gz
MCSYM-DB/5/UAUGG/
MCSYM-DB/5/UAUGG/5-UAUGG.mcs
MCSYM-DB/5/UAUGG/ss-5-UAUGG_x.pdb.gz
MCSYM-DB/5/UAUGU/
MCSYM-DB/5/UAUGU/5-UAUGU.mcs
MCSYM-DB/5/UAUGU/ss-5-UAUGU_x.pdb.gz
MCSYM-DB/5/UAUUA/
MCSYM-DB/5/UAUUA/5-UAUUA.mcs
MCSYM-DB/5/UAUUA/ss-5-UAUUA_x.pdb.gz
MCSYM-DB/5/UAUUC/
MCSYM-DB/5/UAUUC/5-UAUUC.mcs
MCSYM-DB/5/UAUUC/ss-5-UAUUC_x.pdb.gz
MCSYM-DB/5/UAUUG/
MCSYM-DB/5/UAUUG/5-UAUUG.mcs
MCSYM-DB/5/UAUUG/ss-5-UAUUG_x.pdb.gz
MCSYM-DB/5/UAUUU/
MCSYM-DB/5/UAUUU/5-UAUUU.mcs
MCSYM-DB/5/UAUUU/ss-5-UAUUU_x.pdb.gz
MCSYM-DB/5/UCAAA/
MCSYM-DB/5/UCAAA/5-UCAAA.mcs
MCSYM-DB/5/UCAAA/ss-5-UCAAA_x.pdb.gz
MCSYM-DB/5/UCAAC/
MCSYM-DB/5/UCAAC/5-UCAAC.mcs
MCSYM-DB/5/UCAAC/ss-5-UCAAC_x.pdb.gz
MCSYM-DB/5/UCAAG/
MCSYM-DB/5/UCAAG/5-UCAAG.mcs
MCSYM-DB/5/UCAAG/ss-5-UCAAG_x.pdb.gz
MCSYM-DB/5/UCAAU/
MCSYM-DB/5/UCAAU/5-UCAAU.mcs
MCSYM-DB/5/UCAAU/ss-5-UCAAU_x.pdb.gz
MCSYM-DB/5/UCACA/
MCSYM-DB/5/UCACA/5-UCACA.mcs
MCSYM-DB/5/UCACA/ss-5-UCACA_x.pdb
MCSYM-DB/5/UCACA/ss-5-UCACA_x.pdb.gz
MCSYM-DB/5/UCACC/
MCSYM-DB/5/UCACC/5-UCACC.mcs
MCSYM-DB/5/UCACC/ss-5-UCACC_x.pdb.gz
MCSYM-DB/5/UCACG/
MCSYM-DB/5/UCACG/5-UCACG.mcs
MCSYM-DB/5/UCACG/ss-5-UCACG_x.pdb.gz
MCSYM-DB/5/UCACU/
MCSYM-DB/5/UCACU/5-UCACU.mcs
MCSYM-DB/5/UCACU/ss-5-UCACU_x.pdb.gz
MCSYM-DB/5/UCAGA/
MCSYM-DB/5/UCAGA/5-UCAGA.mcs
MCSYM-DB/5/UCAGA/ss-5-UCAGA_x.pdb.gz
MCSYM-DB/5/UCAGC/
MCSYM-DB/5/UCAGC/5-UCAGC.mcs
MCSYM-DB/5/UCAGC/ss-5-UCAGC_x.pdb.gz
MCSYM-DB/5/UCAGG/
MCSYM-DB/5/UCAGG/5-UCAGG.mcs
MCSYM-DB/5/UCAGG/ss-5-UCAGG_x.pdb.gz
MCSYM-DB/5/UCAGU/
MCSYM-DB/5/UCAGU/5-UCAGU.mcs
MCSYM-DB/5/UCAGU/ss-5-UCAGU_x.pdb.gz
MCSYM-DB/5/UCAUA/
MCSYM-DB/5/UCAUA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/UCAUA/5-UCAUA.mcs
MCSYM-DB/5/UCAUA/ss-5-UCAUA_x.pdb.gz
MCSYM-DB/5/UCAUC/
MCSYM-DB/5/UCAUC/5-UCAUC.mcs
MCSYM-DB/5/UCAUC/ss-5-UCAUC_x.pdb.gz
MCSYM-DB/5/UCAUG/
MCSYM-DB/5/UCAUG/5-UCAUG.mcs
MCSYM-DB/5/UCAUG/ss-5-UCAUG_x.pdb.gz
MCSYM-DB/5/UCAUU/
MCSYM-DB/5/UCAUU/5-UCAUU.mcs
MCSYM-DB/5/UCAUU/ss-5-UCAUU_x.pdb.gz
MCSYM-DB/5/UCCAA/
MCSYM-DB/5/UCCAA/5-UCCAA.mcs
MCSYM-DB/5/UCCAA/ss-5-UCCAA_x.pdb.gz
MCSYM-DB/5/UCCAC/
MCSYM-DB/5/UCCAC/5-UCCAC.mcs
MCSYM-DB/5/UCCAC/ss-5-UCCAC_x.pdb.gz
MCSYM-DB/5/UCCAG/
MCSYM-DB/5/UCCAG/5-UCCAG.mcs
MCSYM-DB/5/UCCAG/ss-5-UCCAG_x.pdb.gz
MCSYM-DB/5/UCCAU/
MCSYM-DB/5/UCCAU/5-UCCAU.mcs
MCSYM-DB/5/UCCAU/ss-5-UCCAU_x.pdb.gz
MCSYM-DB/5/UCCCA/
MCSYM-DB/5/UCCCA/5-UCCCA.mcs
MCSYM-DB/5/UCCCA/ss-5-UCCCA_x.pdb.gz
MCSYM-DB/5/UCCCC/
MCSYM-DB/5/UCCCC/5-UCCCC.mcs
MCSYM-DB/5/UCCCC/ss-5-UCCCC_x.pdb.gz
MCSYM-DB/5/UCCCG/
MCSYM-DB/5/UCCCG/5-UCCCG.mcs
MCSYM-DB/5/UCCCG/ss-5-UCCCG_x.pdb.gz
MCSYM-DB/5/UCCCU/
MCSYM-DB/5/UCCCU/5-UCCCU.mcs
MCSYM-DB/5/UCCCU/ss-5-UCCCU_x.pdb.gz
MCSYM-DB/5/UCCGA/
MCSYM-DB/5/UCCGA/5-UCCGA.mcs
MCSYM-DB/5/UCCGA/ss-5-UCCGA_x.pdb.gz
MCSYM-DB/5/UCCGC/
MCSYM-DB/5/UCCGC/5-UCCGC.mcs
MCSYM-DB/5/UCCGC/ss-5-UCCGC_x.pdb.gz
MCSYM-DB/5/UCCGG/
MCSYM-DB/5/UCCGG/5-UCCGG.mcs
MCSYM-DB/5/UCCGG/ss-5-UCCGG_x.pdb.gz
MCSYM-DB/5/UCCGU/
MCSYM-DB/5/UCCGU/5-UCCGU.mcs
MCSYM-DB/5/UCCGU/ss-5-UCCGU_x.pdb.gz
MCSYM-DB/5/UCCUA/
MCSYM-DB/5/UCCUA/5-UCCUA.mcs
MCSYM-DB/5/UCCUA/ss-5-UCCUA_x.pdb.gz
MCSYM-DB/5/UCCUC/
MCSYM-DB/5/UCCUC/5-UCCUC.mcs
MCSYM-DB/5/UCCUC/ss-5-UCCUC_x.pdb.gz
MCSYM-DB/5/UCCUG/
MCSYM-DB/5/UCCUG/5-UCCUG.mcs
MCSYM-DB/5/UCCUG/ss-5-UCCUG_x.pdb.gz
MCSYM-DB/5/UCCUU/
MCSYM-DB/5/UCCUU/5-UCCUU.mcs
MCSYM-DB/5/UCCUU/ss-5-UCCUU_x.pdb.gz
MCSYM-DB/5/UCGAA/
MCSYM-DB/5/UCGAA/5-UCGAA.mcs
MCSYM-DB/5/UCGAA/ss-5-UCGAA_x.pdb.gz
MCSYM-DB/5/UCGAC/
MCSYM-DB/5/UCGAC/5-UCGAC.mcs
MCSYM-DB/5/UCGAC/ss-5-UCGAC_x.pdb.gz
MCSYM-DB/5/UCGAG/
MCSYM-DB/5/UCGAG/5-UCGAG.mcs
MCSYM-DB/5/UCGAG/ss-5-UCGAG_x.pdb.gz
MCSYM-DB/5/UCGAU/
MCSYM-DB/5/UCGAU/5-UCGAU.mcs
MCSYM-DB/5/UCGAU/ss-5-UCGAU_x.pdb.gz
MCSYM-DB/5/UCGCA/
MCSYM-DB/5/UCGCA/5-UCGCA.mcs
MCSYM-DB/5/UCGCA/ss-5-UCGCA_x.pdb.gz
MCSYM-DB/5/UCGCC/
MCSYM-DB/5/UCGCC/5-UCGCC.mcs
MCSYM-DB/5/UCGCC/ss-5-UCGCC_x.pdb.gz
MCSYM-DB/5/UCGCG/
MCSYM-DB/5/UCGCG/5-UCGCG.mcs
MCSYM-DB/5/UCGCG/ss-5-UCGCG_x.pdb.gz
MCSYM-DB/5/UCGCU/
MCSYM-DB/5/UCGCU/5-UCGCU.mcs
MCSYM-DB/5/UCGCU/ss-5-UCGCU_x.pdb.gz
MCSYM-DB/5/UCGGA/
MCSYM-DB/5/UCGGA/5-UCGGA.mcs
MCSYM-DB/5/UCGGA/ss-5-UCGGA_x.pdb.gz
MCSYM-DB/5/UCGGC/
MCSYM-DB/5/UCGGC/5-UCGGC.mcs
MCSYM-DB/5/UCGGC/ss-5-UCGGC_x.pdb.gz
MCSYM-DB/5/UCGGG/
MCSYM-DB/5/UCGGG/5-UCGGG.mcs
MCSYM-DB/5/UCGGG/ss-5-UCGGG_x.pdb.gz
MCSYM-DB/5/UCGGU/
MCSYM-DB/5/UCGGU/5-UCGGU.mcs
MCSYM-DB/5/UCGGU/ss-5-UCGGU_x.pdb.gz
MCSYM-DB/5/UCGUA/
MCSYM-DB/5/UCGUA/5-UCGUA.mcs
MCSYM-DB/5/UCGUA/ss-5-UCGUA_x.pdb.gz
MCSYM-DB/5/UCGUC/
MCSYM-DB/5/UCGUC/5-UCGUC.mcs
MCSYM-DB/5/UCGUC/ss-5-UCGUC_x.pdb.gz
MCSYM-DB/5/UCGUG/
MCSYM-DB/5/UCGUG/5-UCGUG.mcs
MCSYM-DB/5/UCGUG/ss-5-UCGUG_x.pdb.gz
MCSYM-DB/5/UCGUU/
MCSYM-DB/5/UCGUU/5-UCGUU.mcs
MCSYM-DB/5/UCGUU/ss-5-UCGUU_x.pdb.gz
MCSYM-DB/5/UCUAA/
MCSYM-DB/5/UCUAA/5-UCUAA.mcs
MCSYM-DB/5/UCUAA/ss-5-UCUAA_x.pdb.gz
MCSYM-DB/5/UCUAC/
MCSYM-DB/5/UCUAC/5-UCUAC.mcs
MCSYM-DB/5/UCUAC/ss-5-UCUAC_x.pdb.gz
MCSYM-DB/5/UCUAG/
MCSYM-DB/5/UCUAG/5-UCUAG.mcs
MCSYM-DB/5/UCUAG/ss-5-UCUAG_x.pdb.gz
MCSYM-DB/5/UCUAU/
MCSYM-DB/5/UCUAU/5-UCUAU.mcs
MCSYM-DB/5/UCUAU/ss-5-UCUAU_x.pdb.gz
MCSYM-DB/5/UCUCA/
MCSYM-DB/5/UCUCA/5-UCUCA.mcs
MCSYM-DB/5/UCUCA/ss-5-UCUCA_x.pdb.gz
MCSYM-DB/5/UCUCC/
MCSYM-DB/5/UCUCC/5-UCUCC.mcs
MCSYM-DB/5/UCUCC/ss-5-UCUCC_x.pdb.gz
MCSYM-DB/5/UCUCG/
MCSYM-DB/5/UCUCG/5-UCUCG.mcs
MCSYM-DB/5/UCUCG/ss-5-UCUCG_x.pdb.gz
MCSYM-DB/5/UCUCU/
MCSYM-DB/5/UCUCU/5-UCUCU.mcs
MCSYM-DB/5/UCUCU/ss-5-UCUCU_x.pdb.gz
MCSYM-DB/5/UCUGA/
MCSYM-DB/5/UCUGA/5-UCUGA.mcs
MCSYM-DB/5/UCUGA/ss-5-UCUGA_x.pdb.gz
MCSYM-DB/5/UCUGC/
MCSYM-DB/5/UCUGC/5-UCUGC.mcs
MCSYM-DB/5/UCUGC/ss-5-UCUGC_x.pdb.gz
MCSYM-DB/5/UCUGG/
MCSYM-DB/5/UCUGG/5-UCUGG.mcs
MCSYM-DB/5/UCUGG/ss-5-UCUGG_x.pdb.gz
MCSYM-DB/5/UCUGU/
MCSYM-DB/5/UCUGU/5-UCUGU.mcs
MCSYM-DB/5/UCUGU/ss-5-UCUGU_x.pdb.gz
MCSYM-DB/5/UCUUA/
MCSYM-DB/5/UCUUA/5-UCUUA.mcs
MCSYM-DB/5/UCUUA/ss-5-UCUUA_x.pdb.gz
MCSYM-DB/5/UCUUC/
MCSYM-DB/5/UCUUC/5-UCUUC.mcs
MCSYM-DB/5/UCUUC/ss-5-UCUUC_x.pdb.gz
MCSYM-DB/5/UCUUG/
MCSYM-DB/5/UCUUG/5-UCUUG.mcs
MCSYM-DB/5/UCUUG/ss-5-UCUUG_x.pdb.gz
MCSYM-DB/5/UCUUU/
MCSYM-DB/5/UCUUU/5-UCUUU.mcs
MCSYM-DB/5/UCUUU/ss-5-UCUUU_x.pdb.gz
MCSYM-DB/5/UGAAA/
MCSYM-DB/5/UGAAA/5-UGAAA.mcs
MCSYM-DB/5/UGAAA/ss-5-UGAAA_x.pdb.gz
MCSYM-DB/5/UGAAC/
MCSYM-DB/5/UGAAC/5-UGAAC.mcs
MCSYM-DB/5/UGAAC/ss-5-UGAAC_x.pdb.gz
MCSYM-DB/5/UGAAG/
MCSYM-DB/5/UGAAG/5-UGAAG.mcs
MCSYM-DB/5/UGAAG/ss-5-UGAAG_x.pdb.gz
MCSYM-DB/5/UGAAU/
MCSYM-DB/5/UGAAU/5-UGAAU.mcs
MCSYM-DB/5/UGAAU/ss-5-UGAAU_x.pdb.gz
MCSYM-DB/5/UGACA/
MCSYM-DB/5/UGACA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/UGACA/5-UGACA.mcs
MCSYM-DB/5/UGACA/ss-5-UGACA_x.pdb.gz
MCSYM-DB/5/UGACC/
MCSYM-DB/5/UGACC/5-UGACC.mcs
MCSYM-DB/5/UGACC/ss-5-UGACC_x.pdb.gz
MCSYM-DB/5/UGACG/
MCSYM-DB/5/UGACG/5-UGACG.mcs
MCSYM-DB/5/UGACG/ss-5-UGACG_x.pdb.gz
MCSYM-DB/5/UGACU/
MCSYM-DB/5/UGACU/5-UGACU.mcs
MCSYM-DB/5/UGACU/ss-5-UGACU_x.pdb.gz
MCSYM-DB/5/UGAGA/
MCSYM-DB/5/UGAGA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/UGAGA/1XMQ_model_1.pdb.gz
MCSYM-DB/5/UGAGA/5-UGAGA.mcs
MCSYM-DB/5/UGAGA/ss-5-UGAGA_x.pdb.gz
MCSYM-DB/5/UGAGC/
MCSYM-DB/5/UGAGC/5-UGAGC.mcs
MCSYM-DB/5/UGAGC/ss-5-UGAGC_x.pdb.gz
MCSYM-DB/5/UGAGG/
MCSYM-DB/5/UGAGG/5-UGAGG.mcs
MCSYM-DB/5/UGAGG/ss-5-UGAGG_x.pdb.gz
MCSYM-DB/5/UGAGU/
MCSYM-DB/5/UGAGU/5-UGAGU.mcs
MCSYM-DB/5/UGAGU/ss-5-UGAGU_x.pdb.gz
MCSYM-DB/5/UGAUA/
MCSYM-DB/5/UGAUA/5-UGAUA.mcs
MCSYM-DB/5/UGAUA/ss-5-UGAUA_x.pdb.gz
MCSYM-DB/5/UGAUC/
MCSYM-DB/5/UGAUC/5-UGAUC.mcs
MCSYM-DB/5/UGAUC/ss-5-UGAUC_x.pdb.gz
MCSYM-DB/5/UGAUG/
MCSYM-DB/5/UGAUG/5-UGAUG.mcs
MCSYM-DB/5/UGAUG/ss-5-UGAUG_x.pdb.gz
MCSYM-DB/5/UGAUU/
MCSYM-DB/5/UGAUU/5-UGAUU.mcs
MCSYM-DB/5/UGAUU/ss-5-UGAUU_x.pdb.gz
MCSYM-DB/5/UGCAA/
MCSYM-DB/5/UGCAA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/UGCAA/1XMQ_model_1.pdb.gz
MCSYM-DB/5/UGCAA/5-UGCAA.mcs
MCSYM-DB/5/UGCAA/ss-5-UGCAA_x.pdb.gz
MCSYM-DB/5/UGCAC/
MCSYM-DB/5/UGCAC/5-UGCAC.mcs
MCSYM-DB/5/UGCAC/ss-5-UGCAC_x.pdb.gz
MCSYM-DB/5/UGCAG/
MCSYM-DB/5/UGCAG/5-UGCAG.mcs
MCSYM-DB/5/UGCAG/ss-5-UGCAG_x.pdb.gz
MCSYM-DB/5/UGCAU/
MCSYM-DB/5/UGCAU/5-UGCAU.mcs
MCSYM-DB/5/UGCAU/ss-5-UGCAU_x.pdb.gz
MCSYM-DB/5/UGCCA/
MCSYM-DB/5/UGCCA/5-UGCCA.mcs
MCSYM-DB/5/UGCCA/ss-5-UGCCA_x.pdb.gz
MCSYM-DB/5/UGCCC/
MCSYM-DB/5/UGCCC/5-UGCCC.mcs
MCSYM-DB/5/UGCCC/ss-5-UGCCC_x.pdb.gz
MCSYM-DB/5/UGCCG/
MCSYM-DB/5/UGCCG/5-UGCCG.mcs
MCSYM-DB/5/UGCCG/ss-5-UGCCG_x.pdb.gz
MCSYM-DB/5/UGCCU/
MCSYM-DB/5/UGCCU/5-UGCCU.mcs
MCSYM-DB/5/UGCCU/ss-5-UGCCU_x.pdb.gz
MCSYM-DB/5/UGCGA/
MCSYM-DB/5/UGCGA/5-UGCGA.mcs
MCSYM-DB/5/UGCGA/ss-5-UGCGA_x.pdb.gz
MCSYM-DB/5/UGCGC/
MCSYM-DB/5/UGCGC/5-UGCGC.mcs
MCSYM-DB/5/UGCGC/ss-5-UGCGC_x.pdb.gz
MCSYM-DB/5/UGCGG/
MCSYM-DB/5/UGCGG/5-UGCGG.mcs
MCSYM-DB/5/UGCGG/ss-5-UGCGG_x.pdb.gz
