Unarchive the mcfold.tar.gz file, create the mcfold directory,
which contains the MCFOLD-DB directory and mcfold.static.exe
file.

Launch MC-Fold: ./mcfold.static.exe

This will return all options.

QUERY_STRING and most useful options:

Input is done through the shell's environment variable QUERY_STRING.

For example: setenv QUERY_STRING "pass=lucy&sequence=CCCGAAAGGG"

Useful options:

*** pseudoknotted, pseudoknot option
    setenv QUERY_STRING "pass=lucy&sequence=...&pseudoknotted=true"

*** top, number of sub-optimal solutions
    setenv QUERY_STRING "pass=lucy&sequence=...&top=100"

*** explore, percent of suboptimal search space
    setenv QUERY_STRING "pass=lucy&sequence=...&explore=15"

*** name, sequence name option
    setenv QUERY_STRING "pass=lucy&sequence=...&name=HCV_seq03"

*** mask, base pairing and single-stranded constraints
    setenv QUERY_STRING "pass=lucy&sequence=...&mask=(**(..)**)"

*** convert, consider single-stranded bases as unconstrained 
    setenv QUERY_STRING "pass=lucy&sequence=...&convert=true"


To see all options, unset the QUERY_STRING variable and run
the program, ./mcfold.static.exe

Notes:

   MC-Fold accesses it's databases through the open instruction:
         open( MCFOLD-DB/* )
   so make sure that the MCFOLD-DB folder is
   accessible from where MC-Fold is launched.

   We suggest you redirect the output to a file;
   ./mcfold.static.exe > HCV_seq03.data

Here is an example, where the secondary structure has been first
obtained with RNAfold (Hofacker. NAR 2003), then submitted to MC-Fold
with the secondary structure as constraints:

setenv QUERY_STRING 
"pass=lucy&sequence=UGCCUGGCGGCCUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU&mask=((((((((((.........((((....)))).((((((((((.....(((....)))...(((((.......))))).))))))))))..(((.(((....))))))..)))))))))).&convert=true&explore=7&name=5S_rRNA"
./mcfold.static.exe > 5S_rRNA.data

Do not hesitate to send questions to:

Francois Major: major@iro.umontreal.ca
Marc Parisien: parisien@iro.umontreal.ca

Citing MC-Fold:

Parisien M, Major F. Nature (2008) 452:51-55.