MCSYM-DB/5/UGCGU/
MCSYM-DB/5/UGCGU/5-UGCGU.mcs
MCSYM-DB/5/UGCGU/ss-5-UGCGU_x.pdb.gz
MCSYM-DB/5/UGCUA/
MCSYM-DB/5/UGCUA/5-UGCUA.mcs
MCSYM-DB/5/UGCUA/ss-5-UGCUA_x.pdb.gz
MCSYM-DB/5/UGCUC/
MCSYM-DB/5/UGCUC/5-UGCUC.mcs
MCSYM-DB/5/UGCUC/ss-5-UGCUC_x.pdb.gz
MCSYM-DB/5/UGCUG/
MCSYM-DB/5/UGCUG/5-UGCUG.mcs
MCSYM-DB/5/UGCUG/ss-5-UGCUG_x.pdb.gz
MCSYM-DB/5/UGCUU/
MCSYM-DB/5/UGCUU/5-UGCUU.mcs
MCSYM-DB/5/UGCUU/ss-5-UGCUU_x.pdb.gz
MCSYM-DB/5/UGGAA/
MCSYM-DB/5/UGGAA/5-UGGAA.mcs
MCSYM-DB/5/UGGAA/ss-5-UGGAA_x.pdb.gz
MCSYM-DB/5/UGGAC/
MCSYM-DB/5/UGGAC/5-UGGAC.mcs
MCSYM-DB/5/UGGAC/ss-5-UGGAC_x.pdb.gz
MCSYM-DB/5/UGGAG/
MCSYM-DB/5/UGGAG/5-UGGAG.mcs
MCSYM-DB/5/UGGAG/ss-5-UGGAG_x.pdb.gz
MCSYM-DB/5/UGGAU/
MCSYM-DB/5/UGGAU/5-UGGAU.mcs
MCSYM-DB/5/UGGAU/ss-5-UGGAU_x.pdb.gz
MCSYM-DB/5/UGGCA/
MCSYM-DB/5/UGGCA/5-UGGCA.mcs
MCSYM-DB/5/UGGCA/ss-5-UGGCA_x.pdb.gz
MCSYM-DB/5/UGGCC/
MCSYM-DB/5/UGGCC/5-UGGCC.mcs
MCSYM-DB/5/UGGCC/ss-5-UGGCC_x.pdb.gz
MCSYM-DB/5/UGGCG/
MCSYM-DB/5/UGGCG/5-UGGCG.mcs
MCSYM-DB/5/UGGCG/ss-5-UGGCG_x.pdb.gz
MCSYM-DB/5/UGGCU/
MCSYM-DB/5/UGGCU/5-UGGCU.mcs
MCSYM-DB/5/UGGCU/ss-5-UGGCU_x.pdb.gz
MCSYM-DB/5/UGGGA/
MCSYM-DB/5/UGGGA/5-UGGGA.mcs
MCSYM-DB/5/UGGGA/ss-5-UGGGA_x.pdb.gz
MCSYM-DB/5/UGGGC/
MCSYM-DB/5/UGGGC/5-UGGGC.mcs
MCSYM-DB/5/UGGGC/ss-5-UGGGC_x.pdb.gz
MCSYM-DB/5/UGGGG/
MCSYM-DB/5/UGGGG/5-UGGGG.mcs
MCSYM-DB/5/UGGGG/ss-5-UGGGG_x.pdb.gz
MCSYM-DB/5/UGGGU/
MCSYM-DB/5/UGGGU/5-UGGGU.mcs
MCSYM-DB/5/UGGGU/ss-5-UGGGU_x.pdb.gz
MCSYM-DB/5/UGGUA/
MCSYM-DB/5/UGGUA/5-UGGUA.mcs
MCSYM-DB/5/UGGUA/ss-5-UGGUA_x.pdb.gz
MCSYM-DB/5/UGGUC/
MCSYM-DB/5/UGGUC/5-UGGUC.mcs
MCSYM-DB/5/UGGUC/ss-5-UGGUC_x.pdb.gz
MCSYM-DB/5/UGGUG/
MCSYM-DB/5/UGGUG/5-UGGUG.mcs
MCSYM-DB/5/UGGUG/ss-5-UGGUG_x.pdb.gz
MCSYM-DB/5/UGGUU/
MCSYM-DB/5/UGGUU/5-UGGUU.mcs
MCSYM-DB/5/UGGUU/ss-5-UGGUU_x.pdb.gz
MCSYM-DB/5/UGUAA/
MCSYM-DB/5/UGUAA/5-UGUAA.mcs
MCSYM-DB/5/UGUAA/ss-5-UGUAA_x.pdb.gz
MCSYM-DB/5/UGUAC/
MCSYM-DB/5/UGUAC/5-UGUAC.mcs
MCSYM-DB/5/UGUAG/
MCSYM-DB/5/UGUAG/5-UGUAG.mcs
MCSYM-DB/5/UGUAG/ss-5-UGUAG_x.pdb.gz
MCSYM-DB/5/UGUAU/
MCSYM-DB/5/UGUAU/5-UGUAU.mcs
MCSYM-DB/5/UGUAU/ss-5-UGUAU_x.pdb.gz
MCSYM-DB/5/UGUCA/
MCSYM-DB/5/UGUCA/5-UGUCA.mcs
MCSYM-DB/5/UGUCA/ss-5-UGUCA_x.pdb.gz
MCSYM-DB/5/UGUCC/
MCSYM-DB/5/UGUCC/5-UGUCC.mcs
MCSYM-DB/5/UGUCC/ss-5-UGUCC_x.pdb.gz
MCSYM-DB/5/UGUCG/
MCSYM-DB/5/UGUCG/5-UGUCG.mcs
MCSYM-DB/5/UGUCG/ss-5-UGUCG_x.pdb.gz
MCSYM-DB/5/UGUCU/
MCSYM-DB/5/UGUCU/5-UGUCU.mcs
MCSYM-DB/5/UGUCU/ss-5-UGUCU_x.pdb.gz
MCSYM-DB/5/UGUGA/
MCSYM-DB/5/UGUGA/5-UGUGA.mcs
MCSYM-DB/5/UGUGA/ss-5-UGUGA_x.pdb.gz
MCSYM-DB/5/UGUGC/
MCSYM-DB/5/UGUGC/5-UGUGC.mcs
MCSYM-DB/5/UGUGC/ss-5-UGUGC_x.pdb.gz
MCSYM-DB/5/UGUGG/
MCSYM-DB/5/UGUGG/5-UGUGG.mcs
MCSYM-DB/5/UGUGG/ss-5-UGUGG_x.pdb.gz
MCSYM-DB/5/UGUGU/
MCSYM-DB/5/UGUGU/5-UGUGU.mcs
MCSYM-DB/5/UGUGU/ss-5-UGUGU_x.pdb.gz
MCSYM-DB/5/UGUUA/
MCSYM-DB/5/UGUUA/5-UGUUA.mcs
MCSYM-DB/5/UGUUA/ss-5-UGUUA_x.pdb.gz
MCSYM-DB/5/UGUUC/
MCSYM-DB/5/UGUUC/5-UGUUC.mcs
MCSYM-DB/5/UGUUC/ss-5-UGUUC_x.pdb.gz
MCSYM-DB/5/UGUUG/
MCSYM-DB/5/UGUUG/5-UGUUG.mcs
MCSYM-DB/5/UGUUG/ss-5-UGUUG_x.pdb.gz
MCSYM-DB/5/UGUUU/
MCSYM-DB/5/UGUUU/5-UGUUU.mcs
MCSYM-DB/5/UGUUU/ss-5-UGUUU_x.pdb.gz
MCSYM-DB/5/UUAAA/
MCSYM-DB/5/UUAAA/1FG0_model_1.pdb.gz
MCSYM-DB/5/UUAAA/1HC8_model_1.pdb.gz
MCSYM-DB/5/UUAAA/1MMS_model_1.pdb.gz
MCSYM-DB/5/UUAAA/1OLN_model_1.pdb.gz
MCSYM-DB/5/UUAAA/1VQ7_model_1.pdb.gz
MCSYM-DB/5/UUAAA/1Y39_model_1.pdb.gz
MCSYM-DB/5/UUAAA/5-UUAAA.mcs
MCSYM-DB/5/UUAAA/ss-5-UUAAA_x.pdb.gz
MCSYM-DB/5/UUAAC/
MCSYM-DB/5/UUAAC/5-UUAAC.mcs
MCSYM-DB/5/UUAAC/ss-5-UUAAC_x.pdb.gz
MCSYM-DB/5/UUAAG/
MCSYM-DB/5/UUAAG/5-UUAAG.mcs
MCSYM-DB/5/UUAAG/ss-5-UUAAG_x.pdb.gz
MCSYM-DB/5/UUAAU/
MCSYM-DB/5/UUAAU/5-UUAAU.mcs
MCSYM-DB/5/UUAAU/ss-5-UUAAU_x.pdb.gz
MCSYM-DB/5/UUACA/
MCSYM-DB/5/UUACA/5-UUACA.mcs
MCSYM-DB/5/UUACA/ss-5-UUACA_x.pdb.gz
MCSYM-DB/5/UUACC/
MCSYM-DB/5/UUACC/5-UUACC.mcs
MCSYM-DB/5/UUACC/ss-5-UUACC_x.pdb.gz
MCSYM-DB/5/UUACG/
MCSYM-DB/5/UUACG/5-UUACG.mcs
MCSYM-DB/5/UUACG/ss-5-UUACG_x.pdb.gz
MCSYM-DB/5/UUACU/
MCSYM-DB/5/UUACU/5-UUACU.mcs
MCSYM-DB/5/UUACU/ss-5-UUACU_x.pdb.gz
MCSYM-DB/5/UUAGA/
MCSYM-DB/5/UUAGA/5-UUAGA.mcs
MCSYM-DB/5/UUAGA/ss-5-UUAGA_x.pdb.gz
MCSYM-DB/5/UUAGC/
MCSYM-DB/5/UUAGC/5-UUAGC.mcs
MCSYM-DB/5/UUAGC/ss-5-UUAGC_x.pdb.gz
MCSYM-DB/5/UUAGG/
MCSYM-DB/5/UUAGG/5-UUAGG.mcs
MCSYM-DB/5/UUAGG/ss-5-UUAGG_x.pdb.gz
MCSYM-DB/5/UUAGU/
MCSYM-DB/5/UUAGU/5-UUAGU.mcs
MCSYM-DB/5/UUAGU/ss-5-UUAGU_x.pdb.gz
MCSYM-DB/5/UUAUA/
MCSYM-DB/5/UUAUA/5-UUAUA.mcs
MCSYM-DB/5/UUAUA/ss-5-UUAUA_x.pdb.gz
MCSYM-DB/5/UUAUC/
MCSYM-DB/5/UUAUC/5-UUAUC.mcs
MCSYM-DB/5/UUAUC/ss-5-UUAUC_x.pdb.gz
MCSYM-DB/5/UUAUG/
MCSYM-DB/5/UUAUG/5-UUAUG.mcs
MCSYM-DB/5/UUAUG/ss-5-UUAUG_x.pdb.gz
MCSYM-DB/5/UUAUU/
MCSYM-DB/5/UUAUU/5-UUAUU.mcs
MCSYM-DB/5/UUAUU/ss-5-UUAUU_x.pdb.gz
MCSYM-DB/5/UUCAA/
MCSYM-DB/5/UUCAA/1IVS_model_1.pdb.gz
MCSYM-DB/5/UUCAA/1J1U_model_1.pdb.gz
MCSYM-DB/5/UUCAA/1QU2_model_1.pdb.gz
MCSYM-DB/5/UUCAA/2BTE_model_1.pdb.gz
MCSYM-DB/5/UUCAA/5-UUCAA.mcs
MCSYM-DB/5/UUCAA/ss-5-UUCAA_x.pdb.gz
MCSYM-DB/5/UUCAC/
MCSYM-DB/5/UUCAC/5-UUCAC.mcs
MCSYM-DB/5/UUCAC/ss-5-UUCAC_x.pdb.gz
MCSYM-DB/5/UUCAG/
MCSYM-DB/5/UUCAG/5-UUCAG.mcs
MCSYM-DB/5/UUCAG/ss-5-UUCAG_x.pdb.gz
MCSYM-DB/5/UUCAU/
MCSYM-DB/5/UUCAU/5-UUCAU.mcs
MCSYM-DB/5/UUCAU/ss-5-UUCAU_x.pdb.gz
MCSYM-DB/5/UUCCA/
MCSYM-DB/5/UUCCA/5-UUCCA.mcs
MCSYM-DB/5/UUCCA/ss-5-UUCCA_x.pdb.gz
MCSYM-DB/5/UUCCC/
MCSYM-DB/5/UUCCC/5-UUCCC.mcs
MCSYM-DB/5/UUCCC/ss-5-UUCCC_x.pdb.gz
MCSYM-DB/5/UUCCG/
MCSYM-DB/5/UUCCG/5-UUCCG.mcs
MCSYM-DB/5/UUCCG/ss-5-UUCCG_x.pdb.gz
MCSYM-DB/5/UUCCU/
MCSYM-DB/5/UUCCU/5-UUCCU.mcs
MCSYM-DB/5/UUCCU/ss-5-UUCCU_x.pdb.gz
MCSYM-DB/5/UUCGA/
MCSYM-DB/5/UUCGA/1EUY_model_1.pdb.gz
MCSYM-DB/5/UUCGA/1EXD_model_1.pdb.gz
MCSYM-DB/5/UUCGA/1N77_model_1.pdb.gz
MCSYM-DB/5/UUCGA/1U0B_model_1.pdb.gz
MCSYM-DB/5/UUCGA/1ZJW_model_1.pdb.gz
MCSYM-DB/5/UUCGA/2CSX_model_1.pdb.gz
MCSYM-DB/5/UUCGA/2FK6_model_1.pdb.gz
MCSYM-DB/5/UUCGA/5-UUCGA.mcs
MCSYM-DB/5/UUCGA/ss-5-UUCGA_x.pdb.gz
MCSYM-DB/5/UUCGC/
MCSYM-DB/5/UUCGC/5-UUCGC.mcs
MCSYM-DB/5/UUCGC/ss-5-UUCGC_x.pdb.gz
MCSYM-DB/5/UUCGG/
MCSYM-DB/5/UUCGG/5-UUCGG.mcs
MCSYM-DB/5/UUCGG/ss-5-UUCGG_x.pdb.gz
MCSYM-DB/5/UUCGU/
MCSYM-DB/5/UUCGU/5-UUCGU.mcs
MCSYM-DB/5/UUCGU/ss-5-UUCGU_x.pdb.gz
MCSYM-DB/5/UUCUA/
MCSYM-DB/5/UUCUA/5-UUCUA.mcs
MCSYM-DB/5/UUCUA/ss-5-UUCUA_x.pdb.gz
MCSYM-DB/5/UUCUC/
MCSYM-DB/5/UUCUC/5-UUCUC.mcs
MCSYM-DB/5/UUCUC/ss-5-UUCUC_x.pdb.gz
MCSYM-DB/5/UUCUG/
MCSYM-DB/5/UUCUG/5-UUCUG.mcs
MCSYM-DB/5/UUCUG/ss-5-UUCUG_x.pdb.gz
MCSYM-DB/5/UUCUU/
MCSYM-DB/5/UUCUU/5-UUCUU.mcs
MCSYM-DB/5/UUCUU/ss-5-UUCUU_x.pdb.gz
MCSYM-DB/5/UUGAA/
MCSYM-DB/5/UUGAA/5-UUGAA.mcs
MCSYM-DB/5/UUGAA/ss-5-UUGAA_x.pdb.gz
MCSYM-DB/5/UUGAC/
MCSYM-DB/5/UUGAC/5-UUGAC.mcs
MCSYM-DB/5/UUGAC/ss-5-UUGAC_x.pdb.gz
MCSYM-DB/5/UUGAG/
MCSYM-DB/5/UUGAG/5-UUGAG.mcs
MCSYM-DB/5/UUGAG/ss-5-UUGAG_x.pdb.gz
MCSYM-DB/5/UUGAU/
MCSYM-DB/5/UUGAU/5-UUGAU.mcs
MCSYM-DB/5/UUGAU/ss-5-UUGAU_x.pdb.gz
MCSYM-DB/5/UUGCA/
MCSYM-DB/5/UUGCA/5-UUGCA.mcs
MCSYM-DB/5/UUGCA/ss-5-UUGCA_x.pdb.gz
MCSYM-DB/5/UUGCC/
MCSYM-DB/5/UUGCC/5-UUGCC.mcs
MCSYM-DB/5/UUGCC/ss-5-UUGCC_x.pdb.gz
MCSYM-DB/5/UUGCG/
MCSYM-DB/5/UUGCG/5-UUGCG.mcs
MCSYM-DB/5/UUGCG/ss-5-UUGCG_x.pdb.gz
MCSYM-DB/5/UUGCU/
MCSYM-DB/5/UUGCU/5-UUGCU.mcs
MCSYM-DB/5/UUGCU/ss-5-UUGCU_x.pdb.gz
MCSYM-DB/5/UUGGA/
MCSYM-DB/5/UUGGA/5-UUGGA.mcs
MCSYM-DB/5/UUGGA/ss-5-UUGGA_x.pdb.gz
MCSYM-DB/5/UUGGC/
MCSYM-DB/5/UUGGC/5-UUGGC.mcs
MCSYM-DB/5/UUGGC/ss-5-UUGGC_x.pdb.gz
MCSYM-DB/5/UUGGG/
MCSYM-DB/5/UUGGG/1FQZ_model_1.pdb.gz
MCSYM-DB/5/UUGGG/1OQ0_model_1.pdb.gz
MCSYM-DB/5/UUGGG/5-UUGGG.mcs
MCSYM-DB/5/UUGGG/ss-5-UUGGG_x.pdb.gz
MCSYM-DB/5/UUGGU/
MCSYM-DB/5/UUGGU/5-UUGGU.mcs
MCSYM-DB/5/UUGGU/ss-5-UUGGU_x.pdb.gz
MCSYM-DB/5/UUGUA/
MCSYM-DB/5/UUGUA/5-UUGUA.mcs
MCSYM-DB/5/UUGUA/ss-5-UUGUA_x.pdb.gz
MCSYM-DB/5/UUGUC/
MCSYM-DB/5/UUGUC/5-UUGUC.mcs
MCSYM-DB/5/UUGUC/ss-5-UUGUC_x.pdb.gz
MCSYM-DB/5/UUGUG/
MCSYM-DB/5/UUGUG/5-UUGUG.mcs
MCSYM-DB/5/UUGUG/ss-5-UUGUG_x.pdb.gz
MCSYM-DB/5/UUGUU/
MCSYM-DB/5/UUGUU/5-UUGUU.mcs
MCSYM-DB/5/UUGUU/ss-5-UUGUU_x.pdb.gz
MCSYM-DB/5/UUUAA/
MCSYM-DB/5/UUUAA/5-UUUAA.mcs
MCSYM-DB/5/UUUAA/ss-5-UUUAA_x.pdb.gz
MCSYM-DB/5/UUUAC/
MCSYM-DB/5/UUUAC/5-UUUAC.mcs
MCSYM-DB/5/UUUAC/ss-5-UUUAC_x.pdb.gz
MCSYM-DB/5/UUUAG/
MCSYM-DB/5/UUUAG/5-UUUAG.mcs
MCSYM-DB/5/UUUAG/ss-5-UUUAG_x.pdb.gz
MCSYM-DB/5/UUUAU/
MCSYM-DB/5/UUUAU/5-UUUAU.mcs
MCSYM-DB/5/UUUAU/ss-5-UUUAU_x.pdb.gz
MCSYM-DB/5/UUUCA/
MCSYM-DB/5/UUUCA/5-UUUCA.mcs
MCSYM-DB/5/UUUCA/ss-5-UUUCA_x.pdb.gz
MCSYM-DB/5/UUUCC/
MCSYM-DB/5/UUUCC/5-UUUCC.mcs
MCSYM-DB/5/UUUCC/ss-5-UUUCC_x.pdb.gz
MCSYM-DB/5/UUUCG/
MCSYM-DB/5/UUUCG/5-UUUCG.mcs
MCSYM-DB/5/UUUCG/ss-5-UUUCG_x.pdb.gz
MCSYM-DB/5/UUUCU/
MCSYM-DB/5/UUUCU/5-UUUCU.mcs
MCSYM-DB/5/UUUCU/ss-5-UUUCU_x.pdb.gz
MCSYM-DB/5/UUUGA/
MCSYM-DB/5/UUUGA/5-UUUGA.mcs
MCSYM-DB/5/UUUGA/ss-5-UUUGA_x.pdb.gz
MCSYM-DB/5/UUUGC/
MCSYM-DB/5/UUUGC/5-UUUGC.mcs
MCSYM-DB/5/UUUGC/ss-5-UUUGC_x.pdb.gz
MCSYM-DB/5/UUUGG/
MCSYM-DB/5/UUUGG/5-UUUGG.mcs
MCSYM-DB/5/UUUGG/ss-5-UUUGG_x.pdb.gz
MCSYM-DB/5/UUUGU/
MCSYM-DB/5/UUUGU/5-UUUGU.mcs
MCSYM-DB/5/UUUGU/ss-5-UUUGU_x.pdb.gz
MCSYM-DB/5/UUUUA/
MCSYM-DB/5/UUUUA/5-UUUUA.mcs
MCSYM-DB/5/UUUUA/ss-5-UUUUA_x.pdb.gz
MCSYM-DB/5/UUUUC/
MCSYM-DB/5/UUUUC/5-UUUUC.mcs
MCSYM-DB/5/UUUUC/ss-5-UUUUC_x.pdb.gz
MCSYM-DB/5/UUUUG/
MCSYM-DB/5/UUUUG/5-UUUUG.mcs
MCSYM-DB/5/UUUUG/ss-5-UUUUG_x.pdb.gz
MCSYM-DB/5/UUUUU/
MCSYM-DB/5/UUUUU/5-UUUUU.mcs
MCSYM-DB/5/UUUUU/ss-5-UUUUU_x.pdb.gz
MCSYM-DB/5_2/
MCSYM-DB/5_2/AAAACCA/
MCSYM-DB/5_2/AAAACCA/5_2-AAAACCA.mcs
MCSYM-DB/5_2/AAAACCA/ds-5_2-AAAACCA_x.pdb.gz
MCSYM-DB/5_2/AAACUAU/
MCSYM-DB/5_2/AAACUAU/5_2-AAACUAU.mcs
MCSYM-DB/5_2/AAACUAU/ds-5_2-AAACUAU_x.pdb.gz
MCSYM-DB/5_2/AAAUCGU/
MCSYM-DB/5_2/AAAUCGU/5_2-AAAUCGU.mcs
MCSYM-DB/5_2/AAAUCGU/ds-5_2-AAAUCGU_x.pdb.gz
MCSYM-DB/5_2/AAAUGUU/
MCSYM-DB/5_2/AAAUGUU/5_2-AAAUGUU.mcs
MCSYM-DB/5_2/AAAUGUU/ds-5_2-AAAUGUU_x.pdb.gz
MCSYM-DB/5_2/AACCUAU/
MCSYM-DB/5_2/AACCUAU/5_2-AACCUAU.mcs
MCSYM-DB/5_2/AACCUAU/ds-5_2-AACCUAU_x.pdb.gz
MCSYM-DB/5_2/AACCUGU/
MCSYM-DB/5_2/AACCUGU/5_2-AACCUGU.mcs
MCSYM-DB/5_2/AACCUGU/ds-5_2-AACCUGU_x.pdb.gz
MCSYM-DB/5_2/AACUUAU/
MCSYM-DB/5_2/AACUUAU/5_2-AACUUAU.mcs
MCSYM-DB/5_2/AACUUAU/ds-5_2-AACUUAU_x.pdb.gz
MCSYM-DB/5_2/AAGUUAA/
MCSYM-DB/5_2/AAGUUAA/5_2-AAGUUAA.mcs
MCSYM-DB/5_2/AAGUUAA/ds-5_2-AAGUUAA_x.pdb.gz
MCSYM-DB/5_2/AAUCGCA/
MCSYM-DB/5_2/AAUCGCA/5_2-AAUCGCA.mcs
MCSYM-DB/5_2/AAUCGCA/ds-5_2-AAUCGCA_x.pdb.gz
MCSYM-DB/5_2/AAUUUAU/
MCSYM-DB/5_2/AAUUUAU/5_2-AAUUUAU.mcs
MCSYM-DB/5_2/AAUUUAU/ds-5_2-AAUUUAU_x.pdb.gz
MCSYM-DB/5_2/ACACAUU/
MCSYM-DB/5_2/ACACAUU/5_2-ACACAUU.mcs
MCSYM-DB/5_2/ACACAUU/ds-5_2-ACACAUU_x.pdb.gz
MCSYM-DB/5_2/ACACUAU/
MCSYM-DB/5_2/ACACUAU/5_2-ACACUAU.mcs
MCSYM-DB/5_2/ACACUAU/ds-5_2-ACACUAU_x.pdb.gz
MCSYM-DB/5_2/ACAGGAU/
MCSYM-DB/5_2/ACAGGAU/5_2-ACAGGAU.mcs
MCSYM-DB/5_2/ACAGGAU/ds-5_2-ACAGGAU_x.pdb.gz
MCSYM-DB/5_2/ACAUCGU/
MCSYM-DB/5_2/ACAUCGU/5_2-ACAUCGU.mcs
MCSYM-DB/5_2/ACAUCGU/ds-5_2-ACAUCGU_x.pdb.gz
MCSYM-DB/5_2/ACCCUAU/
MCSYM-DB/5_2/ACCCUAU/5_2-ACCCUAU.mcs
MCSYM-DB/5_2/ACCCUAU/ds-5_2-ACCCUAU_x.pdb.gz
MCSYM-DB/5_2/ACCUUAU/
MCSYM-DB/5_2/ACCUUAU/5_2-ACCUUAU.mcs
MCSYM-DB/5_2/ACCUUAU/ds-5_2-ACCUUAU_x.pdb.gz
MCSYM-DB/5_2/ACUUUUU/
MCSYM-DB/5_2/ACUUUUU/5_2-ACUUUUU.mcs
MCSYM-DB/5_2/ACUUUUU/ds-5_2-ACUUUUU_x.pdb.gz
MCSYM-DB/5_2/AGAAAUA/
MCSYM-DB/5_2/AGAAAUA/5_2-AGAAAUA.mcs
MCSYM-DB/5_2/AGAAAUA/ds-5_2-AGAAAUA_x.pdb.gz
MCSYM-DB/5_2/AGACUAU/
MCSYM-DB/5_2/AGACUAU/5_2-AGACUAU.mcs
MCSYM-DB/5_2/AGACUAU/ds-5_2-AGACUAU_x.pdb.gz
MCSYM-DB/5_2/AGAUUAU/
MCSYM-DB/5_2/AGAUUAU/5_2-AGAUUAU.mcs
MCSYM-DB/5_2/AGAUUAU/ds-5_2-AGAUUAU_x.pdb.gz
MCSYM-DB/5_2/AGCAAUU/
MCSYM-DB/5_2/AGCAAUU/5_2-AGCAAUU.mcs
MCSYM-DB/5_2/AGCAAUU/ds-5_2-AGCAAUU_x.pdb.gz
MCSYM-DB/5_2/AGGCUAU/
MCSYM-DB/5_2/AGGCUAU/5_2-AGGCUAU.mcs
MCSYM-DB/5_2/AGGCUAU/ds-5_2-AGGCUAU_x.pdb.gz
MCSYM-DB/5_2/AGUUCGU/
MCSYM-DB/5_2/AGUUCGU/5_2-AGUUCGU.mcs
MCSYM-DB/5_2/AGUUCGU/ds-5_2-AGUUCGU_x.pdb.gz
MCSYM-DB/5_2/AUAUGUU/
MCSYM-DB/5_2/AUAUGUU/5_2-AUAUGUU.mcs
MCSYM-DB/5_2/AUAUGUU/ds-5_2-AUAUGUU_x.pdb.gz
MCSYM-DB/5_2/AUCUGCU/
MCSYM-DB/5_2/AUCUGCU/1LVJ_model_1.pdb.gz
MCSYM-DB/5_2/AUCUGCU/1UUD_model_1.pdb.gz
MCSYM-DB/5_2/AUCUGCU/397D_model_1.pdb.gz
MCSYM-DB/5_2/AUCUGCU/5_2-AUCUGCU.mcs
MCSYM-DB/5_2/AUCUGCU/ds-5_2-AUCUGCU.pdb.gz
MCSYM-DB/5_2/AUCUGCU/ds-5_2-AUCUGCU_x.pdb.gz
MCSYM-DB/5_2/AUGUGCU/
MCSYM-DB/5_2/AUGUGCU/5_2-AUGUGCU.mcs
MCSYM-DB/5_2/AUGUGCU/ds-5_2-AUGUGCU_x.pdb.gz
MCSYM-DB/5_2/AUUUAUU/
MCSYM-DB/5_2/AUUUAUU/5_2-AUUUAUU.mcs
MCSYM-DB/5_2/AUUUAUU/ds-5_2-AUUUAUU_x.pdb.gz
MCSYM-DB/5_2/AUUUCCG/
MCSYM-DB/5_2/AUUUCCG/5_2-AUUUCCG.mcs
MCSYM-DB/5_2/AUUUCCG/ds-5_2-AUUUCCG_x.pdb.gz
MCSYM-DB/5_2/AUUUCGU/
MCSYM-DB/5_2/AUUUCGU/5_2-AUUUCGU.mcs
MCSYM-DB/5_2/AUUUCGU/ds-5_2-AUUUCGU_x.pdb.gz
MCSYM-DB/5_2/CAAAGAA/
MCSYM-DB/5_2/CAAAGAA/5_2-CAAAGAA.mcs
MCSYM-DB/5_2/CAAAGAA/ds-5_2-CAAAGAA_x.pdb.gz
MCSYM-DB/5_2/CAGAGCG/
MCSYM-DB/5_2/CAGAGCG/1U3K_model_1.pdb.gz
MCSYM-DB/5_2/CAGAGCG/5_2-CAGAGCG.mcs
MCSYM-DB/5_2/CAGAGUA/
MCSYM-DB/5_2/CAGAGUA/5_2-CAGAGUA.mcs
MCSYM-DB/5_2/CAGAGUA/ds-5_2-CAGAGUA_x.pdb.gz
MCSYM-DB/5_2/CAUUAGG/
MCSYM-DB/5_2/CAUUAGG/5_2-CAUUAGG.mcs
MCSYM-DB/5_2/CAUUAGG/ds-5_2-CAUUAGG_x.pdb.gz
MCSYM-DB/5_2/CCAAGCG/
MCSYM-DB/5_2/CCAAGCG/5_2-CCAAGCG.mcs
MCSYM-DB/5_2/CCAAGCG/ds-5_2-CCAAGCG_x.pdb.gz
MCSYM-DB/5_2/CCAUAUG/
MCSYM-DB/5_2/CCAUAUG/5_2-CCAUAUG.mcs
MCSYM-DB/5_2/CCAUAUG/ds-5_2-CCAUAUG_x.pdb.gz
MCSYM-DB/5_2/CCCAGCG/
MCSYM-DB/5_2/CCCAGCG/5_2-CCCAGCG.mcs
MCSYM-DB/5_2/CCCAGCG/ds-5_2-CCCAGCG_x.pdb.gz
MCSYM-DB/5_2/CCUCUAG/
MCSYM-DB/5_2/CCUCUAG/5_2-CCUCUAG.mcs
MCSYM-DB/5_2/CCUCUAG/ds-5_2-CCUCUAG_x.pdb.gz
MCSYM-DB/5_2/CCUCUUG/
MCSYM-DB/5_2/CCUCUUG/5_2-CCUCUUG.mcs
MCSYM-DB/5_2/CCUCUUG/ds-5_2-CCUCUUG_x.pdb.gz
MCSYM-DB/5_2/CGCACGG/
MCSYM-DB/5_2/CGCACGG/5_2-CGCACGG.mcs
MCSYM-DB/5_2/CGCACGG/ds-5_2-CGCACGG_x.pdb.gz
MCSYM-DB/5_2/CGCGGCG/
MCSYM-DB/5_2/CGCGGCG/5_2-CGCGGCG.mcs
MCSYM-DB/5_2/CGCGGCG/ds-5_2-CGCGGCG_x.pdb.gz
MCSYM-DB/5_2/CGGUCGG/
MCSYM-DB/5_2/CGGUCGG/5_2-CGGUCGG.mcs
MCSYM-DB/5_2/CGGUCGG/ds-5_2-CGGUCGG_x.pdb.gz
MCSYM-DB/5_2/CGUAAUG/
MCSYM-DB/5_2/CGUAAUG/5_2-CGUAAUG.mcs
MCSYM-DB/5_2/CGUAAUG/ds-5_2-CGUAAUG_x.pdb.gz
MCSYM-DB/5_2/CUACCGG/
MCSYM-DB/5_2/CUACCGG/5_2-CUACCGG.mcs
MCSYM-DB/5_2/CUACCGG/ds-5_2-CUACCGG_x.pdb.gz
MCSYM-DB/5_2/CUACGUG/
MCSYM-DB/5_2/CUACGUG/5_2-CUACGUG.mcs
MCSYM-DB/5_2/CUACGUG/ds-5_2-CUACGUG_x.pdb.gz
MCSYM-DB/5_2/CUAUCGG/
MCSYM-DB/5_2/CUAUCGG/5_2-CUAUCGG.mcs
MCSYM-DB/5_2/CUAUCGG/ds-5_2-CUAUCGG_x.pdb.gz
MCSYM-DB/5_2/CUCAAUG/
MCSYM-DB/5_2/CUCAAUG/5_2-CUCAAUG.mcs
MCSYM-DB/5_2/CUCAAUG/ds-5_2-CUCAAUG_x.pdb.gz
MCSYM-DB/5_2/CUCACGG/
MCSYM-DB/5_2/CUCACGG/5_2-CUCACGG.mcs
MCSYM-DB/5_2/CUCACGG/ds-5_2-CUCACGG_x.pdb.gz
MCSYM-DB/5_2/CUUAAUG/
MCSYM-DB/5_2/CUUAAUG/5_2-CUUAAUG.mcs
MCSYM-DB/5_2/CUUAAUG/ds-5_2-CUUAAUG_x.pdb.gz
MCSYM-DB/5_2/CUUCCGG/
MCSYM-DB/5_2/CUUCCGG/5_2-CUUCCGG.mcs
MCSYM-DB/5_2/CUUCCGG/ds-5_2-CUUCCGG_x.pdb.gz
MCSYM-DB/5_2/CUUGAUG/
MCSYM-DB/5_2/CUUGAUG/5_2-CUUGAUG.mcs
MCSYM-DB/5_2/CUUGAUG/ds-5_2-CUUGAUG_x.pdb.gz
MCSYM-DB/5_2/CUUGGCG/
MCSYM-DB/5_2/CUUGGCG/5_2-CUUGGCG.mcs
MCSYM-DB/5_2/CUUGGCG/ds-5_2-CUUGGCG_x.pdb.gz
MCSYM-DB/5_2/CUUGGUG/
MCSYM-DB/5_2/CUUGGUG/5_2-CUUGGUG.mcs
MCSYM-DB/5_2/CUUGGUG/ds-5_2-CUUGGUG_x.pdb.gz
MCSYM-DB/5_2/GAACCGC/
MCSYM-DB/5_2/GAACCGC/5_2-GAACCGC.mcs
MCSYM-DB/5_2/GAACCGC/ds-5_2-GAACCGC_x.pdb.gz
MCSYM-DB/5_2/GAAGUAC/
MCSYM-DB/5_2/GAAGUAC/ds-5_2-GAAGUAC_x.pdb.gz
MCSYM-DB/5_2/GAAUUAC/
MCSYM-DB/5_2/GAAUUAC/5_2-GAAUUAC.mcs
MCSYM-DB/5_2/GAAUUAC/ds-5_2-GAAUUAC_x.pdb.gz
MCSYM-DB/5_2/GACGGCA/
MCSYM-DB/5_2/GACGGCA/5_2-GACGGCA.mcs
MCSYM-DB/5_2/GACGGCA/ds-5_2-GACGGCA_x.pdb.gz
MCSYM-DB/5_2/GAUACGC/
MCSYM-DB/5_2/GAUACGC/5_2-GAUACGC.mcs
MCSYM-DB/5_2/GAUACGC/ds-5_2-GAUACGC_x.pdb.gz
MCSYM-DB/5_2/GAUAGCC/
MCSYM-DB/5_2/GAUAGCC/5_2-GAUAGCC.mcs
MCSYM-DB/5_2/GAUAGCC/ds-5_2-GAUAGCC_x.pdb.gz
MCSYM-DB/5_2/GAUAUAU/
MCSYM-DB/5_2/GAUAUAU/5_2-GAUAUAU.mcs
MCSYM-DB/5_2/GAUAUAU/ds-5_2-GAUAUAU_x.pdb.gz
MCSYM-DB/5_2/GAUUUAU/
MCSYM-DB/5_2/GAUUUAU/5_2-GAUUUAU.mcs
MCSYM-DB/5_2/GAUUUAU/ds-5_2-GAUUUAU_x.pdb.gz
MCSYM-DB/5_2/GCAUCGC/
MCSYM-DB/5_2/GCAUCGC/5_2-GCAUCGC.mcs
MCSYM-DB/5_2/GCAUCGC/ds-5_2-GCAUCGC_x.pdb.gz
MCSYM-DB/5_2/GCCAGUC/
MCSYM-DB/5_2/GCCAGUC/5_2-GCCAGUC.mcs
MCSYM-DB/5_2/GCCAGUC/ds-5_2-GCCAGUC_x.pdb.gz
MCSYM-DB/5_2/GCCCAAC/
MCSYM-DB/5_2/GCCCAAC/5_2-GCCCAAC.mcs
MCSYM-DB/5_2/GCCCAAC/ds-5_2-GCCCAAC_x.pdb.gz
MCSYM-DB/5_2/GCCUGCC/
MCSYM-DB/5_2/GCCUGCC/5_2-GCCUGCC.mcs
MCSYM-DB/5_2/GCCUGCC/ds-5_2-GCCUGCC_x.pdb.gz
MCSYM-DB/5_2/GGAACGA/
MCSYM-DB/5_2/GGAACGA/5_2-GGAACGA.mcs
MCSYM-DB/5_2/GGCAUAC/
MCSYM-DB/5_2/GGCAUAC/5_2-GGCAUAC.mcs
MCSYM-DB/5_2/GGCAUAC/ds-5_2-GGCAUAC_x.pdb.gz
MCSYM-DB/5_2/GGCUCGU/
MCSYM-DB/5_2/GGCUCGU/5_2-GGCUCGU.mcs
MCSYM-DB/5_2/GGCUCGU/ds-5_2-GGCUCGU_x.pdb.gz
MCSYM-DB/5_2/GGGCUAC/
MCSYM-DB/5_2/GGGCUAC/5_2-GGGCUAC.mcs
MCSYM-DB/5_2/GGGCUAC/ds-5_2-GGGCUAC_x.pdb.gz
MCSYM-DB/5_2/GUAAGCC/
MCSYM-DB/5_2/GUAAGCC/5_2-GUAAGCC.mcs
MCSYM-DB/5_2/GUAAGCC/ds-5_2-GUAAGCC_x.pdb.gz
MCSYM-DB/5_2/GUAGUUA/
MCSYM-DB/5_2/GUAGUUA/5_2-GUAGUUA.mcs
MCSYM-DB/5_2/GUAGUUA/ds-5_2-GUAGUUA_x.pdb.gz
MCSYM-DB/5_2/GUCUAUC/
MCSYM-DB/5_2/GUCUAUC/5_2-GUCUAUC.mcs
MCSYM-DB/5_2/GUCUAUC/ds-5_2-GUCUAUC_x.pdb.gz
MCSYM-DB/5_2/GUCUGCC/
MCSYM-DB/5_2/GUCUGCC/5_2-GUCUGCC.mcs
MCSYM-DB/5_2/GUCUGCC/ds-5_2-GUCUGCC_x.pdb.gz
MCSYM-DB/5_2/GUGAGCA/
MCSYM-DB/5_2/GUGAGCA/5_2-GUGAGCA.mcs
MCSYM-DB/5_2/GUGAGCA/ds-5_2-GUGAGCA_x.pdb.gz
MCSYM-DB/5_2/GUUCAUC/
MCSYM-DB/5_2/GUUCAUC/5_2-GUUCAUC.mcs
MCSYM-DB/5_2/GUUCAUC/ds-5_2-GUUCAUC_x.pdb.gz
MCSYM-DB/5_2/GUUUGCC/
MCSYM-DB/5_2/GUUUGCC/5_2-GUUUGCC.mcs
MCSYM-DB/5_2/GUUUGCC/ds-5_2-GUUUGCC_x.pdb.gz
MCSYM-DB/5_2/GUUUUAU/
MCSYM-DB/5_2/GUUUUAU/5_2-GUUUUAU.mcs
MCSYM-DB/5_2/GUUUUAU/ds-5_2-GUUUUAU_x.pdb.gz
MCSYM-DB/5_2/UAACUGA/
MCSYM-DB/5_2/UAACUGA/5_2-UAACUGA.mcs
MCSYM-DB/5_2/UAACUGA/ds-5_2-UAACUGA_x.pdb.gz
MCSYM-DB/5_2/UACACGA/
MCSYM-DB/5_2/UACACGA/5_2-UACACGA.mcs
MCSYM-DB/5_2/UACACGA/ds-5_2-UACACGA_x.pdb.gz
MCSYM-DB/5_2/UACCCGA/
MCSYM-DB/5_2/UACCCGA/5_2-UACCCGA.mcs
MCSYM-DB/5_2/UACCCGA/ds-5_2-UACCCGA_x.pdb.gz
MCSYM-DB/5_2/UACUAUG/
MCSYM-DB/5_2/UACUAUG/5_2-UACUAUG.mcs
MCSYM-DB/5_2/UACUAUG/ds-5_2-UACUAUG_x.pdb.gz
MCSYM-DB/5_2/UACUUAG/
MCSYM-DB/5_2/UACUUAG/5_2-UACUUAG.mcs
MCSYM-DB/5_2/UACUUAG/ds-5_2-UACUUAG_x.pdb.gz
MCSYM-DB/5_2/UAGACGG/
MCSYM-DB/5_2/UAGACGG/5_2-UAGACGG.mcs
MCSYM-DB/5_2/UAGACGG/ds-5_2-UAGACGG_x.pdb.gz
MCSYM-DB/5_2/UAGGCGA/
MCSYM-DB/5_2/UAGGCGA/5_2-UAGGCGA.mcs
MCSYM-DB/5_2/UAGGCGA/ds-5_2-UAGGCGA_x.pdb.gz
MCSYM-DB/5_2/UAGUGGG/
MCSYM-DB/5_2/UAGUGGG/5_2-UAGUGGG.mcs
MCSYM-DB/5_2/UAGUGGG/ds-5_2-UAGUGGG_x.pdb.gz
MCSYM-DB/5_2/UAUAAAA/
MCSYM-DB/5_2/UAUAAAA/5_2-UAUAAAA.mcs
MCSYM-DB/5_2/UAUAAAA/ds-5_2-UAUAAAA_x.pdb.gz
MCSYM-DB/5_2/UAUGUAG/
MCSYM-DB/5_2/UAUGUAG/5_2-UAUGUAG.mcs
MCSYM-DB/5_2/UAUGUAG/ds-5_2-UAUGUAG_x.pdb.gz
MCSYM-DB/5_2/UAUUUAA/
MCSYM-DB/5_2/UAUUUAA/5_2-UAUUUAA.mcs
MCSYM-DB/5_2/UAUUUAA/ds-5_2-UAUUUAA_x.pdb.gz
MCSYM-DB/5_2/UAUUUAU/
MCSYM-DB/5_2/UAUUUAU/5_2-UAUUUAU.mcs
MCSYM-DB/5_2/UAUUUAU/ds-5_2-UAUUUAU_x.pdb.gz
MCSYM-DB/5_2/UCCUGCU/
MCSYM-DB/5_2/UCCUGCU/5_2-UCCUGCU.mcs
MCSYM-DB/5_2/UCCUGCU/ds-5_2-UCCUGCU_x.pdb.gz
MCSYM-DB/5_2/UCGAGCA/
MCSYM-DB/5_2/UCGAGCA/5_2-UCGAGCA.mcs
MCSYM-DB/5_2/UCGAGCA/ds-5_2-UCGAGCA_x.pdb.gz
MCSYM-DB/5_2/UCGGGCA/
MCSYM-DB/5_2/UCGGGCA/5_2-UCGGGCA.mcs
MCSYM-DB/5_2/UCGGGCA/ds-5_2-UCGGGCA_x.pdb.gz
MCSYM-DB/5_2/UCUAUAG/
MCSYM-DB/5_2/UCUAUAG/5_2-UCUAUAG.mcs
MCSYM-DB/5_2/UCUAUAG/ds-5_2-UCUAUAG_x.pdb.gz
MCSYM-DB/5_2/UGAAUGA/
MCSYM-DB/5_2/UGAAUGA/5_2-UGAAUGA.mcs
MCSYM-DB/5_2/UGAAUGA/ds-5_2-UGAAUGA_x.pdb.gz
MCSYM-DB/5_2/UGAGAUG/
MCSYM-DB/5_2/UGAGAUG/5_2-UGAGAUG.mcs
MCSYM-DB/5_2/UGAGAUG/ds-5_2-UGAGAUG_x.pdb.gz
MCSYM-DB/5_2/UGGAUGA/
MCSYM-DB/5_2/UGGAUGA/5_2-UGGAUGA.mcs
MCSYM-DB/5_2/UGGAUGA/ds-5_2-UGGAUGA_x.pdb.gz
MCSYM-DB/5_2/UGGCCGA/
MCSYM-DB/5_2/UGGCCGA/5_2-UGGCCGA.mcs
MCSYM-DB/5_2/UGGCCGA/ds-5_2-UGGCCGA_x.pdb.gz
MCSYM-DB/5_2/UGGUUAG/
MCSYM-DB/5_2/UGGUUAG/5_2-UGGUUAG.mcs
MCSYM-DB/5_2/UGGUUAG/ds-5_2-UGGUUAG_x.pdb.gz
MCSYM-DB/5_2/UGUUGAA/
MCSYM-DB/5_2/UGUUGAA/5_2-UGUUGAA.mcs
MCSYM-DB/5_2/UGUUGAA/ds-5_2-UGUUGAA_x.pdb.gz
MCSYM-DB/5_2/UGUUUAG/
MCSYM-DB/5_2/UGUUUAG/5_2-UGUUUAG.mcs
MCSYM-DB/5_2/UGUUUAG/ds-5_2-UGUUUAG_x.pdb.gz
MCSYM-DB/5_2/UUAAGCA/
MCSYM-DB/5_2/UUAAGCA/5_2-UUAAGCA.mcs
MCSYM-DB/5_2/UUAAGCA/ds-5_2-UUAAGCA_x.pdb.gz
MCSYM-DB/5_2/UUGGCGA/
MCSYM-DB/5_2/UUGGCGA/5_2-UUGGCGA.mcs
MCSYM-DB/5_2/UUGGCGA/ds-5_2-UUGGCGA_x.pdb.gz
MCSYM-DB/5_2/UUGUGCU/
MCSYM-DB/5_2/UUGUGCU/5_2-UUGUGCU.mcs
MCSYM-DB/5_2/UUGUGCU/ds-5_2-UUGUGCU_x.pdb.gz
MCSYM-DB/5_2/UUUUGCU/
MCSYM-DB/5_2/UUUUGCU/5_2-UUUUGCU.mcs
MCSYM-DB/5_2/UUUUGCU/ds-5_2-UUUUGCU_x.pdb.gz
MCSYM-DB/6/
MCSYM-DB/6/A----U/
MCSYM-DB/6/A----U/1G1X_model_1.pdb.gz
MCSYM-DB/6/A----U/124D_model_1.pdb.gz
MCSYM-DB/6/A----U/1GKW_model_1.pdb.gz
MCSYM-DB/6/A----U/157D_model_1.pdb.gz
MCSYM-DB/6/A----U/1G2E_model_1.pdb.gz
MCSYM-DB/6/A----U/17RA_model_1.pdb.gz
MCSYM-DB/6/A----U/1H0Q_model_1.pdb.gz
MCSYM-DB/6/A----U/1A51_model_1.pdb.gz
MCSYM-DB/6/A----U/1H38_model_1.pdb.gz
MCSYM-DB/6/A----U/1A60_model_1.pdb.gz
MCSYM-DB/6/A----U/1H3E_model_1.pdb.gz
MCSYM-DB/6/A----U/1A9N_model_1.pdb.gz
MCSYM-DB/6/A----U/1HS8_model_1.pdb.gz
MCSYM-DB/6/A----U/1AJT_model_1.pdb.gz
MCSYM-DB/6/A----U/1I6U_model_1.pdb.gz
MCSYM-DB/6/A----U/1AL5_model_1.pdb.gz
MCSYM-DB/6/A----U/1I9V_model_1.pdb.gz
MCSYM-DB/6/A----U/1ATW_model_1.pdb.gz
MCSYM-DB/6/A----U/1IE1_model_1.pdb.gz
MCSYM-DB/6/A----U/1AUD_model_1.pdb.gz
MCSYM-DB/6/A----U/1IK1_model_1.pdb.gz
MCSYM-DB/6/A----U/1B23_model_1.pdb.gz
MCSYM-DB/6/A----U/1IK5_model_1.pdb.gz
MCSYM-DB/6/A----U/1B36_model_1.pdb.gz
MCSYM-DB/6/A----U/1IL2_model_1.pdb.gz
MCSYM-DB/6/A----U/1BAU_model_1.pdb.gz
MCSYM-DB/6/A----U/1J1U_model_1.pdb.gz
MCSYM-DB/6/A----U/1BGZ_model_1.pdb.gz
MCSYM-DB/6/A----U/1J4Y_model_1.pdb.gz
MCSYM-DB/6/A----U/1BJ2_model_1.pdb.gz
MCSYM-DB/6/A----U/1JOX_model_1.pdb.gz
MCSYM-DB/6/A----U/1BMV_model_1.pdb.gz
MCSYM-DB/6/A----U/1JZC_model_1.pdb.gz
MCSYM-DB/6/A----U/1BR3_model_1.pdb.gz
MCSYM-DB/6/A----U/1K1G_model_1.pdb.gz
MCSYM-DB/6/A----U/1BVJ_model_1.pdb.gz
MCSYM-DB/6/A----U/1K2G_model_1.pdb.gz
MCSYM-DB/6/A----U/1BZ2_model_1.pdb.gz
MCSYM-DB/6/A----U/1K6G_model_1.pdb.gz
MCSYM-DB/6/A----U/1C0A_model_1.pdb.gz
MCSYM-DB/6/A----U/1KFO_model_1.pdb.gz
MCSYM-DB/6/A----U/1C2Q_model_1.pdb.gz
MCSYM-DB/6/A----U/1KOS_model_1.pdb.gz
MCSYM-DB/6/A----U/1C9S_model_1.pdb.gz
MCSYM-DB/6/A----U/1KP7_model_1.pdb.gz
MCSYM-DB/6/A----U/1CK5_model_1.pdb.gz
MCSYM-DB/6/A----U/1KUO_model_1.pdb.gz
MCSYM-DB/6/A----U/1CX0_model_1.pdb.gz
MCSYM-DB/6/A----U/1KXK_model_1.pdb.gz
MCSYM-DB/6/A----U/1D0U_model_1.pdb.gz
MCSYM-DB/6/A----U/1L1C_model_1.pdb.gz
MCSYM-DB/6/A----U/1D6K_model_1.pdb.gz
MCSYM-DB/6/A----U/1L3Z_model_1.pdb.gz
MCSYM-DB/6/A----U/1DDY_model_1.pdb.gz
MCSYM-DB/6/A----U/1L8V_model_1.pdb.gz
MCSYM-DB/6/A----U/1DFU_model_1.pdb.gz
MCSYM-DB/6/A----U/1L9A_model_1.pdb.gz
MCSYM-DB/6/A----U/1DZ5_model_1.pdb.gz
MCSYM-DB/6/A----U/1LUU_model_1.pdb.gz
MCSYM-DB/6/A----U/1E7K_model_1.pdb.gz
MCSYM-DB/6/A----U/1LUX_model_1.pdb.gz
MCSYM-DB/6/A----U/1E95_model_1.pdb.gz
MCSYM-DB/6/A----U/1LVJ_model_1.pdb.gz
MCSYM-DB/6/A----U/1EC6_model_1.pdb.gz
MCSYM-DB/6/A----U/1M5K_model_1.pdb.gz
MCSYM-DB/6/A----U/1EFW_model_1.pdb.gz
MCSYM-DB/6/A----U/1M8W_model_1.pdb.gz
MCSYM-DB/6/A----U/1EHZ_model_1.pdb.gz
MCSYM-DB/6/A----U/1M8X_model_1.pdb.gz
MCSYM-DB/6/A----U/1ELH_model_1.pdb.gz
MCSYM-DB/6/A----U/1M8Y_model_1.pdb.gz
MCSYM-DB/6/A----U/1ESH_model_1.pdb.gz
MCSYM-DB/6/A----U/1MHK_model_1.pdb.gz
MCSYM-DB/6/A----U/1ET4_model_1.pdb.gz
MCSYM-DB/6/A----U/1MJI_model_1.pdb.gz
MCSYM-DB/6/A----U/1EUY_model_1.pdb.gz
MCSYM-DB/6/A----U/1MMS_model_1.pdb.gz
MCSYM-DB/6/A----U/1EXD_model_1.pdb.gz
MCSYM-DB/6/A----U/1MNX_model_1.pdb.gz
MCSYM-DB/6/A----U/1F85_model_1.pdb.gz
MCSYM-DB/6/A----U/1MZP_model_1.pdb.gz
MCSYM-DB/6/A----U/1F8V_model_1.pdb.gz
MCSYM-DB/6/A----U/1N77_model_1.pdb.gz
MCSYM-DB/6/A----U/1F9L_model_1.pdb.gz
MCSYM-DB/6/A----U/1NAO_model_1.pdb.gz
MCSYM-DB/6/A----U/1FEQ_model_1.pdb.gz
MCSYM-DB/6/A----U/1NBK_model_1.pdb.gz
MCSYM-DB/6/A----U/1FEU_model_1.pdb.gz
MCSYM-DB/6/A----U/1NC0_model_1.pdb.gz
MCSYM-DB/6/A----U/1FG0_model_1.pdb.gz
MCSYM-DB/6/A----U/1NTA_model_1.pdb.gz
MCSYM-DB/6/A----U/1FHK_model_1.pdb.gz
MCSYM-DB/6/A----U/1NZ1_model_1.pdb.gz
MCSYM-DB/6/A----U/1FMN_model_1.pdb.gz
MCSYM-DB/6/A----U/1O15_model_1.pdb.gz
MCSYM-DB/6/A----U/1FNX_model_1.pdb.gz
MCSYM-DB/6/A----U/1OKF_model_1.pdb.gz
MCSYM-DB/6/A----U/1FUF_model_1.pdb.gz
MCSYM-DB/6/A----U/1H4S_model_1.pdb.gz
MCSYM-DB/6/A----U/1OLN_model_1.pdb.gz
MCSYM-DB/6/A----U/1HC8_model_1.pdb.gz
MCSYM-DB/6/A----U/1OOA_model_1.pdb.gz
MCSYM-DB/6/A----U/1HLX_model_1.pdb.gz
MCSYM-DB/6/A----U/1P5N_model_1.pdb.gz
MCSYM-DB/6/A----U/1HMH_model_1.pdb.gz
MCSYM-DB/6/A----U/1P5O_model_1.pdb.gz
MCSYM-DB/6/A----U/1HS3_model_1.pdb.gz
MCSYM-DB/6/A----U/1Q29_model_1.pdb.gz
MCSYM-DB/6/A----U/1HS4_model_1.pdb.gz
MCSYM-DB/6/A----U/1Q8N_model_1.pdb.gz
MCSYM-DB/6/A----U/1Q96_model_1.pdb.gz
MCSYM-DB/6/A----U/1QD3_model_1.pdb.gz
MCSYM-DB/6/A----U/1QET_model_1.pdb.gz
MCSYM-DB/6/A----U/1QF6_model_1.pdb.gz
MCSYM-DB/6/A----U/1QU2_model_1.pdb.gz
MCSYM-DB/6/A----U/1QWB_model_1.pdb.gz
MCSYM-DB/6/A----U/1R2P_model_1.pdb.gz
MCSYM-DB/6/A----U/1R3E_model_1.pdb.gz
MCSYM-DB/6/A----U/1R7W_model_1.pdb.gz
MCSYM-DB/6/A----U/1R7Z_model_1.pdb.gz
MCSYM-DB/6/A----U/1RFR_model_1.pdb.gz
MCSYM-DB/6/A----U/1RGO_model_1.pdb.gz
MCSYM-DB/6/A----U/1RKJ_model_1.pdb.gz
MCSYM-DB/6/A----U/1RNA_model_1.pdb.gz
MCSYM-DB/6/A----U/1RNK_model_1.pdb.gz
MCSYM-DB/6/A----U/1ROQ_model_1.pdb.gz
MCSYM-DB/6/A----U/1S03_model_1.pdb.gz
MCSYM-DB/6/A----U/1S2F_model_1.pdb.gz
MCSYM-DB/6/A----U/1SDR_model_1.pdb.gz
MCSYM-DB/6/A----U/1SDS_model_1.pdb.gz
MCSYM-DB/6/A----U/1SER_model_1.pdb.gz
MCSYM-DB/6/A----U/1SJ3_model_1.pdb.gz
MCSYM-DB/6/A----U/1SYZ_model_1.pdb.gz
MCSYM-DB/6/A----U/1SZY_model_1.pdb.gz
MCSYM-DB/6/A----U/1T28_model_1.pdb.gz
MCSYM-DB/6/A----U/1T4L_model_1.pdb.gz
MCSYM-DB/6/A----U/1TFW_model_1.pdb.gz
MCSYM-DB/6/A----U/1TLR_model_1.pdb.gz
MCSYM-DB/6/A----U/1TTT_model_1.pdb.gz
MCSYM-DB/6/A----U/1TUT_model_1.pdb.gz
MCSYM-DB/6/A----U/1TXS_model_1.pdb.gz
MCSYM-DB/6/A----U/1U0B_model_1.pdb.gz
MCSYM-DB/6/A----U/1U3K_model_1.pdb.gz
MCSYM-DB/6/A----U/1U6P_model_1.pdb.gz
MCSYM-DB/6/A----U/1U8D_model_1.pdb.gz
MCSYM-DB/6/A----U/1UUD_model_1.pdb.gz
MCSYM-DB/6/A----U/1VFG_model_1.pdb.gz
MCSYM-DB/6/A----U/1VQ7_model_1.pdb.gz
MCSYM-DB/6/A----U/1WKS_model_1.pdb.gz
MCSYM-DB/6/A----U/1WNE_model_1.pdb.gz
MCSYM-DB/6/A----U/1WWG_model_1.pdb.gz
MCSYM-DB/6/A----U/1XHP_model_1.pdb.gz
MCSYM-DB/6/A----U/1XJR_model_1.pdb.gz
MCSYM-DB/6/A----U/1XMQ_model_1.pdb.gz
MCSYM-DB/6/A----U/1XOK_model_1.pdb.gz
MCSYM-DB/6/A----U/1XWP_model_1.pdb.gz
MCSYM-DB/6/A----U/1XWU_model_1.pdb.gz
MCSYM-DB/6/A----U/1Y26_model_1.pdb.gz
MCSYM-DB/6/A----U/1Y27_model_1.pdb.gz
MCSYM-DB/6/A----U/1Y39_model_1.pdb.gz
MCSYM-DB/6/A----U/1YFG_model_1.pdb.gz
MCSYM-DB/6/A----U/1YNC_model_1.pdb.gz
MCSYM-DB/6/A----U/1YNE_model_1.pdb.gz
MCSYM-DB/6/A----U/1YSV_model_1.pdb.gz
MCSYM-DB/6/A----U/1YYK_model_1.pdb.gz
MCSYM-DB/6/A----U/1YYW_model_1.pdb.gz
MCSYM-DB/6/A----U/1Z2J_model_1.pdb.gz
MCSYM-DB/6/A----U/1Z43_model_1.pdb.gz
MCSYM-DB/6/A----U/1Z7F_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZBI_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZC5_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZDJ_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZDK_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZE2_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZFV_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZJW_model_1.pdb.gz
MCSYM-DB/6/A----U/1ZL3_model_1.pdb.gz
MCSYM-DB/6/A----U/219D_model_1.pdb.gz
MCSYM-DB/6/A----U/246D_model_1.pdb.gz
MCSYM-DB/6/A----U/2A9X_model_1.pdb.gz
MCSYM-DB/6/A----U/2AB4_model_1.pdb.gz
MCSYM-DB/6/A----U/2ADT_model_1.pdb.gz
MCSYM-DB/6/A----U/2ASB_model_1.pdb.gz
MCSYM-DB/6/A----U/2ATW_model_1.pdb.gz
MCSYM-DB/6/A----U/2AWQ_model_1.pdb.gz
MCSYM-DB/6/A----U/2B3J_model_1.pdb.gz
MCSYM-DB/6/A----U/2BBV_model_1.pdb.gz
MCSYM-DB/6/A----U/2BGG_model_1.pdb.gz
MCSYM-DB/6/A----U/2BJ6_model_1.pdb.gz
MCSYM-DB/6/A----U/2BNY_model_1.pdb.gz
MCSYM-DB/6/A----U/2BTE_model_1.pdb.gz
MCSYM-DB/6/A----U/2BX2_model_1.pdb.gz
MCSYM-DB/6/A----U/2C4Y_model_1.pdb.gz
MCSYM-DB/6/A----U/2C4Z_model_1.pdb.gz
MCSYM-DB/6/A----U/2C50_model_1.pdb.gz
MCSYM-DB/6/A----U/2C51_model_1.pdb.gz
MCSYM-DB/6/A----U/2CSX_model_1.pdb.gz
MCSYM-DB/6/A----U/2ERR_model_1.pdb.gz
MCSYM-DB/6/A----U/2EZ6_model_1.pdb.gz
MCSYM-DB/6/A----U/2F88_model_1.pdb.gz
MCSYM-DB/6/A----U/2F8K_model_1.pdb.gz
MCSYM-DB/6/A----U/2FK6_model_1.pdb.gz
MCSYM-DB/6/A----U/2FMT_model_1.pdb.gz
MCSYM-DB/6/A----U/2FRL_model_1.pdb.gz
MCSYM-DB/6/A----U/2G92_model_1.pdb.gz
MCSYM-DB/6/A----U/2GBH_model_1.pdb.gz
MCSYM-DB/6/A----U/2TOB_model_1.pdb.gz
MCSYM-DB/6/A----U/2TPK_model_1.pdb.gz
MCSYM-DB/6/A----U/2TRA_model_1.pdb.gz
MCSYM-DB/6/A----U/315D_model_1.pdb.gz
MCSYM-DB/6/A----U/353D_model_1.pdb.gz
MCSYM-DB/6/A----U/354D_model_1.pdb.gz
MCSYM-DB/6/A----U/364D_model_1.pdb.gz
MCSYM-DB/6/A----U/397D_model_1.pdb.gz
MCSYM-DB/6/A----U/3PHP_model_1.pdb.gz
MCSYM-DB/6/A----U/405D_model_1.pdb.gz
MCSYM-DB/6/A----U/419D_model_1.pdb.gz
MCSYM-DB/6/A----U/420D_model_1.pdb.gz
MCSYM-DB/6/A----U/422D_model_1.pdb.gz
MCSYM-DB/6/A----U/433D_model_1.pdb.gz
MCSYM-DB/6/A----U/484D_model_1.pdb.gz
MCSYM-DB/6/A----U/485D_model_1.pdb.gz
MCSYM-DB/6/A----U/5MSF_model_1.pdb.gz
MCSYM-DB/6/A----U/6-A----U.mcs
MCSYM-DB/6/AAAAAA/
MCSYM-DB/6/AAAAAA/6-AAAAAA.mcs
MCSYM-DB/6/AAAAAA/ss-6-AAAAAA_x.pdb.gz
MCSYM-DB/6/AAAAAC/
MCSYM-DB/6/AAAAAC/6-AAAAAC.mcs
MCSYM-DB/6/AAAAAC/6-AAAAAC.pdb.gz
MCSYM-DB/6/AAAAAC/ss-6-AAAAAC_x.pdb.gz
MCSYM-DB/6/AAAAAG/
MCSYM-DB/6/AAAAAG/6-AAAAAG.mcs
MCSYM-DB/6/AAAAAG/ss-6-AAAAAG_x.pdb.gz
MCSYM-DB/6/AAAAAU/
MCSYM-DB/6/AAAAAU/6-AAAAAU.mcs
MCSYM-DB/6/AAAAAU/ss-6-AAAAAU_x.pdb.gz
MCSYM-DB/6/AAAACC/
MCSYM-DB/6/AAAACC/6-AAAACC.mcs
MCSYM-DB/6/AAAACC/ss-6-AAAACC_x.pdb.gz
MCSYM-DB/6/AAAACG/
MCSYM-DB/6/AAAACG/6-AAAACG.mcs
MCSYM-DB/6/AAAACG/ss-6-AAAACG_x.pdb.gz
MCSYM-DB/6/AAAACU/
MCSYM-DB/6/AAAACU/6-AAAACU.mcs
MCSYM-DB/6/AAAACU/ss-6-AAAACU_x.pdb.gz
MCSYM-DB/6/AAAAGA/
MCSYM-DB/6/AAAAGA/6-AAAAGA.mcs
MCSYM-DB/6/AAAAGA/ss-6-AAAAGA_x.pdb.gz
MCSYM-DB/6/AAAAGC/
MCSYM-DB/6/AAAAGC/6-AAAAGC.mcs
MCSYM-DB/6/AAAAGC/ss-6-AAAAGC_x.pdb.gz
MCSYM-DB/6/AAAAGG/
MCSYM-DB/6/AAAAGG/6-AAAAGG.mcs
MCSYM-DB/6/AAAAGG/ss-6-AAAAGG_x.pdb.gz
MCSYM-DB/6/AAAAGU/
MCSYM-DB/6/AAAAGU/6-AAAAGU.mcs
MCSYM-DB/6/AAAAGU/ss-6-AAAAGU_x.pdb.gz
MCSYM-DB/6/AAAAUA/
MCSYM-DB/6/AAAAUA/6-AAAAUA.mcs
MCSYM-DB/6/AAAAUC/
MCSYM-DB/6/AAAAUC/6-AAAAUC.mcs
MCSYM-DB/6/AAAAUC/ss-6-AAAAUC_x.pdb.gz
MCSYM-DB/6/AAAAUG/
MCSYM-DB/6/AAAAUG/6-AAAAUG.mcs
MCSYM-DB/6/AAAAUG/ss-6-AAAAUG_x.pdb.gz
MCSYM-DB/6/AAAAUU/
MCSYM-DB/6/AAAAUU/6-AAAAUU.mcs
MCSYM-DB/6/AAACAA/
MCSYM-DB/6/AAACAA/6-AAACAA.mcs
MCSYM-DB/6/AAACAA/ss-6-AAACAA_x.pdb.gz
MCSYM-DB/6/AAACAC/
MCSYM-DB/6/AAACAC/6-AAACAC.mcs
MCSYM-DB/6/AAACAC/ss-6-AAACAC_x.pdb.gz
MCSYM-DB/6/AAACAG/
MCSYM-DB/6/AAACAG/6-AAACAG.mcs
MCSYM-DB/6/AAACAG/ss-6-AAACAG_x.pdb.gz
MCSYM-DB/6/AAACAU/
MCSYM-DB/6/AAACAU/6-AAACAU.mcs
MCSYM-DB/6/AAACAU/ss-6-AAACAU_x.pdb.gz
MCSYM-DB/6/AAACCC/
MCSYM-DB/6/AAACCC/6-AAACCC.mcs
MCSYM-DB/6/AAACCC/ss-6-AAACCC_x.pdb.gz
MCSYM-DB/6/AAACCG/
MCSYM-DB/6/AAACCG/6-AAACCG.mcs
MCSYM-DB/6/AAACCG/ss-6-AAACCG_x.pdb.gz
MCSYM-DB/6/AAACCU/
MCSYM-DB/6/AAACCU/6-AAACCU.mcs
MCSYM-DB/6/AAACCU/ss-6-AAACCU_x.pdb.gz
MCSYM-DB/6/AAACGA/
MCSYM-DB/6/AAACGA/6-AAACGA.mcs
MCSYM-DB/6/AAACGA/ss-6-AAACGA_x.pdb.gz
MCSYM-DB/6/AAACGG/
MCSYM-DB/6/AAACGG/6-AAACGG.mcs
MCSYM-DB/6/AAACGG/ss-6-AAACGG_x.pdb.gz
MCSYM-DB/6/AAACGU/
MCSYM-DB/6/AAACGU/6-AAACGU.mcs
MCSYM-DB/6/AAACGU/ss-6-AAACGU_x.pdb.gz
MCSYM-DB/6/AAACUA/
MCSYM-DB/6/AAACUA/6-AAACUA.mcs
MCSYM-DB/6/AAACUA/ss-6-AAACUA_x.pdb.gz
MCSYM-DB/6/AAACUC/
MCSYM-DB/6/AAACUC/6-AAACUC.mcs
MCSYM-DB/6/AAACUC/ss-6-AAACUC_x.pdb.gz
MCSYM-DB/6/AAACUU/
MCSYM-DB/6/AAACUU/6-AAACUU.mcs
MCSYM-DB/6/AAAGAA/
MCSYM-DB/6/AAAGAA/6-AAAGAA.mcs
MCSYM-DB/6/AAAGAA/ss-6-AAAGAA_x.pdb.gz
MCSYM-DB/6/AAAGAC/
MCSYM-DB/6/AAAGAC/6-AAAGAC.mcs
MCSYM-DB/6/AAAGAC/ss-6-AAAGAC_x.pdb.gz
MCSYM-DB/6/AAAGAG/
MCSYM-DB/6/AAAGAG/6-AAAGAG.mcs
MCSYM-DB/6/AAAGAG/ss-6-AAAGAG_x.pdb.gz
MCSYM-DB/6/AAAGAU/
MCSYM-DB/6/AAAGAU/6-AAAGAU.mcs
MCSYM-DB/6/AAAGAU/ss-6-AAAGAU_x.pdb.gz
MCSYM-DB/6/AAAGCC/
MCSYM-DB/6/AAAGCC/6-AAAGCC.mcs
MCSYM-DB/6/AAAGCC/ss-6-AAAGCC_x.pdb.gz
MCSYM-DB/6/AAAGCG/
MCSYM-DB/6/AAAGCG/6-AAAGCG.mcs
MCSYM-DB/6/AAAGCG/ss-6-AAAGCG_x.pdb.gz
MCSYM-DB/6/AAAGCU/
MCSYM-DB/6/AAAGCU/6-AAAGCU.mcs
MCSYM-DB/6/AAAGCU/ss-6-AAAGCU_x.pdb.gz
MCSYM-DB/6/AAAGGA/
MCSYM-DB/6/AAAGGA/6-AAAGGA.mcs
MCSYM-DB/6/AAAGGC/
MCSYM-DB/6/AAAGGC/6-AAAGGC.mcs
MCSYM-DB/6/AAAGGC/ss-6-AAAGGC_x.pdb.gz
MCSYM-DB/6/AAAGGG/
MCSYM-DB/6/AAAGGG/6-AAAGGG.mcs
MCSYM-DB/6/AAAGGG/ss-6-AAAGGG_x.pdb.gz
MCSYM-DB/6/AAAGGU/
MCSYM-DB/6/AAAGGU/6-AAAGGU.mcs
MCSYM-DB/6/AAAGGU/ss-6-AAAGGU_x.pdb.gz
MCSYM-DB/6/AAAGUU/
MCSYM-DB/6/AAAGUU/6-AAAGUU.mcs
MCSYM-DB/6/AAAGUU/ss-6-AAAGUU_x.pdb.gz
MCSYM-DB/6/AAAUAA/
MCSYM-DB/6/AAAUAA/6-AAAUAA.mcs
MCSYM-DB/6/AAAUAA/ss-6-AAAUAA_x.pdb.gz
MCSYM-DB/6/AAAUAC/
MCSYM-DB/6/AAAUAC/6-AAAUAC.mcs
MCSYM-DB/6/AAAUAC/ss-6-AAAUAC_x.pdb.gz
MCSYM-DB/6/AAAUAG/
MCSYM-DB/6/AAAUAG/6-AAAUAG.mcs
MCSYM-DB/6/AAAUAG/ss-6-AAAUAG_x.pdb.gz
MCSYM-DB/6/AAAUAU/
MCSYM-DB/6/AAAUAU/6-AAAUAU.mcs
MCSYM-DB/6/AAAUAU/ss-6-AAAUAU_x.pdb.gz
MCSYM-DB/6/AAAUCC/
MCSYM-DB/6/AAAUCC/6-AAAUCC.mcs
MCSYM-DB/6/AAAUCC/ss-6-AAAUCC_x.pdb.gz
MCSYM-DB/6/AAAUCG/
MCSYM-DB/6/AAAUCG/6-AAAUCG.mcs
MCSYM-DB/6/AAAUCG/ss-6-AAAUCG_x.pdb.gz
MCSYM-DB/6/AAAUCU/
MCSYM-DB/6/AAAUCU/6-AAAUCU.mcs
MCSYM-DB/6/AAAUCU/ss-6-AAAUCU_x.pdb.gz
MCSYM-DB/6/AAAUGA/
MCSYM-DB/6/AAAUGA/6-AAAUGA.mcs
MCSYM-DB/6/AAAUGA/ss-6-AAAUGA_x.pdb.gz
MCSYM-DB/6/AAAUGC/
MCSYM-DB/6/AAAUGC/6-AAAUGC.mcs
MCSYM-DB/6/AAAUGC/ss-6-AAAUGC_x.pdb.gz
MCSYM-DB/6/AAAUGG/
MCSYM-DB/6/AAAUGG/6-AAAUGG.mcs
MCSYM-DB/6/AAAUGG/ss-6-AAAUGG_x.pdb.gz
MCSYM-DB/6/AAAUGU/
MCSYM-DB/6/AAAUGU/6-AAAUGU.mcs
MCSYM-DB/6/AAAUGU/ss-6-AAAUGU_x.pdb.gz
MCSYM-DB/6/AAAUUC/
MCSYM-DB/6/AAAUUC/6-AAAUUC.mcs
MCSYM-DB/6/AAAUUU/
MCSYM-DB/6/AAAUUU/6-AAAUUU.mcs
MCSYM-DB/6/AAAUUU/ss-6-AAAUUU_x.pdb.gz
MCSYM-DB/6/AACAAA/
MCSYM-DB/6/AACAAA/6-AACAAA.mcs
MCSYM-DB/6/AACAAA/ss-6-AACAAA_x.pdb.gz
MCSYM-DB/6/AACAAG/
MCSYM-DB/6/AACAAG/6-AACAAG.mcs
MCSYM-DB/6/AACAAG/ss-6-AACAAG_x.pdb.gz
MCSYM-DB/6/AACAAU/
MCSYM-DB/6/AACAAU/6-AACAAU.mcs
MCSYM-DB/6/AACAAU/ss-6-AACAAU_x.pdb.gz
MCSYM-DB/6/AACACC/
MCSYM-DB/6/AACACC/6-AACACC.mcs
MCSYM-DB/6/AACACC/ss-6-AACACC_x.pdb.gz
MCSYM-DB/6/AACACG/
MCSYM-DB/6/AACACG/6-AACACG.mcs
MCSYM-DB/6/AACACG/ss-6-AACACG_x.pdb.gz
MCSYM-DB/6/AACACU/
MCSYM-DB/6/AACACU/6-AACACU.mcs
MCSYM-DB/6/AACACU/ss-6-AACACU_x.pdb.gz
MCSYM-DB/6/AACAGC/
MCSYM-DB/6/AACAGC/6-AACAGC.mcs
MCSYM-DB/6/AACAGC/ss-6-AACAGC_x.pdb.gz
MCSYM-DB/6/AACAGG/
MCSYM-DB/6/AACAGG/6-AACAGG.mcs
MCSYM-DB/6/AACAGG/ss-6-AACAGG_x.pdb.gz
MCSYM-DB/6/AACAGU/
MCSYM-DB/6/AACAGU/6-AACAGU.mcs
MCSYM-DB/6/AACAGU/ss-6-AACAGU_x.pdb.gz
MCSYM-DB/6/AACAUG/
MCSYM-DB/6/AACAUG/6-AACAUG.mcs
MCSYM-DB/6/AACAUU/
MCSYM-DB/6/AACAUU/6-AACAUU.mcs
MCSYM-DB/6/AACCAC/
MCSYM-DB/6/AACCAC/6-AACCAC.mcs
MCSYM-DB/6/AACCAC/ss-6-AACCAC_x.pdb.gz
MCSYM-DB/6/AACCAG/
MCSYM-DB/6/AACCAG/6-AACCAG.mcs
MCSYM-DB/6/AACCAG/ss-6-AACCAG_x.pdb.gz
MCSYM-DB/6/AACCAU/
MCSYM-DB/6/AACCAU/6-AACCAU.mcs
MCSYM-DB/6/AACCAU/ss-6-AACCAU_x.pdb.gz
MCSYM-DB/6/AACCCC/
MCSYM-DB/6/AACCCC/6-AACCCC.mcs
MCSYM-DB/6/AACCCC/ss-6-AACCCC_x.pdb.gz
MCSYM-DB/6/AACCCG/
MCSYM-DB/6/AACCCG/6-AACCCG.mcs
MCSYM-DB/6/AACCCG/ss-6-AACCCG_x.pdb.gz
MCSYM-DB/6/AACCCU/
MCSYM-DB/6/AACCCU/6-AACCCU.mcs
MCSYM-DB/6/AACCCU/ss-6-AACCCU_x.pdb.gz
MCSYM-DB/6/AACCGG/
MCSYM-DB/6/AACCGG/6-AACCGG.mcs
MCSYM-DB/6/AACCGG/ss-6-AACCGG_x.pdb.gz
MCSYM-DB/6/AACCGU/
MCSYM-DB/6/AACCGU/6-AACCGU.mcs
MCSYM-DB/6/AACCGU/ss-6-AACCGU_x.pdb.gz
MCSYM-DB/6/AACCUG/
MCSYM-DB/6/AACCUG/6-AACCUG.mcs
MCSYM-DB/6/AACCUG/ss-6-AACCUG_x.pdb.gz
MCSYM-DB/6/AACCUU/
MCSYM-DB/6/AACCUU/6-AACCUU.mcs
MCSYM-DB/6/AACCUU/ss-6-AACCUU_x.pdb.gz
MCSYM-DB/6/AACGAC/
MCSYM-DB/6/AACGAC/6-AACGAC.mcs
MCSYM-DB/6/AACGAC/ss-6-AACGAC_x.pdb.gz
MCSYM-DB/6/AACGAU/
MCSYM-DB/6/AACGAU/6-AACGAU.mcs
MCSYM-DB/6/AACGAU/ss-6-AACGAU_x.pdb.gz
MCSYM-DB/6/AACGCC/
MCSYM-DB/6/AACGCC/6-AACGCC.mcs
MCSYM-DB/6/AACGCG/
MCSYM-DB/6/AACGCG/6-AACGCG.mcs
MCSYM-DB/6/AACGCG/ss-6-AACGCG_x.pdb.gz
MCSYM-DB/6/AACGCU/
MCSYM-DB/6/AACGCU/6-AACGCU.mcs
MCSYM-DB/6/AACGCU/ss-6-AACGCU_x.pdb.gz
MCSYM-DB/6/AACGGG/
MCSYM-DB/6/AACGGG/6-AACGGG.mcs
MCSYM-DB/6/AACGGG/ss-6-AACGGG_x.pdb.gz
MCSYM-DB/6/AACGGU/
MCSYM-DB/6/AACGGU/6-AACGGU.mcs
MCSYM-DB/6/AACGGU/ss-6-AACGGU_x.pdb.gz
MCSYM-DB/6/AACUAA/
MCSYM-DB/6/AACUAA/6-AACUAA.mcs
MCSYM-DB/6/AACUAC/
MCSYM-DB/6/AACUAC/6-AACUAC.mcs
MCSYM-DB/6/AACUAC/ss-6-AACUAC_x.pdb.gz
MCSYM-DB/6/AACUAU/
MCSYM-DB/6/AACUAU/6-AACUAU.mcs
MCSYM-DB/6/AACUAU/ss-6-AACUAU_x.pdb.gz
MCSYM-DB/6/AACUCG/
MCSYM-DB/6/AACUCG/6-AACUCG.mcs
MCSYM-DB/6/AACUCG/ss-6-AACUCG_x.pdb.gz
MCSYM-DB/6/AACUCU/
MCSYM-DB/6/AACUCU/6-AACUCU.mcs
MCSYM-DB/6/AACUCU/ss-6-AACUCU_x.pdb.gz
MCSYM-DB/6/AACUGC/
MCSYM-DB/6/AACUGC/6-AACUGC.mcs
MCSYM-DB/6/AACUGC/ss-6-AACUGC_x.pdb.gz
MCSYM-DB/6/AACUGG/
MCSYM-DB/6/AACUGG/6-AACUGG.mcs
MCSYM-DB/6/AACUGG/ss-6-AACUGG_x.pdb.gz
MCSYM-DB/6/AACUGU/
MCSYM-DB/6/AACUGU/6-AACUGU.mcs
MCSYM-DB/6/AACUGU/ss-6-AACUGU_x.pdb.gz
MCSYM-DB/6/AACUUA/
MCSYM-DB/6/AACUUA/6-AACUUA.mcs
MCSYM-DB/6/AAGAAA/
MCSYM-DB/6/AAGAAA/6-AAGAAA.mcs
MCSYM-DB/6/AAGAAA/ss-6-AAGAAA_x.pdb.gz
MCSYM-DB/6/AAGAAC/
MCSYM-DB/6/AAGAAC/6-AAGAAC.mcs
MCSYM-DB/6/AAGAAG/
MCSYM-DB/6/AAGAAG/6-AAGAAG.mcs
MCSYM-DB/6/AAGAAG/ss-6-AAGAAG_x.pdb.gz
MCSYM-DB/6/AAGAAU/
MCSYM-DB/6/AAGAAU/6-AAGAAU.mcs
MCSYM-DB/6/AAGAAU/ss-6-AAGAAU_x.pdb.gz
MCSYM-DB/6/AAGACC/
MCSYM-DB/6/AAGACC/6-AAGACC.mcs
MCSYM-DB/6/AAGACG/
MCSYM-DB/6/AAGACG/6-AAGACG.mcs
MCSYM-DB/6/AAGACG/ss-6-AAGACG_x.pdb.gz
MCSYM-DB/6/AAGACU/
MCSYM-DB/6/AAGACU/6-AAGACU.mcs
MCSYM-DB/6/AAGACU/ss-6-AAGACU_x.pdb.gz
MCSYM-DB/6/AAGAGG/
MCSYM-DB/6/AAGAGG/6-AAGAGG.mcs
MCSYM-DB/6/AAGAGG/ss-6-AAGAGG_x.pdb.gz
MCSYM-DB/6/AAGAGU/
MCSYM-DB/6/AAGAGU/6-AAGAGU.mcs
MCSYM-DB/6/AAGAGU/ss-6-AAGAGU_x.pdb.gz
MCSYM-DB/6/AAGAUG/
MCSYM-DB/6/AAGAUG/6-AAGAUG.mcs
MCSYM-DB/6/AAGAUG/ss-6-AAGAUG_x.pdb.gz
MCSYM-DB/6/AAGAUU/
MCSYM-DB/6/AAGAUU/6-AAGAUU.mcs
MCSYM-DB/6/AAGCAA/
MCSYM-DB/6/AAGCAA/6-AAGCAA.mcs
MCSYM-DB/6/AAGCAA/ss-6-AAGCAA_x.pdb.gz
MCSYM-DB/6/AAGCAG/
MCSYM-DB/6/AAGCAG/6-AAGCAG.mcs
MCSYM-DB/6/AAGCAG/ss-6-AAGCAG_x.pdb.gz
MCSYM-DB/6/AAGCAU/
MCSYM-DB/6/AAGCAU/6-AAGCAU.mcs
MCSYM-DB/6/AAGCAU/ss-6-AAGCAU_x.pdb.gz
MCSYM-DB/6/AAGCCC/
MCSYM-DB/6/AAGCCC/6-AAGCCC.mcs
MCSYM-DB/6/AAGCCC/ss-6-AAGCCC_x.pdb.gz
MCSYM-DB/6/AAGCCG/
MCSYM-DB/6/AAGCCG/6-AAGCCG.mcs
MCSYM-DB/6/AAGCCU/
MCSYM-DB/6/AAGCCU/6-AAGCCU.mcs
MCSYM-DB/6/AAGCCU/ss-6-AAGCCU_x.pdb.gz
MCSYM-DB/6/AAGCGG/
MCSYM-DB/6/AAGCGG/6-AAGCGG.mcs
MCSYM-DB/6/AAGCGG/ss-6-AAGCGG_x.pdb.gz
MCSYM-DB/6/AAGCUA/
MCSYM-DB/6/AAGCUA/6-AAGCUA.mcs
MCSYM-DB/6/AAGCUU/
MCSYM-DB/6/AAGCUU/6-AAGCUU.mcs
MCSYM-DB/6/AAGCUU/ss-6-AAGCUU_x.pdb.gz
MCSYM-DB/6/AAGGAC/
MCSYM-DB/6/AAGGAC/6-AAGGAC.mcs
MCSYM-DB/6/AAGGAG/
MCSYM-DB/6/AAGGAG/6-AAGGAG.mcs
MCSYM-DB/6/AAGGAG/ss-6-AAGGAG_x.pdb.gz
MCSYM-DB/6/AAGGAU/
MCSYM-DB/6/AAGGAU/6-AAGGAU.mcs
MCSYM-DB/6/AAGGAU/ss-6-AAGGAU_x.pdb.gz
MCSYM-DB/6/AAGGCC/
MCSYM-DB/6/AAGGCC/6-AAGGCC.mcs
MCSYM-DB/6/AAGGCC/ss-6-AAGGCC_x.pdb.gz
MCSYM-DB/6/AAGGCG/
MCSYM-DB/6/AAGGCG/6-AAGGCG.mcs
MCSYM-DB/6/AAGGCG/ss-6-AAGGCG_x.pdb.gz
MCSYM-DB/6/AAGGCU/
MCSYM-DB/6/AAGGCU/6-AAGGCU.mcs
MCSYM-DB/6/AAGGCU/ss-6-AAGGCU_x.pdb.gz
MCSYM-DB/6/AAGGGA/
MCSYM-DB/6/AAGGGA/6-AAGGGA.mcs
MCSYM-DB/6/AAGGGC/
MCSYM-DB/6/AAGGGC/6-AAGGGC.mcs
MCSYM-DB/6/AAGGGC/ss-6-AAGGGC_x.pdb.gz
MCSYM-DB/6/AAGGGG/
MCSYM-DB/6/AAGGGG/6-AAGGGG.mcs
MCSYM-DB/6/AAGGGG/ss-6-AAGGGG_x.pdb.gz
MCSYM-DB/6/AAGGGU/
MCSYM-DB/6/AAGGGU/6-AAGGGU.mcs
MCSYM-DB/6/AAGGGU/ss-6-AAGGGU_x.pdb.gz
MCSYM-DB/6/AAGGUG/
MCSYM-DB/6/AAGGUG/6-AAGGUG.mcs
MCSYM-DB/6/AAGGUG/ss-6-AAGGUG_x.pdb.gz
MCSYM-DB/6/AAGGUU/
MCSYM-DB/6/AAGGUU/6-AAGGUU.mcs
MCSYM-DB/6/AAGUAC/
MCSYM-DB/6/AAGUAC/6-AAGUAC.mcs
MCSYM-DB/6/AAGUAC/ss-6-AAGUAC_x.pdb.gz
MCSYM-DB/6/AAGUAG/
MCSYM-DB/6/AAGUAG/6-AAGUAG.mcs
MCSYM-DB/6/AAGUAG/ss-6-AAGUAG_x.pdb.gz
MCSYM-DB/6/AAGUAU/
MCSYM-DB/6/AAGUAU/6-AAGUAU.mcs
MCSYM-DB/6/AAGUAU/ss-6-AAGUAU_x.pdb.gz
MCSYM-DB/6/AAGUCC/
MCSYM-DB/6/AAGUCC/6-AAGUCC.mcs
MCSYM-DB/6/AAGUCC/ss-6-AAGUCC_x.pdb.gz
MCSYM-DB/6/AAGUCG/
MCSYM-DB/6/AAGUCG/6-AAGUCG.mcs
MCSYM-DB/6/AAGUCG/ss-6-AAGUCG_x.pdb.gz
MCSYM-DB/6/AAGUCU/
MCSYM-DB/6/AAGUCU/6-AAGUCU.mcs
MCSYM-DB/6/AAGUCU/ss-6-AAGUCU_x.pdb.gz
MCSYM-DB/6/AAGUGG/
MCSYM-DB/6/AAGUGG/6-AAGUGG.mcs
MCSYM-DB/6/AAGUGG/ss-6-AAGUGG_x.pdb.gz
MCSYM-DB/6/AAGUGU/
MCSYM-DB/6/AAGUGU/6-AAGUGU.mcs
MCSYM-DB/6/AAGUGU/ss-6-AAGUGU_x.pdb.gz
MCSYM-DB/6/AAGUUG/
MCSYM-DB/6/AAGUUG/6-AAGUUG.mcs
MCSYM-DB/6/AAGUUU/
MCSYM-DB/6/AAGUUU/6-AAGUUU.mcs
MCSYM-DB/6/AAGUUU/ss-6-AAGUUU_x.pdb.gz
MCSYM-DB/6/AAUAAA/
MCSYM-DB/6/AAUAAA/6-AAUAAA.mcs
MCSYM-DB/6/AAUAAA/ss-6-AAUAAA_x.pdb.gz
MCSYM-DB/6/AAUAAG/
MCSYM-DB/6/AAUAAG/6-AAUAAG.mcs
MCSYM-DB/6/AAUAAG/ss-6-AAUAAG_x.pdb.gz
MCSYM-DB/6/AAUAAU/
MCSYM-DB/6/AAUAAU/6-AAUAAU.mcs
MCSYM-DB/6/AAUAAU/ss-6-AAUAAU_x.pdb.gz
MCSYM-DB/6/AAUACA/
MCSYM-DB/6/AAUACA/6-AAUACA.mcs
MCSYM-DB/6/AAUACC/
MCSYM-DB/6/AAUACC/6-AAUACC.mcs
MCSYM-DB/6/AAUACC/ss-6-AAUACC_x.pdb.gz
MCSYM-DB/6/AAUACG/
MCSYM-DB/6/AAUACG/6-AAUACG.mcs
MCSYM-DB/6/AAUACG/ss-6-AAUACG_x.pdb.gz
MCSYM-DB/6/AAUACU/
MCSYM-DB/6/AAUACU/6-AAUACU.mcs
MCSYM-DB/6/AAUACU/ss-6-AAUACU_x.pdb.gz
MCSYM-DB/6/AAUAGC/
MCSYM-DB/6/AAUAGC/6-AAUAGC.mcs
MCSYM-DB/6/AAUAGC/ss-6-AAUAGC_x.pdb.gz
MCSYM-DB/6/AAUAGG/
MCSYM-DB/6/AAUAGG/6-AAUAGG.mcs
MCSYM-DB/6/AAUAGU/
MCSYM-DB/6/AAUAGU/6-AAUAGU.mcs
MCSYM-DB/6/AAUAGU/ss-6-AAUAGU_x.pdb.gz
MCSYM-DB/6/AAUAUC/
MCSYM-DB/6/AAUAUC/6-AAUAUC.mcs
MCSYM-DB/6/AAUAUG/
MCSYM-DB/6/AAUAUG/6-AAUAUG.mcs
MCSYM-DB/6/AAUAUG/ss-6-AAUAUG_x.pdb.gz
MCSYM-DB/6/AAUAUU/
MCSYM-DB/6/AAUAUU/6-AAUAUU.mcs
MCSYM-DB/6/AAUCAA/
MCSYM-DB/6/AAUCAA/6-AAUCAA.mcs
MCSYM-DB/6/AAUCAA/ss-6-AAUCAA_x.pdb.gz
MCSYM-DB/6/AAUCAC/
MCSYM-DB/6/AAUCAC/6-AAUCAC.mcs
MCSYM-DB/6/AAUCAC/ss-6-AAUCAC_x.pdb.gz
MCSYM-DB/6/AAUCAG/
MCSYM-DB/6/AAUCAG/6-AAUCAG.mcs
MCSYM-DB/6/AAUCAG/ss-6-AAUCAG_x.pdb.gz
MCSYM-DB/6/AAUCAU/
MCSYM-DB/6/AAUCAU/6-AAUCAU.mcs
MCSYM-DB/6/AAUCAU/ss-6-AAUCAU_x.pdb.gz
MCSYM-DB/6/AAUCCA/
MCSYM-DB/6/AAUCCA/6-AAUCCA.mcs
MCSYM-DB/6/AAUCCA/ss-6-AAUCCA_x.pdb.gz
MCSYM-DB/6/AAUCCC/
MCSYM-DB/6/AAUCCC/6-AAUCCC.mcs
MCSYM-DB/6/AAUCCC/ss-6-AAUCCC_x.pdb.gz
MCSYM-DB/6/AAUCCG/
MCSYM-DB/6/AAUCCG/6-AAUCCG.mcs
MCSYM-DB/6/AAUCCG/ss-6-AAUCCG_x.pdb.gz
MCSYM-DB/6/AAUCCU/
MCSYM-DB/6/AAUCCU/6-AAUCCU.mcs
MCSYM-DB/6/AAUCCU/ss-6-AAUCCU_x.pdb.gz
MCSYM-DB/6/AAUCGU/
MCSYM-DB/6/AAUCGU/6-AAUCGU.mcs
MCSYM-DB/6/AAUCGU/ss-6-AAUCGU_x.pdb.gz
MCSYM-DB/6/AAUCUG/
MCSYM-DB/6/AAUCUG/6-AAUCUG.mcs
MCSYM-DB/6/AAUCUU/
MCSYM-DB/6/AAUCUU/6-AAUCUU.mcs
MCSYM-DB/6/AAUCUU/ss-6-AAUCUU_x.pdb.gz
MCSYM-DB/6/AAUGAA/
MCSYM-DB/6/AAUGAA/6-AAUGAA.mcs
MCSYM-DB/6/AAUGAA/ss-6-AAUGAA_x.pdb.gz
MCSYM-DB/6/AAUGAC/
MCSYM-DB/6/AAUGAC/6-AAUGAC.mcs
MCSYM-DB/6/AAUGAG/
MCSYM-DB/6/AAUGAG/6-AAUGAG.mcs
MCSYM-DB/6/AAUGAG/ss-6-AAUGAG_x.pdb.gz
MCSYM-DB/6/AAUGAU/
MCSYM-DB/6/AAUGAU/6-AAUGAU.mcs
MCSYM-DB/6/AAUGAU/ss-6-AAUGAU_x.pdb.gz
MCSYM-DB/6/AAUGCC/
MCSYM-DB/6/AAUGCC/6-AAUGCC.mcs
MCSYM-DB/6/AAUGCC/ss-6-AAUGCC_x.pdb.gz
MCSYM-DB/6/AAUGCG/
MCSYM-DB/6/AAUGCG/6-AAUGCG.mcs
MCSYM-DB/6/AAUGCU/
MCSYM-DB/6/AAUGCU/6-AAUGCU.mcs
MCSYM-DB/6/AAUGCU/ss-6-AAUGCU_x.pdb.gz
MCSYM-DB/6/AAUGGC/
MCSYM-DB/6/AAUGGC/6-AAUGGC.mcs
MCSYM-DB/6/AAUGGC/ss-6-AAUGGC_x.pdb.gz
MCSYM-DB/6/AAUGGU/
MCSYM-DB/6/AAUGGU/6-AAUGGU.mcs
MCSYM-DB/6/AAUGGU/ss-6-AAUGGU_x.pdb.gz
MCSYM-DB/6/AAUGUU/
MCSYM-DB/6/AAUGUU/6-AAUGUU.mcs
MCSYM-DB/6/AAUUAA/
MCSYM-DB/6/AAUUAA/6-AAUUAA.mcs
MCSYM-DB/6/AAUUAA/ss-6-AAUUAA_x.pdb.gz
MCSYM-DB/6/AAUUAC/
MCSYM-DB/6/AAUUAC/6-AAUUAC.mcs
MCSYM-DB/6/AAUUAC/ss-6-AAUUAC_x.pdb.gz
MCSYM-DB/6/AAUUAU/
MCSYM-DB/6/AAUUAU/6-AAUUAU.mcs
MCSYM-DB/6/AAUUAU/ss-6-AAUUAU_x.pdb.gz
MCSYM-DB/6/AAUUCA/
MCSYM-DB/6/AAUUCA/6-AAUUCA.mcs
MCSYM-DB/6/AAUUCU/
MCSYM-DB/6/AAUUCU/6-AAUUCU.mcs
MCSYM-DB/6/AAUUCU/ss-6-AAUUCU_x.pdb.gz
MCSYM-DB/6/AAUUGA/
MCSYM-DB/6/AAUUGA/6-AAUUGA.mcs
MCSYM-DB/6/AAUUGA/ss-6-AAUUGA_x.pdb.gz
MCSYM-DB/6/AAUUGC/
MCSYM-DB/6/AAUUGC/6-AAUUGC.mcs
MCSYM-DB/6/AAUUGC/ss-6-AAUUGC_x.pdb.gz
MCSYM-DB/6/AAUUGG/
MCSYM-DB/6/AAUUGG/6-AAUUGG.mcs
MCSYM-DB/6/AAUUGG/ss-6-AAUUGG_x.pdb.gz
MCSYM-DB/6/AAUUGU/
MCSYM-DB/6/AAUUGU/6-AAUUGU.mcs
MCSYM-DB/6/AAUUGU/ss-6-AAUUGU_x.pdb.gz
MCSYM-DB/6/AAUUUC/
MCSYM-DB/6/AAUUUC/6-AAUUUC.mcs
MCSYM-DB/6/AAUUUU/
MCSYM-DB/6/AAUUUU/6-AAUUUU.mcs
MCSYM-DB/6/AAUUUU/ss-6-AAUUUU_x.pdb.gz
MCSYM-DB/6/ACAAAC/
MCSYM-DB/6/ACAAAC/6-ACAAAC.mcs
MCSYM-DB/6/ACAAAC/ss-6-ACAAAC_x.pdb.gz
MCSYM-DB/6/ACAAAG/
MCSYM-DB/6/ACAAAG/6-ACAAAG.mcs
MCSYM-DB/6/ACAAAG/ss-6-ACAAAG_x.pdb.gz
MCSYM-DB/6/ACAAAU/
MCSYM-DB/6/ACAAAU/6-ACAAAU.mcs
MCSYM-DB/6/ACAAAU/ss-6-ACAAAU_x.pdb.gz
MCSYM-DB/6/ACAACU/
MCSYM-DB/6/ACAACU/6-ACAACU.mcs
MCSYM-DB/6/ACAACU/ss-6-ACAACU_x.pdb.gz
MCSYM-DB/6/ACAAGG/
MCSYM-DB/6/ACAAGG/6-ACAAGG.mcs
MCSYM-DB/6/ACAAUC/
MCSYM-DB/6/ACAAUC/6-ACAAUC.mcs
MCSYM-DB/6/ACAAUC/ss-6-ACAAUC_x.pdb.gz
MCSYM-DB/6/ACAAUG/
MCSYM-DB/6/ACAAUG/6-ACAAUG.mcs
MCSYM-DB/6/ACAAUG/ss-6-ACAAUG_x.pdb.gz
MCSYM-DB/6/ACAAUU/
MCSYM-DB/6/ACAAUU/6-ACAAUU.mcs
MCSYM-DB/6/ACACAA/
MCSYM-DB/6/ACACAA/6-ACACAA.mcs
MCSYM-DB/6/ACACAA/ss-6-ACACAA_x.pdb.gz
MCSYM-DB/6/ACACAC/
MCSYM-DB/6/ACACAC/6-ACACAC.mcs
MCSYM-DB/6/ACACAC/ss-6-ACACAC_x.pdb.gz
MCSYM-DB/6/ACACAG/
MCSYM-DB/6/ACACAG/6-ACACAG.mcs
MCSYM-DB/6/ACACAG/ss-6-ACACAG_x.pdb.gz
MCSYM-DB/6/ACACAU/
MCSYM-DB/6/ACACAU/6-ACACAU.mcs
MCSYM-DB/6/ACACAU/ss-6-ACACAU_x.pdb.gz
MCSYM-DB/6/ACACCU/
MCSYM-DB/6/ACACCU/6-ACACCU.mcs
MCSYM-DB/6/ACACCU/ss-6-ACACCU_x.pdb.gz
MCSYM-DB/6/ACACUG/
MCSYM-DB/6/ACACUG/6-ACACUG.mcs
MCSYM-DB/6/ACACUG/ss-6-ACACUG_x.pdb.gz
MCSYM-DB/6/ACACUU/
MCSYM-DB/6/ACACUU/6-ACACUU.mcs
MCSYM-DB/6/ACACUU/ss-6-ACACUU_x.pdb.gz
MCSYM-DB/6/ACAGAC/
MCSYM-DB/6/ACAGAC/6-ACAGAC.mcs
MCSYM-DB/6/ACAGAG/
MCSYM-DB/6/ACAGAG/6-ACAGAG.mcs
MCSYM-DB/6/ACAGAG/ss-6-ACAGAG_x.pdb.gz
MCSYM-DB/6/ACAGCU/
MCSYM-DB/6/ACAGCU/6-ACAGCU.mcs
MCSYM-DB/6/ACAGGU/
MCSYM-DB/6/ACAGGU/6-ACAGGU.mcs
MCSYM-DB/6/ACAGUA/
MCSYM-DB/6/ACAGUA/6-ACAGUA.mcs
MCSYM-DB/6/ACAGUA/ss-6-ACAGUA_x.pdb.gz
MCSYM-DB/6/ACAGUC/
MCSYM-DB/6/ACAGUC/6-ACAGUC.mcs
MCSYM-DB/6/ACAGUC/ss-6-ACAGUC_x.pdb.gz
MCSYM-DB/6/ACAUAC/
MCSYM-DB/6/ACAUAC/6-ACAUAC.mcs
MCSYM-DB/6/ACAUAU/
MCSYM-DB/6/ACAUAU/6-ACAUAU.mcs
MCSYM-DB/6/ACAUAU/ss-6-ACAUAU_x.pdb.gz
MCSYM-DB/6/ACAUCA/
MCSYM-DB/6/ACAUCA/6-ACAUCA.mcs
MCSYM-DB/6/ACAUCA/ss-6-ACAUCA_x.pdb.gz
MCSYM-DB/6/ACAUCU/
MCSYM-DB/6/ACAUCU/6-ACAUCU.mcs
MCSYM-DB/6/ACAUCU/ss-6-ACAUCU_x.pdb.gz
MCSYM-DB/6/ACAUGU/
MCSYM-DB/6/ACAUGU/6-ACAUGU.mcs
MCSYM-DB/6/ACAUGU/ss-6-ACAUGU_x.pdb.gz
MCSYM-DB/6/ACAUUU/
MCSYM-DB/6/ACAUUU/6-ACAUUU.mcs
MCSYM-DB/6/ACAUUU/ss-6-ACAUUU_x.pdb.gz
MCSYM-DB/6/ACCAAG/
MCSYM-DB/6/ACCAAG/6-ACCAAG.mcs
MCSYM-DB/6/ACCAAG/ss-6-ACCAAG_x.pdb.gz
MCSYM-DB/6/ACCAAU/
MCSYM-DB/6/ACCAAU/6-ACCAAU.mcs
MCSYM-DB/6/ACCAAU/ss-6-ACCAAU_x.pdb.gz
MCSYM-DB/6/ACCACA/
MCSYM-DB/6/ACCACA/6-ACCACA.mcs
MCSYM-DB/6/ACCACA/ss-6-ACCACA_x.pdb.gz
MCSYM-DB/6/ACCACC/
MCSYM-DB/6/ACCACC/6-ACCACC.mcs
MCSYM-DB/6/ACCACC/ss-6-ACCACC_x.pdb.gz
MCSYM-DB/6/ACCACG/
MCSYM-DB/6/ACCACG/6-ACCACG.mcs
MCSYM-DB/6/ACCACG/ss-6-ACCACG_x.pdb.gz
MCSYM-DB/6/ACCACU/
MCSYM-DB/6/ACCACU/6-ACCACU.mcs
MCSYM-DB/6/ACCACU/ss-6-ACCACU_x.pdb.gz
MCSYM-DB/6/ACCAUG/
MCSYM-DB/6/ACCAUG/6-ACCAUG.mcs
MCSYM-DB/6/ACCAUG/ss-6-ACCAUG_x.pdb.gz
MCSYM-DB/6/ACCAUU/
MCSYM-DB/6/ACCAUU/6-ACCAUU.mcs
MCSYM-DB/6/ACCAUU/ss-6-ACCAUU_x.pdb.gz
MCSYM-DB/6/ACCCAC/
MCSYM-DB/6/ACCCAC/6-ACCCAC.mcs
MCSYM-DB/6/ACCCAC/ss-6-ACCCAC_x.pdb.gz
MCSYM-DB/6/ACCCAG/
MCSYM-DB/6/ACCCAG/6-ACCCAG.mcs
MCSYM-DB/6/ACCCAG/ss-6-ACCCAG_x.pdb.gz
MCSYM-DB/6/ACCCAU/
MCSYM-DB/6/ACCCAU/6-ACCCAU.mcs
MCSYM-DB/6/ACCCAU/ss-6-ACCCAU_x.pdb.gz
MCSYM-DB/6/ACCCCA/
MCSYM-DB/6/ACCCCA/6-ACCCCA.mcs
MCSYM-DB/6/ACCCCA/ss-6-ACCCCA_x.pdb.gz
MCSYM-DB/6/ACCCCG/
MCSYM-DB/6/ACCCCG/6-ACCCCG.mcs
MCSYM-DB/6/ACCCCG/ss-6-ACCCCG_x.pdb.gz
MCSYM-DB/6/ACCCCU/
MCSYM-DB/6/ACCCCU/6-ACCCCU.mcs
MCSYM-DB/6/ACCCCU/ss-6-ACCCCU_x.pdb.gz
MCSYM-DB/6/ACCCGU/
MCSYM-DB/6/ACCCGU/6-ACCCGU.mcs
MCSYM-DB/6/ACCCGU/ss-6-ACCCGU_x.pdb.gz
MCSYM-DB/6/ACCCUG/
MCSYM-DB/6/ACCCUG/6-ACCCUG.mcs
MCSYM-DB/6/ACCCUG/ss-6-ACCCUG_x.pdb.gz
MCSYM-DB/6/ACCCUU/
MCSYM-DB/6/ACCCUU/6-ACCCUU.mcs
MCSYM-DB/6/ACCCUU/ss-6-ACCCUU_x.pdb.gz
MCSYM-DB/6/ACCGAC/
MCSYM-DB/6/ACCGAC/6-ACCGAC.mcs
MCSYM-DB/6/ACCGAC/ss-6-ACCGAC_x.pdb.gz
MCSYM-DB/6/ACCGAG/
MCSYM-DB/6/ACCGAG/6-ACCGAG.mcs
MCSYM-DB/6/ACCGAG/ss-6-ACCGAG_x.pdb.gz
MCSYM-DB/6/ACCGCA/
MCSYM-DB/6/ACCGCA/6-ACCGCA.mcs
MCSYM-DB/6/ACCGCA/ss-6-ACCGCA_x.pdb.gz
MCSYM-DB/6/ACCGCU/
MCSYM-DB/6/ACCGCU/6-ACCGCU.mcs
MCSYM-DB/6/ACCGCU/ss-6-ACCGCU_x.pdb.gz
MCSYM-DB/6/ACCGGC/
MCSYM-DB/6/ACCGGC/6-ACCGGC.mcs
MCSYM-DB/6/ACCGGC/ss-6-ACCGGC_x.pdb.gz
MCSYM-DB/6/ACCGUU/
MCSYM-DB/6/ACCGUU/6-ACCGUU.mcs
MCSYM-DB/6/ACCGUU/ss-6-ACCGUU_x.pdb.gz
MCSYM-DB/6/ACCUAC/
MCSYM-DB/6/ACCUAC/6-ACCUAC.mcs
MCSYM-DB/6/ACCUAC/ss-6-ACCUAC_x.pdb.gz
MCSYM-DB/6/ACCUAG/
MCSYM-DB/6/ACCUAG/6-ACCUAG.mcs
MCSYM-DB/6/ACCUAG/ss-6-ACCUAG_x.pdb.gz
MCSYM-DB/6/ACCUCC/
MCSYM-DB/6/ACCUCC/6-ACCUCC.mcs
MCSYM-DB/6/ACCUCC/ss-6-ACCUCC_x.pdb.gz
MCSYM-DB/6/ACCUCU/
MCSYM-DB/6/ACCUCU/6-ACCUCU.mcs
MCSYM-DB/6/ACCUCU/ss-6-ACCUCU_x.pdb.gz
MCSYM-DB/6/ACCUGC/
MCSYM-DB/6/ACCUGC/6-ACCUGC.mcs
MCSYM-DB/6/ACCUGC/ss-6-ACCUGC_x.pdb.gz
MCSYM-DB/6/ACCUGU/
MCSYM-DB/6/ACCUGU/6-ACCUGU.mcs
MCSYM-DB/6/ACCUUG/
MCSYM-DB/6/ACCUUG/6-ACCUUG.mcs
MCSYM-DB/6/ACCUUG/ss-6-ACCUUG_x.pdb.gz
MCSYM-DB/6/ACCUUU/
MCSYM-DB/6/ACCUUU/6-ACCUUU.mcs
MCSYM-DB/6/ACCUUU/ss-6-ACCUUU_x.pdb.gz
MCSYM-DB/6/ACGAAA/
MCSYM-DB/6/ACGAAA/6-ACGAAA.mcs
MCSYM-DB/6/ACGAAA/ss-6-ACGAAA_x.pdb.gz
MCSYM-DB/6/ACGAAG/
MCSYM-DB/6/ACGAAG/6-ACGAAG.mcs
MCSYM-DB/6/ACGAAG/ss-6-ACGAAG_x.pdb.gz
MCSYM-DB/6/ACGAAU/
MCSYM-DB/6/ACGAAU/6-ACGAAU.mcs
MCSYM-DB/6/ACGAAU/ss-6-ACGAAU_x.pdb.gz
MCSYM-DB/6/ACGAGU/
MCSYM-DB/6/ACGAGU/6-ACGAGU.mcs
MCSYM-DB/6/ACGCCG/
MCSYM-DB/6/ACGCCG/6-ACGCCG.mcs
MCSYM-DB/6/ACGCCG/ss-6-ACGCCG_x.pdb.gz
MCSYM-DB/6/ACGCCU/
MCSYM-DB/6/ACGCCU/6-ACGCCU.mcs
MCSYM-DB/6/ACGCCU/ss-6-ACGCCU_x.pdb.gz
MCSYM-DB/6/ACGCUG/
MCSYM-DB/6/ACGCUG/6-ACGCUG.mcs
MCSYM-DB/6/ACGCUG/ss-6-ACGCUG_x.pdb.gz
MCSYM-DB/6/ACGCUU/
MCSYM-DB/6/ACGCUU/6-ACGCUU.mcs
MCSYM-DB/6/ACGCUU/ss-6-ACGCUU_x.pdb.gz
MCSYM-DB/6/ACGGAG/
MCSYM-DB/6/ACGGAG/6-ACGGAG.mcs
MCSYM-DB/6/ACGGAG/ss-6-ACGGAG_x.pdb.gz
MCSYM-DB/6/ACGGAU/
MCSYM-DB/6/ACGGAU/6-ACGGAU.mcs
MCSYM-DB/6/ACGGAU/ss-6-ACGGAU_x.pdb.gz
MCSYM-DB/6/ACGGCC/
MCSYM-DB/6/ACGGCC/6-ACGGCC.mcs
MCSYM-DB/6/ACGGCC/ss-6-ACGGCC_x.pdb.gz
MCSYM-DB/6/ACGGCG/
MCSYM-DB/6/ACGGCG/6-ACGGCG.mcs
MCSYM-DB/6/ACGGCG/ss-6-ACGGCG_x.pdb.gz
MCSYM-DB/6/ACGGGC/
MCSYM-DB/6/ACGGGC/6-ACGGGC.mcs
MCSYM-DB/6/ACGGGG/
MCSYM-DB/6/ACGGGG/6-ACGGGG.mcs
MCSYM-DB/6/ACGGUC/
MCSYM-DB/6/ACGGUC/6-ACGGUC.mcs
MCSYM-DB/6/ACGGUC/ss-6-ACGGUC_x.pdb.gz
MCSYM-DB/6/ACGUAC/
MCSYM-DB/6/ACGUAC/6-ACGUAC.mcs
MCSYM-DB/6/ACGUAC/ss-6-ACGUAC_x.pdb.gz
MCSYM-DB/6/ACGUAU/
MCSYM-DB/6/ACGUAU/6-ACGUAU.mcs
MCSYM-DB/6/ACGUAU/ss-6-ACGUAU_x.pdb.gz
MCSYM-DB/6/ACGUGU/
MCSYM-DB/6/ACGUGU/6-ACGUGU.mcs
MCSYM-DB/6/ACGUGU/ss-6-ACGUGU_x.pdb.gz
MCSYM-DB/6/ACGUUC/
MCSYM-DB/6/ACGUUC/6-ACGUUC.mcs
MCSYM-DB/6/ACGUUU/
MCSYM-DB/6/ACGUUU/6-ACGUUU.mcs
MCSYM-DB/6/ACGUUU/ss-6-ACGUUU_x.pdb.gz
MCSYM-DB/6/ACUAAA/
MCSYM-DB/6/ACUAAA/6-ACUAAA.mcs
MCSYM-DB/6/ACUAAA/ss-6-ACUAAA_x.pdb.gz
MCSYM-DB/6/ACUAAC/
MCSYM-DB/6/ACUAAC/6-ACUAAC.mcs
MCSYM-DB/6/ACUAAC/ss-6-ACUAAC_x.pdb.gz
MCSYM-DB/6/ACUAAU/
MCSYM-DB/6/ACUAAU/6-ACUAAU.mcs
MCSYM-DB/6/ACUAAU/ss-6-ACUAAU_x.pdb.gz
MCSYM-DB/6/ACUACU/
MCSYM-DB/6/ACUACU/6-ACUACU.mcs
MCSYM-DB/6/ACUAUA/
MCSYM-DB/6/ACUAUA/6-ACUAUA.mcs
MCSYM-DB/6/ACUAUG/
MCSYM-DB/6/ACUAUG/6-ACUAUG.mcs
MCSYM-DB/6/ACUAUG/ss-6-ACUAUG_x.pdb.gz
MCSYM-DB/6/ACUAUU/
MCSYM-DB/6/ACUAUU/6-ACUAUU.mcs
MCSYM-DB/6/ACUAUU/ss-6-ACUAUU_x.pdb.gz
MCSYM-DB/6/ACUCAA/
MCSYM-DB/6/ACUCAA/6-ACUCAA.mcs
MCSYM-DB/6/ACUCAA/ss-6-ACUCAA_x.pdb.gz
MCSYM-DB/6/ACUCAC/
MCSYM-DB/6/ACUCAC/6-ACUCAC.mcs
MCSYM-DB/6/ACUCAC/ss-6-ACUCAC_x.pdb.gz
MCSYM-DB/6/ACUCAG/
MCSYM-DB/6/ACUCAG/6-ACUCAG.mcs
MCSYM-DB/6/ACUCAG/ss-6-ACUCAG_x.pdb.gz
MCSYM-DB/6/ACUCAU/
MCSYM-DB/6/ACUCAU/6-ACUCAU.mcs
MCSYM-DB/6/ACUCAU/ss-6-ACUCAU_x.pdb.gz
MCSYM-DB/6/ACUCCC/
MCSYM-DB/6/ACUCCC/6-ACUCCC.mcs
MCSYM-DB/6/ACUCCC/ss-6-ACUCCC_x.pdb.gz
MCSYM-DB/6/ACUCUC/
MCSYM-DB/6/ACUCUC/6-ACUCUC.mcs
MCSYM-DB/6/ACUCUC/ss-6-ACUCUC_x.pdb.gz
MCSYM-DB/6/ACUCUG/
MCSYM-DB/6/ACUCUG/6-ACUCUG.mcs
MCSYM-DB/6/ACUCUG/ss-6-ACUCUG_x.pdb.gz
MCSYM-DB/6/ACUCUU/
MCSYM-DB/6/ACUCUU/6-ACUCUU.mcs
MCSYM-DB/6/ACUCUU/ss-6-ACUCUU_x.pdb.gz
MCSYM-DB/6/ACUGCU/
MCSYM-DB/6/ACUGCU/6-ACUGCU.mcs
MCSYM-DB/6/ACUGCU/ss-6-ACUGCU_x.pdb.gz
MCSYM-DB/6/ACUGGA/
MCSYM-DB/6/ACUGGA/6-ACUGGA.mcs
MCSYM-DB/6/ACUGGA/ss-6-ACUGGA_x.pdb.gz
MCSYM-DB/6/ACUGGG/
MCSYM-DB/6/ACUGGG/6-ACUGGG.mcs
MCSYM-DB/6/ACUGGU/
MCSYM-DB/6/ACUGGU/6-ACUGGU.mcs
MCSYM-DB/6/ACUGGU/ss-6-ACUGGU_x.pdb.gz
MCSYM-DB/6/ACUGUG/
MCSYM-DB/6/ACUGUG/6-ACUGUG.mcs
MCSYM-DB/6/ACUGUG/ss-6-ACUGUG_x.pdb.gz
MCSYM-DB/6/ACUUAC/
MCSYM-DB/6/ACUUAC/6-ACUUAC.mcs
MCSYM-DB/6/ACUUAC/ss-6-ACUUAC_x.pdb.gz
MCSYM-DB/6/ACUUAG/
MCSYM-DB/6/ACUUAG/6-ACUUAG.mcs
MCSYM-DB/6/ACUUAG/ss-6-ACUUAG_x.pdb.gz
MCSYM-DB/6/ACUUAU/
MCSYM-DB/6/ACUUAU/6-ACUUAU.mcs
MCSYM-DB/6/ACUUAU/ss-6-ACUUAU_x.pdb.gz
MCSYM-DB/6/ACUUCC/
MCSYM-DB/6/ACUUCC/6-ACUUCC.mcs
MCSYM-DB/6/ACUUCC/ss-6-ACUUCC_x.pdb.gz
MCSYM-DB/6/ACUUCG/
MCSYM-DB/6/ACUUCG/6-ACUUCG.mcs
MCSYM-DB/6/ACUUCG/ss-6-ACUUCG_x.pdb.gz
MCSYM-DB/6/ACUUCU/
MCSYM-DB/6/ACUUCU/6-ACUUCU.mcs
MCSYM-DB/6/ACUUCU/ss-6-ACUUCU_x.pdb.gz
MCSYM-DB/6/ACUUGU/
MCSYM-DB/6/ACUUGU/6-ACUUGU.mcs
MCSYM-DB/6/ACUUUA/
MCSYM-DB/6/ACUUUA/6-ACUUUA.mcs
MCSYM-DB/6/ACUUUC/
MCSYM-DB/6/ACUUUC/6-ACUUUC.mcs
MCSYM-DB/6/ACUUUC/ss-6-ACUUUC_x.pdb.gz
MCSYM-DB/6/ACUUUG/
MCSYM-DB/6/ACUUUG/6-ACUUUG.mcs
MCSYM-DB/6/ACUUUG/ss-6-ACUUUG_x.pdb.gz
MCSYM-DB/6/ACUUUU/
MCSYM-DB/6/ACUUUU/6-ACUUUU.mcs
MCSYM-DB/6/ACUUUU/ss-6-ACUUUU_x.pdb.gz
MCSYM-DB/6/AGAAAA/
MCSYM-DB/6/AGAAAA/6-AGAAAA.mcs
MCSYM-DB/6/AGAAAA/ss-6-AGAAAA_x.pdb.gz
MCSYM-DB/6/AGAAAC/
MCSYM-DB/6/AGAAAC/6-AGAAAC.mcs
MCSYM-DB/6/AGAAAC/ss-6-AGAAAC_x.pdb.gz
MCSYM-DB/6/AGAAAG/
MCSYM-DB/6/AGAAAG/6-AGAAAG.mcs
MCSYM-DB/6/AGAAAG/ss-6-AGAAAG_x.pdb.gz
MCSYM-DB/6/AGAAAU/
MCSYM-DB/6/AGAAAU/6-AGAAAU.mcs
MCSYM-DB/6/AGAAAU/ss-6-AGAAAU_x.pdb.gz
MCSYM-DB/6/AGAACA/
MCSYM-DB/6/AGAACA/6-AGAACA.mcs
MCSYM-DB/6/AGAACA/ss-6-AGAACA_x.pdb.gz
MCSYM-DB/6/AGAACG/
MCSYM-DB/6/AGAACG/6-AGAACG.mcs
MCSYM-DB/6/AGAACG/ss-6-AGAACG_x.pdb.gz
MCSYM-DB/6/AGAAGA/
MCSYM-DB/6/AGAAGA/6-AGAAGA.mcs
MCSYM-DB/6/AGAAGA/ss-6-AGAAGA_x.pdb.gz
MCSYM-DB/6/AGAAGC/
MCSYM-DB/6/AGAAGC/6-AGAAGC.mcs
MCSYM-DB/6/AGAAGC/ss-6-AGAAGC_x.pdb.gz
MCSYM-DB/6/AGAAGG/
MCSYM-DB/6/AGAAGG/6-AGAAGG.mcs
MCSYM-DB/6/AGAAGG/ss-6-AGAAGG_x.pdb.gz
MCSYM-DB/6/AGAAGU/
MCSYM-DB/6/AGAAGU/6-AGAAGU.mcs
MCSYM-DB/6/AGAAGU/ss-6-AGAAGU_x.pdb.gz
MCSYM-DB/6/AGAAUG/
MCSYM-DB/6/AGAAUG/6-AGAAUG.mcs
MCSYM-DB/6/AGAAUU/
MCSYM-DB/6/AGAAUU/6-AGAAUU.mcs
MCSYM-DB/6/AGAAUU/ss-6-AGAAUU_x.pdb.gz
MCSYM-DB/6/AGACAA/
MCSYM-DB/6/AGACAA/6-AGACAA.mcs
MCSYM-DB/6/AGACAA/ss-6-AGACAA_x.pdb.gz
MCSYM-DB/6/AGACAC/
MCSYM-DB/6/AGACAC/6-AGACAC.mcs
MCSYM-DB/6/AGACAG/
MCSYM-DB/6/AGACAG/6-AGACAG.mcs
MCSYM-DB/6/AGACAG/ss-6-AGACAG_x.pdb.gz
MCSYM-DB/6/AGACAU/
MCSYM-DB/6/AGACAU/6-AGACAU.mcs
MCSYM-DB/6/AGACAU/ss-6-AGACAU_x.pdb.gz
MCSYM-DB/6/AGACCU/
MCSYM-DB/6/AGACCU/6-AGACCU.mcs
MCSYM-DB/6/AGACGG/
MCSYM-DB/6/AGACGG/6-AGACGG.mcs
MCSYM-DB/6/AGACGG/ss-6-AGACGG_x.pdb.gz
MCSYM-DB/6/AGACGU/
MCSYM-DB/6/AGACGU/6-AGACGU.mcs
MCSYM-DB/6/AGACGU/ss-6-AGACGU_x.pdb.gz
MCSYM-DB/6/AGACUG/
MCSYM-DB/6/AGACUG/6-AGACUG.mcs
MCSYM-DB/6/AGACUG/ss-6-AGACUG_x.pdb.gz
MCSYM-DB/6/AGACUU/
MCSYM-DB/6/AGACUU/6-AGACUU.mcs
MCSYM-DB/6/AGACUU/ss-6-AGACUU_x.pdb.gz
MCSYM-DB/6/AGAGAA/
MCSYM-DB/6/AGAGAA/6-AGAGAA.mcs
MCSYM-DB/6/AGAGAA/ss-6-AGAGAA_x.pdb.gz
MCSYM-DB/6/AGAGAG/
MCSYM-DB/6/AGAGAG/6-AGAGAG.mcs
MCSYM-DB/6/AGAGAG/ss-6-AGAGAG_x.pdb.gz
MCSYM-DB/6/AGAGAU/
MCSYM-DB/6/AGAGAU/6-AGAGAU.mcs
MCSYM-DB/6/AGAGAU/ss-6-AGAGAU_x.pdb.gz
MCSYM-DB/6/AGAGCA/
MCSYM-DB/6/AGAGCA/6-AGAGCA.mcs
MCSYM-DB/6/AGAGCA/ss-6-AGAGCA_x.pdb.gz
MCSYM-DB/6/AGAGCU/
MCSYM-DB/6/AGAGCU/6-AGAGCU.mcs
MCSYM-DB/6/AGAGCU/ss-6-AGAGCU_x.pdb.gz
MCSYM-DB/6/AGAGGA/
MCSYM-DB/6/AGAGGA/6-AGAGGA.mcs
MCSYM-DB/6/AGAGGC/
MCSYM-DB/6/AGAGGC/6-AGAGGC.mcs
MCSYM-DB/6/AGAGGC/ss-6-AGAGGC_x.pdb.gz
MCSYM-DB/6/AGAGGG/
MCSYM-DB/6/AGAGGG/6-AGAGGG.mcs
MCSYM-DB/6/AGAGGG/ss-6-AGAGGG_x.pdb.gz
MCSYM-DB/6/AGAGGU/
MCSYM-DB/6/AGAGGU/6-AGAGGU.mcs
MCSYM-DB/6/AGAGGU/ss-6-AGAGGU_x.pdb.gz
MCSYM-DB/6/AGAGUA/
MCSYM-DB/6/AGAGUA/6-AGAGUA.mcs
MCSYM-DB/6/AGAGUU/
MCSYM-DB/6/AGAGUU/6-AGAGUU.mcs
MCSYM-DB/6/AGAUAG/
MCSYM-DB/6/AGAUAG/6-AGAUAG.mcs
MCSYM-DB/6/AGAUAG/ss-6-AGAUAG_x.pdb.gz
MCSYM-DB/6/AGAUAU/
MCSYM-DB/6/AGAUAU/6-AGAUAU.mcs
MCSYM-DB/6/AGAUAU/ss-6-AGAUAU_x.pdb.gz
MCSYM-DB/6/AGAUGC/
MCSYM-DB/6/AGAUGC/6-AGAUGC.mcs
MCSYM-DB/6/AGAUGG/
MCSYM-DB/6/AGAUGG/6-AGAUGG.mcs
MCSYM-DB/6/AGAUGG/ss-6-AGAUGG_x.pdb.gz
MCSYM-DB/6/AGAUGU/
MCSYM-DB/6/AGAUGU/6-AGAUGU.mcs
MCSYM-DB/6/AGAUGU/ss-6-AGAUGU_x.pdb.gz
MCSYM-DB/6/AGAUUC/
MCSYM-DB/6/AGAUUC/6-AGAUUC.mcs
MCSYM-DB/6/AGAUUC/ss-6-AGAUUC_x.pdb.gz
MCSYM-DB/6/AGCAAA/
MCSYM-DB/6/AGCAAA/6-AGCAAA.mcs
MCSYM-DB/6/AGCAAA/ss-6-AGCAAA_x.pdb.gz
MCSYM-DB/6/AGCAAU/
MCSYM-DB/6/AGCAAU/6-AGCAAU.mcs
MCSYM-DB/6/AGCAAU/ss-6-AGCAAU_x.pdb.gz
MCSYM-DB/6/AGCACU/
MCSYM-DB/6/AGCACU/6-AGCACU.mcs
MCSYM-DB/6/AGCAGC/
MCSYM-DB/6/AGCAGC/6-AGCAGC.mcs
MCSYM-DB/6/AGCAGC/ss-6-AGCAGC_x.pdb.gz
MCSYM-DB/6/AGCAGG/
MCSYM-DB/6/AGCAGG/6-AGCAGG.mcs
MCSYM-DB/6/AGCAGG/ss-6-AGCAGG_x.pdb.gz
MCSYM-DB/6/AGCAGU/
MCSYM-DB/6/AGCAGU/1IDV_model_1.pdb.gz
MCSYM-DB/6/AGCAGU/6-AGCAGU.mcs
MCSYM-DB/6/AGCAGU/ss-6-AGCAGU_x.pdb.gz
MCSYM-DB/6/AGCAUA/
MCSYM-DB/6/AGCAUA/6-AGCAUA.mcs
MCSYM-DB/6/AGCAUU/
MCSYM-DB/6/AGCAUU/6-AGCAUU.mcs
MCSYM-DB/6/AGCCAA/
MCSYM-DB/6/AGCCAA/6-AGCCAA.mcs
MCSYM-DB/6/AGCCAA/ss-6-AGCCAA_x.pdb.gz
MCSYM-DB/6/AGCCAG/
MCSYM-DB/6/AGCCAG/6-AGCCAG.mcs
MCSYM-DB/6/AGCCAU/
MCSYM-DB/6/AGCCAU/6-AGCCAU.mcs
MCSYM-DB/6/AGCCCC/
MCSYM-DB/6/AGCCCC/6-AGCCCC.mcs
MCSYM-DB/6/AGCCCC/ss-6-AGCCCC_x.pdb.gz
MCSYM-DB/6/AGCCGA/
MCSYM-DB/6/AGCCGA/6-AGCCGA.mcs
MCSYM-DB/6/AGCCGA/ss-6-AGCCGA_x.pdb.gz
MCSYM-DB/6/AGCCGG/
MCSYM-DB/6/AGCCGG/6-AGCCGG.mcs
MCSYM-DB/6/AGCCGG/ss-6-AGCCGG_x.pdb.gz
MCSYM-DB/6/AGCCGU/
MCSYM-DB/6/AGCCGU/6-AGCCGU.mcs
MCSYM-DB/6/AGCCGU/ss-6-AGCCGU_x.pdb.gz
MCSYM-DB/6/AGCCUG/
MCSYM-DB/6/AGCCUG/6-AGCCUG.mcs
MCSYM-DB/6/AGCCUU/
MCSYM-DB/6/AGCCUU/6-AGCCUU.mcs
MCSYM-DB/6/AGCGAU/
MCSYM-DB/6/AGCGAU/6-AGCGAU.mcs
MCSYM-DB/6/AGCGAU/ss-6-AGCGAU_x.pdb.gz
MCSYM-DB/6/AGCGCU/
MCSYM-DB/6/AGCGCU/6-AGCGCU.mcs
MCSYM-DB/6/AGCGCU/ss-6-AGCGCU_x.pdb.gz
MCSYM-DB/6/AGCGGC/
MCSYM-DB/6/AGCGGC/6-AGCGGC.mcs
MCSYM-DB/6/AGCGGC/ss-6-AGCGGC_x.pdb.gz
MCSYM-DB/6/AGCGGG/
MCSYM-DB/6/AGCGGG/6-AGCGGG.mcs
MCSYM-DB/6/AGCGGG/ss-6-AGCGGG_x.pdb.gz
MCSYM-DB/6/AGCGUC/
MCSYM-DB/6/AGCGUC/6-AGCGUC.mcs
MCSYM-DB/6/AGCGUC/ss-6-AGCGUC_x.pdb.gz
MCSYM-DB/6/AGCUAA/
MCSYM-DB/6/AGCUAA/6-AGCUAA.mcs
MCSYM-DB/6/AGCUAU/
MCSYM-DB/6/AGCUAU/6-AGCUAU.mcs
MCSYM-DB/6/AGCUAU/ss-6-AGCUAU_x.pdb.gz
MCSYM-DB/6/AGCUCU/
MCSYM-DB/6/AGCUCU/6-AGCUCU.mcs
MCSYM-DB/6/AGCUGA/
MCSYM-DB/6/AGCUGA/6-AGCUGA.mcs
MCSYM-DB/6/AGCUGC/
MCSYM-DB/6/AGCUGC/6-AGCUGC.mcs
MCSYM-DB/6/AGCUGC/ss-6-AGCUGC_x.pdb.gz
MCSYM-DB/6/AGCUGG/
MCSYM-DB/6/AGCUGG/6-AGCUGG.mcs
MCSYM-DB/6/AGCUGG/ss-6-AGCUGG_x.pdb.gz
MCSYM-DB/6/AGCUGU/
MCSYM-DB/6/AGCUGU/6-AGCUGU.mcs
MCSYM-DB/6/AGCUGU/ss-6-AGCUGU_x.pdb.gz
MCSYM-DB/6/AGCUUA/
MCSYM-DB/6/AGCUUA/6-AGCUUA.mcs
MCSYM-DB/6/AGCUUU/
MCSYM-DB/6/AGCUUU/6-AGCUUU.mcs
MCSYM-DB/6/AGCUUU/ss-6-AGCUUU_x.pdb.gz
MCSYM-DB/6/AGGAAG/
MCSYM-DB/6/AGGAAG/6-AGGAAG.mcs
MCSYM-DB/6/AGGAAG/ss-6-AGGAAG_x.pdb.gz
MCSYM-DB/6/AGGAAU/
MCSYM-DB/6/AGGAAU/6-AGGAAU.mcs
MCSYM-DB/6/AGGAGA/
MCSYM-DB/6/AGGAGA/6-AGGAGA.mcs
MCSYM-DB/6/AGGAGA/ss-6-AGGAGA_x.pdb.gz
MCSYM-DB/6/AGGAGG/
MCSYM-DB/6/AGGAGG/6-AGGAGG.mcs
MCSYM-DB/6/AGGAGG/ss-6-AGGAGG_x.pdb.gz
MCSYM-DB/6/AGGAGU/
MCSYM-DB/6/AGGAGU/6-AGGAGU.mcs
MCSYM-DB/6/AGGAGU/ss-6-AGGAGU_x.pdb.gz
MCSYM-DB/6/AGGAUU/
MCSYM-DB/6/AGGAUU/6-AGGAUU.mcs
MCSYM-DB/6/AGGAUU/ss-6-AGGAUU_x.pdb.gz
MCSYM-DB/6/AGGCAG/
MCSYM-DB/6/AGGCAG/6-AGGCAG.mcs
MCSYM-DB/6/AGGCAG/ss-6-AGGCAG_x.pdb.gz
MCSYM-DB/6/AGGCGG/
MCSYM-DB/6/AGGCGG/6-AGGCGG.mcs
MCSYM-DB/6/AGGCGG/ss-6-AGGCGG_x.pdb.gz
MCSYM-DB/6/AGGCGU/
MCSYM-DB/6/AGGCGU/6-AGGCGU.mcs
MCSYM-DB/6/AGGCGU/ss-6-AGGCGU_x.pdb.gz
MCSYM-DB/6/AGGCUA/
MCSYM-DB/6/AGGCUA/6-AGGCUA.mcs
MCSYM-DB/6/AGGCUA/ss-6-AGGCUA_x.pdb.gz
MCSYM-DB/6/AGGCUU/
MCSYM-DB/6/AGGCUU/6-AGGCUU.mcs
MCSYM-DB/6/AGGCUU/ss-6-AGGCUU_x.pdb.gz
MCSYM-DB/6/AGGGAA/
MCSYM-DB/6/AGGGAA/6-AGGGAA.mcs
MCSYM-DB/6/AGGGAG/
MCSYM-DB/6/AGGGAG/6-AGGGAG.mcs
MCSYM-DB/6/AGGGCA/
MCSYM-DB/6/AGGGCA/6-AGGGCA.mcs
MCSYM-DB/6/AGGGCA/ss-6-AGGGCA_x.pdb.gz
MCSYM-DB/6/AGGGCU/
MCSYM-DB/6/AGGGCU/6-AGGGCU.mcs
MCSYM-DB/6/AGGGCU/ss-6-AGGGCU_x.pdb.gz
MCSYM-DB/6/AGGGGC/
MCSYM-DB/6/AGGGGC/6-AGGGGC.mcs
MCSYM-DB/6/AGGGGG/
MCSYM-DB/6/AGGGGG/6-AGGGGG.mcs
MCSYM-DB/6/AGGGGG/ss-6-AGGGGG_x.pdb.gz
MCSYM-DB/6/AGGGGU/
MCSYM-DB/6/AGGGGU/6-AGGGGU.mcs
MCSYM-DB/6/AGGGGU/ss-6-AGGGGU_x.pdb.gz
MCSYM-DB/6/AGGGUC/
MCSYM-DB/6/AGGGUC/6-AGGGUC.mcs
MCSYM-DB/6/AGGGUU/
MCSYM-DB/6/AGGGUU/6-AGGGUU.mcs
MCSYM-DB/6/AGGUAU/
MCSYM-DB/6/AGGUAU/6-AGGUAU.mcs
MCSYM-DB/6/AGGUAU/ss-6-AGGUAU_x.pdb.gz
MCSYM-DB/6/AGGUCC/
MCSYM-DB/6/AGGUCC/6